ID: 1081834815

View in Genome Browser
Species Human (GRCh38)
Location 11:46144756-46144778
Sequence TCCAGGGCTGTGCCCCCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081834815_1081834823 12 Left 1081834815 11:46144756-46144778 CCCATTGGGGGCACAGCCCTGGA No data
Right 1081834823 11:46144791-46144813 GGAATGTGTGGTGCTAAAGTGGG No data
1081834815_1081834822 11 Left 1081834815 11:46144756-46144778 CCCATTGGGGGCACAGCCCTGGA No data
Right 1081834822 11:46144790-46144812 TGGAATGTGTGGTGCTAAAGTGG No data
1081834815_1081834828 25 Left 1081834815 11:46144756-46144778 CCCATTGGGGGCACAGCCCTGGA No data
Right 1081834828 11:46144804-46144826 CTAAAGTGGGGCTGGGGCCCAGG No data
1081834815_1081834817 -9 Left 1081834815 11:46144756-46144778 CCCATTGGGGGCACAGCCCTGGA No data
Right 1081834817 11:46144770-46144792 AGCCCTGGACTTCCTCACTCTGG No data
1081834815_1081834824 13 Left 1081834815 11:46144756-46144778 CCCATTGGGGGCACAGCCCTGGA No data
Right 1081834824 11:46144792-46144814 GAATGTGTGGTGCTAAAGTGGGG No data
1081834815_1081834826 18 Left 1081834815 11:46144756-46144778 CCCATTGGGGGCACAGCCCTGGA No data
Right 1081834826 11:46144797-46144819 TGTGGTGCTAAAGTGGGGCTGGG No data
1081834815_1081834827 19 Left 1081834815 11:46144756-46144778 CCCATTGGGGGCACAGCCCTGGA No data
Right 1081834827 11:46144798-46144820 GTGGTGCTAAAGTGGGGCTGGGG No data
1081834815_1081834825 17 Left 1081834815 11:46144756-46144778 CCCATTGGGGGCACAGCCCTGGA No data
Right 1081834825 11:46144796-46144818 GTGTGGTGCTAAAGTGGGGCTGG No data
1081834815_1081834820 0 Left 1081834815 11:46144756-46144778 CCCATTGGGGGCACAGCCCTGGA No data
Right 1081834820 11:46144779-46144801 CTTCCTCACTCTGGAATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081834815 Original CRISPR TCCAGGGCTGTGCCCCCAAT GGG (reversed) Intergenic
No off target data available for this crispr