ID: 1081852740

View in Genome Browser
Species Human (GRCh38)
Location 11:46285101-46285123
Sequence CCTCTCCTGGTGCAGTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 381}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081852740 Original CRISPR CCTCTCCTGGTGCAGTAGCC AGG (reversed) Intronic
901133793 1:6979832-6979854 CCTCTCATGGTGGTGTAGCTGGG + Intronic
901843946 1:11970799-11970821 CCCACCCTGGTGTAGTAGCCGGG - Exonic
901963652 1:12848079-12848101 CCTCTCCTGCTACAGCAGCCCGG + Exonic
901984244 1:13061513-13061535 CCTCTCCTGCTACAGCAGCCCGG - Exonic
901991296 1:13116190-13116212 CCTCTCCTGCTACAGCAGCCCGG + Intergenic
901997567 1:13165257-13165279 CCTCTCCTGCTACAGCAGCCCGG + Exonic
902459237 1:16560065-16560087 CCTCTCCTGTTGCAAAAGCTTGG - Intergenic
903152433 1:21420747-21420769 CCTCTCCTGTTGCAAAAGCTTGG - Intergenic
904335585 1:29795503-29795525 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
904613622 1:31738385-31738407 CCTGTCCTTGGGCAGTGGCCAGG - Intronic
905353746 1:37366305-37366327 CCTCTCCTGAGGCAGTTGCCAGG + Intergenic
906867755 1:49441032-49441054 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
907596998 1:55729181-55729203 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
908737240 1:67289623-67289645 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
909673191 1:78211699-78211721 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
909843991 1:80367272-80367294 CCTCACCCACTGCAGTAGCCTGG - Intergenic
910460590 1:87444502-87444524 CCTCTACTGGTGCAGTATGGAGG - Intergenic
910587877 1:88899257-88899279 CCTCTCCTGAGACAGTTGCCAGG + Intergenic
910831486 1:91466185-91466207 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
910948093 1:92615694-92615716 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
910995669 1:93102014-93102036 CCTCTCCTGATTAAGCAGCCAGG - Intronic
911310750 1:96289341-96289363 CCTCTCCTGGGGCTCCAGCCTGG - Intergenic
912470011 1:109900396-109900418 CCCATCCTGGTGCAGAGGCCTGG + Intergenic
912733652 1:112131295-112131317 CCTCTCCTGAGGCAGTTGCCAGG - Intergenic
912944152 1:114070645-114070667 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
913211558 1:116586947-116586969 CCTCTGCTGGTGCATTAAACAGG - Intronic
913349536 1:117842503-117842525 CCTCTCCTGGGGCCTCAGCCTGG + Intergenic
913542016 1:119830606-119830628 CCTCTCCTGCTGCAAAAGCTTGG - Intergenic
914317824 1:146530770-146530792 CCTCTACTGGTGCAGTATGGAGG - Intergenic
914409603 1:147413633-147413655 CCCCTCCTTGTGCTGTGGCCTGG + Intergenic
914490702 1:148148737-148148759 CCGTTCCTGGTGCACTGGCCAGG - Intronic
914496532 1:148202588-148202610 CCTCTACTGGTGCAGTATGGAGG + Intergenic
915551429 1:156637468-156637490 CCTCTGCTGCTCCAGTAGCTGGG + Intergenic
917082472 1:171270724-171270746 CCTTGCCTGGTGCAGTATGCGGG - Intronic
917217547 1:172693377-172693399 CCTCCCCTGAAGCAGTTGCCAGG - Intergenic
917462399 1:175243744-175243766 CCTCACCTGAGGCAGTTGCCAGG + Intergenic
919414315 1:197288022-197288044 CCTCTCCCTGTGCTGTTGCCCGG - Intronic
919570692 1:199243563-199243585 CCACTCCTGGTGCTGTGGACAGG - Intergenic
919929746 1:202213603-202213625 CCCCTCCTGGTGGAGAAGCAGGG - Intronic
920189876 1:204186822-204186844 CTCTTCCTGGTGGAGTAGCCTGG + Intergenic
920197094 1:204235893-204235915 CCTCCCCTGAAGCAGTTGCCAGG + Intronic
921389833 1:214606479-214606501 CCGTTCCTGGTGCACTGGCCAGG + Intronic
923855248 1:237838947-237838969 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
924841074 1:247710017-247710039 CCTCCCCTGATGCAGTTGCCAGG - Intergenic
924869985 1:248031474-248031496 CCCCTTCTGGGGCAGTAGGCAGG + Intronic
1062770813 10:99150-99172 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1063460948 10:6214778-6214800 CTTCTGCTGGTGCAGCCGCCAGG - Intronic
1064545979 10:16450276-16450298 CCTCTCCTGAGGCAGTTGCCAGG - Intronic
1065917279 10:30364574-30364596 CCTCTCCTGGTGCAGGCTCCAGG + Intronic
1068837566 10:61571066-61571088 CCTCTCCTGAGGCAGATGCCAGG - Intergenic
1069791194 10:71022211-71022233 CCTCCCCTGGGGCAGTTGCCAGG - Intergenic
1071267419 10:83976465-83976487 CCTCCCCTGGGGCAGTTGTCAGG - Intergenic
1073122775 10:101132355-101132377 CCTCTCCGGATCCACTAGCCGGG + Intronic
