ID: 1081851739

View in Genome Browser
Species Human (GRCh38)
Location 11:46278760-46278782
Sequence GGGGCTGGGAAGAGGCGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 682
Summary {0: 1, 1: 0, 2: 2, 3: 59, 4: 620}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081851723_1081851739 5 Left 1081851723 11:46278732-46278754 CCCCACCCCAGGGAGGGACCTGA 0: 1
1: 1
2: 4
3: 39
4: 304
Right 1081851739 11:46278760-46278782 GGGGCTGGGAAGAGGCGGTCAGG 0: 1
1: 0
2: 2
3: 59
4: 620
1081851713_1081851739 29 Left 1081851713 11:46278708-46278730 CCCAGGGAATCAGGCCCAGAGAC 0: 1
1: 0
2: 2
3: 34
4: 300
Right 1081851739 11:46278760-46278782 GGGGCTGGGAAGAGGCGGTCAGG 0: 1
1: 0
2: 2
3: 59
4: 620
1081851721_1081851739 7 Left 1081851721 11:46278730-46278752 CCCCCCACCCCAGGGAGGGACCT 0: 1
1: 1
2: 5
3: 42
4: 395
Right 1081851739 11:46278760-46278782 GGGGCTGGGAAGAGGCGGTCAGG 0: 1
1: 0
2: 2
3: 59
4: 620
1081851730_1081851739 -2 Left 1081851730 11:46278739-46278761 CCAGGGAGGGACCTGAGGCTGGG 0: 1
1: 1
2: 10
3: 96
4: 756
Right 1081851739 11:46278760-46278782 GGGGCTGGGAAGAGGCGGTCAGG 0: 1
1: 0
2: 2
3: 59
4: 620
1081851712_1081851739 30 Left 1081851712 11:46278707-46278729 CCCCAGGGAATCAGGCCCAGAGA 0: 1
1: 0
2: 6
3: 62
4: 371
Right 1081851739 11:46278760-46278782 GGGGCTGGGAAGAGGCGGTCAGG 0: 1
1: 0
2: 2
3: 59
4: 620
1081851724_1081851739 4 Left 1081851724 11:46278733-46278755 CCCACCCCAGGGAGGGACCTGAG 0: 1
1: 0
2: 4
3: 36
4: 370
Right 1081851739 11:46278760-46278782 GGGGCTGGGAAGAGGCGGTCAGG 0: 1
1: 0
2: 2
3: 59
4: 620
1081851714_1081851739 28 Left 1081851714 11:46278709-46278731 CCAGGGAATCAGGCCCAGAGACC 0: 1
1: 0
2: 4
3: 17
4: 247
Right 1081851739 11:46278760-46278782 GGGGCTGGGAAGAGGCGGTCAGG 0: 1
1: 0
2: 2
3: 59
4: 620
1081851725_1081851739 3 Left 1081851725 11:46278734-46278756 CCACCCCAGGGAGGGACCTGAGG 0: 1
1: 0
2: 3
3: 36
4: 326
Right 1081851739 11:46278760-46278782 GGGGCTGGGAAGAGGCGGTCAGG 0: 1
1: 0
2: 2
3: 59
4: 620
1081851716_1081851739 15 Left 1081851716 11:46278722-46278744 CCCAGAGACCCCCCACCCCAGGG 0: 1
1: 1
2: 6
3: 58
4: 467
Right 1081851739 11:46278760-46278782 GGGGCTGGGAAGAGGCGGTCAGG 0: 1
1: 0
2: 2
3: 59
4: 620
1081851728_1081851739 -1 Left 1081851728 11:46278738-46278760 CCCAGGGAGGGACCTGAGGCTGG 0: 1
1: 1
2: 12
3: 52
4: 423
Right 1081851739 11:46278760-46278782 GGGGCTGGGAAGAGGCGGTCAGG 0: 1
1: 0
2: 2
3: 59
4: 620
1081851722_1081851739 6 Left 1081851722 11:46278731-46278753 CCCCCACCCCAGGGAGGGACCTG 0: 1
1: 1
2: 4
3: 53
4: 548
Right 1081851739 11:46278760-46278782 GGGGCTGGGAAGAGGCGGTCAGG 0: 1
1: 0
2: 2
3: 59
4: 620
1081851727_1081851739 0 Left 1081851727 11:46278737-46278759 CCCCAGGGAGGGACCTGAGGCTG 0: 1
1: 1
2: 3
3: 49
4: 439
Right 1081851739 11:46278760-46278782 GGGGCTGGGAAGAGGCGGTCAGG 0: 1
1: 0
2: 2
3: 59
4: 620
1081851718_1081851739 14 Left 1081851718 11:46278723-46278745 CCAGAGACCCCCCACCCCAGGGA 0: 2
1: 0
2: 8
3: 68
4: 539
Right 1081851739 11:46278760-46278782 GGGGCTGGGAAGAGGCGGTCAGG 0: 1
1: 0
2: 2
3: 59
4: 620

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081851739 Original CRISPR GGGGCTGGGAAGAGGCGGTC AGG Intronic