ID: 1081832796

View in Genome Browser
Species Human (GRCh38)
Location 11:46128221-46128243
Sequence CAGGTGTGAGCCACTGCACT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081832786_1081832796 11 Left 1081832786 11:46128187-46128209 CCGCCCACCTCGGCCTCCCAAAG No data
Right 1081832796 11:46128221-46128243 CAGGTGTGAGCCACTGCACTCGG No data
1081832792_1081832796 -2 Left 1081832792 11:46128200-46128222 CCTCCCAAAGTGCTGGGATTACA No data
Right 1081832796 11:46128221-46128243 CAGGTGTGAGCCACTGCACTCGG No data
1081832794_1081832796 -5 Left 1081832794 11:46128203-46128225 CCCAAAGTGCTGGGATTACAGGT No data
Right 1081832796 11:46128221-46128243 CAGGTGTGAGCCACTGCACTCGG No data
1081832795_1081832796 -6 Left 1081832795 11:46128204-46128226 CCAAAGTGCTGGGATTACAGGTG No data
Right 1081832796 11:46128221-46128243 CAGGTGTGAGCCACTGCACTCGG No data
1081832787_1081832796 8 Left 1081832787 11:46128190-46128212 CCCACCTCGGCCTCCCAAAGTGC No data
Right 1081832796 11:46128221-46128243 CAGGTGTGAGCCACTGCACTCGG No data
1081832788_1081832796 7 Left 1081832788 11:46128191-46128213 CCACCTCGGCCTCCCAAAGTGCT No data
Right 1081832796 11:46128221-46128243 CAGGTGTGAGCCACTGCACTCGG No data
1081832790_1081832796 4 Left 1081832790 11:46128194-46128216 CCTCGGCCTCCCAAAGTGCTGGG No data
Right 1081832796 11:46128221-46128243 CAGGTGTGAGCCACTGCACTCGG No data
1081832784_1081832796 22 Left 1081832784 11:46128176-46128198 CCTTAGGTGATCCGCCCACCTCG No data
Right 1081832796 11:46128221-46128243 CAGGTGTGAGCCACTGCACTCGG No data
1081832783_1081832796 27 Left 1081832783 11:46128171-46128193 CCTGACCTTAGGTGATCCGCCCA No data
Right 1081832796 11:46128221-46128243 CAGGTGTGAGCCACTGCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081832796 Original CRISPR CAGGTGTGAGCCACTGCACT CGG Intergenic