ID: 1081851251

View in Genome Browser
Species Human (GRCh38)
Location 11:46276702-46276724
Sequence CCTTTCACACAGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081851244_1081851251 1 Left 1081851244 11:46276678-46276700 CCTATCTCTGGCTGTTCACCCAG No data
Right 1081851251 11:46276702-46276724 CCTTTCACACAGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081851251 Original CRISPR CCTTTCACACAGAGGGAAGC TGG Intergenic
No off target data available for this crispr