ID: 1081832799

View in Genome Browser
Species Human (GRCh38)
Location 11:46128239-46128261
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081832787_1081832799 26 Left 1081832787 11:46128190-46128212 CCCACCTCGGCCTCCCAAAGTGC No data
Right 1081832799 11:46128239-46128261 CTCGGCCTCACTGGATTGTTTGG No data
1081832795_1081832799 12 Left 1081832795 11:46128204-46128226 CCAAAGTGCTGGGATTACAGGTG No data
Right 1081832799 11:46128239-46128261 CTCGGCCTCACTGGATTGTTTGG No data
1081832786_1081832799 29 Left 1081832786 11:46128187-46128209 CCGCCCACCTCGGCCTCCCAAAG No data
Right 1081832799 11:46128239-46128261 CTCGGCCTCACTGGATTGTTTGG No data
1081832790_1081832799 22 Left 1081832790 11:46128194-46128216 CCTCGGCCTCCCAAAGTGCTGGG No data
Right 1081832799 11:46128239-46128261 CTCGGCCTCACTGGATTGTTTGG No data
1081832788_1081832799 25 Left 1081832788 11:46128191-46128213 CCACCTCGGCCTCCCAAAGTGCT No data
Right 1081832799 11:46128239-46128261 CTCGGCCTCACTGGATTGTTTGG No data
1081832794_1081832799 13 Left 1081832794 11:46128203-46128225 CCCAAAGTGCTGGGATTACAGGT No data
Right 1081832799 11:46128239-46128261 CTCGGCCTCACTGGATTGTTTGG No data
1081832792_1081832799 16 Left 1081832792 11:46128200-46128222 CCTCCCAAAGTGCTGGGATTACA No data
Right 1081832799 11:46128239-46128261 CTCGGCCTCACTGGATTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081832799 Original CRISPR CTCGGCCTCACTGGATTGTT TGG Intergenic