ID: 1081840976

View in Genome Browser
Species Human (GRCh38)
Location 11:46201208-46201230
Sequence GGGAAGTCCTAGAACTCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081840976_1081840980 -3 Left 1081840976 11:46201208-46201230 CCAGGAGAGTTCTAGGACTTCCC No data
Right 1081840980 11:46201228-46201250 CCCAAGGCCCGTAGGTCCATTGG No data
1081840976_1081840982 2 Left 1081840976 11:46201208-46201230 CCAGGAGAGTTCTAGGACTTCCC No data
Right 1081840982 11:46201233-46201255 GGCCCGTAGGTCCATTGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081840976 Original CRISPR GGGAAGTCCTAGAACTCTCC TGG (reversed) Intergenic
No off target data available for this crispr