ID: 1081832795

View in Genome Browser
Species Human (GRCh38)
Location 11:46128204-46128226
Sequence CACCTGTAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 901149
Summary {0: 68945, 1: 203244, 2: 249087, 3: 204446, 4: 175427}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081832795_1081832797 3 Left 1081832795 11:46128204-46128226 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 1081832797 11:46128230-46128252 GCCACTGCACTCGGCCTCACTGG No data
1081832795_1081832801 16 Left 1081832795 11:46128204-46128226 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 1081832801 11:46128243-46128265 GCCTCACTGGATTGTTTGGAGGG No data
1081832795_1081832800 15 Left 1081832795 11:46128204-46128226 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 1081832800 11:46128242-46128264 GGCCTCACTGGATTGTTTGGAGG No data
1081832795_1081832799 12 Left 1081832795 11:46128204-46128226 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 1081832799 11:46128239-46128261 CTCGGCCTCACTGGATTGTTTGG No data
1081832795_1081832796 -6 Left 1081832795 11:46128204-46128226 CCAAAGTGCTGGGATTACAGGTG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427
Right 1081832796 11:46128221-46128243 CAGGTGTGAGCCACTGCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081832795 Original CRISPR CACCTGTAATCCCAGCACTT TGG (reversed) Intergenic