ID: 1081832784

View in Genome Browser
Species Human (GRCh38)
Location 11:46128176-46128198
Sequence CGAGGTGGGCGGATCACCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081832784_1081832791 -5 Left 1081832784 11:46128176-46128198 CCTTAGGTGATCCGCCCACCTCG No data
Right 1081832791 11:46128194-46128216 CCTCGGCCTCCCAAAGTGCTGGG No data
1081832784_1081832796 22 Left 1081832784 11:46128176-46128198 CCTTAGGTGATCCGCCCACCTCG No data
Right 1081832796 11:46128221-46128243 CAGGTGTGAGCCACTGCACTCGG No data
1081832784_1081832789 -6 Left 1081832784 11:46128176-46128198 CCTTAGGTGATCCGCCCACCTCG No data
Right 1081832789 11:46128193-46128215 ACCTCGGCCTCCCAAAGTGCTGG No data
1081832784_1081832793 3 Left 1081832784 11:46128176-46128198 CCTTAGGTGATCCGCCCACCTCG No data
Right 1081832793 11:46128202-46128224 TCCCAAAGTGCTGGGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081832784 Original CRISPR CGAGGTGGGCGGATCACCTA AGG (reversed) Intergenic