ID: 1081832786

View in Genome Browser
Species Human (GRCh38)
Location 11:46128187-46128209
Sequence CTTTGGGAGGCCGAGGTGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081832786_1081832796 11 Left 1081832786 11:46128187-46128209 CCGCCCACCTCGGCCTCCCAAAG No data
Right 1081832796 11:46128221-46128243 CAGGTGTGAGCCACTGCACTCGG No data
1081832786_1081832793 -8 Left 1081832786 11:46128187-46128209 CCGCCCACCTCGGCCTCCCAAAG No data
Right 1081832793 11:46128202-46128224 TCCCAAAGTGCTGGGATTACAGG No data
1081832786_1081832797 20 Left 1081832786 11:46128187-46128209 CCGCCCACCTCGGCCTCCCAAAG No data
Right 1081832797 11:46128230-46128252 GCCACTGCACTCGGCCTCACTGG No data
1081832786_1081832799 29 Left 1081832786 11:46128187-46128209 CCGCCCACCTCGGCCTCCCAAAG No data
Right 1081832799 11:46128239-46128261 CTCGGCCTCACTGGATTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081832786 Original CRISPR CTTTGGGAGGCCGAGGTGGG CGG (reversed) Intergenic