ID: 1081832787

View in Genome Browser
Species Human (GRCh38)
Location 11:46128190-46128212
Sequence GCACTTTGGGAGGCCGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081832787_1081832797 17 Left 1081832787 11:46128190-46128212 CCCACCTCGGCCTCCCAAAGTGC No data
Right 1081832797 11:46128230-46128252 GCCACTGCACTCGGCCTCACTGG No data
1081832787_1081832799 26 Left 1081832787 11:46128190-46128212 CCCACCTCGGCCTCCCAAAGTGC No data
Right 1081832799 11:46128239-46128261 CTCGGCCTCACTGGATTGTTTGG No data
1081832787_1081832796 8 Left 1081832787 11:46128190-46128212 CCCACCTCGGCCTCCCAAAGTGC No data
Right 1081832796 11:46128221-46128243 CAGGTGTGAGCCACTGCACTCGG No data
1081832787_1081832801 30 Left 1081832787 11:46128190-46128212 CCCACCTCGGCCTCCCAAAGTGC No data
Right 1081832801 11:46128243-46128265 GCCTCACTGGATTGTTTGGAGGG No data
1081832787_1081832800 29 Left 1081832787 11:46128190-46128212 CCCACCTCGGCCTCCCAAAGTGC No data
Right 1081832800 11:46128242-46128264 GGCCTCACTGGATTGTTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081832787 Original CRISPR GCACTTTGGGAGGCCGAGGT GGG (reversed) Intergenic