ID: 1081832783

View in Genome Browser
Species Human (GRCh38)
Location 11:46128171-46128193
Sequence TGGGCGGATCACCTAAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081832783_1081832793 8 Left 1081832783 11:46128171-46128193 CCTGACCTTAGGTGATCCGCCCA No data
Right 1081832793 11:46128202-46128224 TCCCAAAGTGCTGGGATTACAGG No data
1081832783_1081832796 27 Left 1081832783 11:46128171-46128193 CCTGACCTTAGGTGATCCGCCCA No data
Right 1081832796 11:46128221-46128243 CAGGTGTGAGCCACTGCACTCGG No data
1081832783_1081832789 -1 Left 1081832783 11:46128171-46128193 CCTGACCTTAGGTGATCCGCCCA No data
Right 1081832789 11:46128193-46128215 ACCTCGGCCTCCCAAAGTGCTGG No data
1081832783_1081832791 0 Left 1081832783 11:46128171-46128193 CCTGACCTTAGGTGATCCGCCCA No data
Right 1081832791 11:46128194-46128216 CCTCGGCCTCCCAAAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081832783 Original CRISPR TGGGCGGATCACCTAAGGTC AGG (reversed) Intergenic