1073135623 10:101218523-101218545 CCCCTCCTGGTCCCCTAGCCAGG - Intergenic
1073557000 10:104463430-104463452 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1074244617 10:111676391-111676413 CCTCCCCTGAAGCAGTTGCCAGG + Intergenic
1076812859 10:132898351-132898373 CCTCTCCAAGAGCAGGAGCCTGG - Intronic
1076983109 11:215719-215741 CTTCTCCTGGGGCTGTACCCAGG - Exonic
1077270709 11:1678305-1678327 CCTTACCTGGTGCTGAAGCCTGG + Intergenic
1077926417 11:6685956-6685978 CTTCTCTTGGTGCAGCAGGCTGG + Intergenic
1079136914 11:17780517-17780539 CCTTTCTTGGTGCAGCAGACTGG + Intronic
1079630355 11:22666983-22667005 CCGCCCCGGGTGCAGTAGACAGG - Intronic
1081072465 11:38628620-38628642 CCTCCCCTGAGGCAGTTGCCTGG + Intergenic
1081590053 11:44416319-44416341 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1081715206 11:45245165-45245187 GCTCTCTTGGTGCAGTGCCCTGG - Intronic
1081852740 11:46285101-46285123 CCTCTCCTGGTGCAGTAGCCAGG - Intronic
1082671370 11:56040562-56040584 CCTCTCCTAAGGCAGTTGCCAGG + Intergenic
1084422107 11:69065606-69065628 CCTGGCCTGGGGCGGTAGCCAGG + Intronic
1085747247 11:79125756-79125778 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
1086267752 11:85021443-85021465 CCTCTCCTGCTACAGCAGCCCGG + Intronic
1086278302 11:85157979-85158001 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
1086961882 11:92986325-92986347 CCTCTCCTGAGGCAGTTGCCAGG - Intergenic
1088806580 11:113358482-113358504 CCTCTCCTGGGGCCCCAGCCAGG - Intronic
1089747056 11:120624797-120624819 CCTTTCCTGGAGCAGCAGGCAGG - Intronic
1090209982 11:124912258-124912280 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1090221928 11:125034079-125034101 CCTCCCCTGAGGCAGTTGCCAGG - Intronic
1090879409 11:130820532-130820554 CATCACCTGGTGCAGGAGACAGG + Intergenic
1091677477 12:2501708-2501730 CTTCTCCTGGTGCTGAAGTCTGG + Intronic
1092092938 12:5819142-5819164 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
1093032229 12:14298706-14298728 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1096462430 12:51829371-51829393 CCTCTCCTGTTGCAATAACTGGG - Intergenic
1097076531 12:56399002-56399024 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1097843705 12:64345246-64345268 CCTCCCCTGAGGCAGTTGCCAGG - Intronic
1098715720 12:73826953-73826975 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1098805128 12:75013587-75013609 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1099184115 12:79499159-79499181 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1099350694 12:81565220-81565242 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
1099375324 12:81891483-81891505 CCTCTTCTGAGGCAGTTGCCAGG + Intergenic
1099379987 12:81941229-81941251 CCTCTCCTGAGGCAGTTGCCAGG - Intergenic
1099859723 12:88211096-88211118 CCTCCCCTTATGCAGTTGCCAGG - Intergenic
1100926893 12:99558680-99558702 CCTCTCCTGGGGCTCCAGCCTGG - Intronic
1101535016 12:105608598-105608620 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1101818120 12:108161610-108161632 TCTCTCCTGGTTCTGGAGCCTGG - Intronic
1102096843 12:110247698-110247720 CCTCTCCTGGTGCCTCTGCCTGG - Intergenic
1102777219 12:115531028-115531050 GCCCTCCTGGTGCACTTGCCAGG + Intergenic
1102996017 12:117351241-117351263 CCTCTCTTAGTGCTGTAGTCTGG + Intronic
1103396177 12:120608959-120608981 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1103413812 12:120731066-120731088 CCTCACCTCCTGCAGTAGCTGGG + Intronic
1104052608 12:125206197-125206219 CCTTTCCTGGTGCTGTGGCTTGG + Intronic
1107424738 13:40281686-40281708 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1108903924 13:55447197-55447219 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1108914614 13:55591385-55591407 CCTCACCTGAGGCAGTTGCCAGG - Intergenic
1109515963 13:63442822-63442844 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1109713000 13:66183470-66183492 CCTCCCCTGAGGCAGTGGCCAGG - Intergenic
1110451913 13:75646300-75646322 CCTATGCTGTTGCAGTAGCCTGG + Intronic
1113877972 13:113606442-113606464 CCTCTCCTGGTGGAAGGGCCAGG + Intronic
1114183500 14:20383637-20383659 CCTCTCCATGTACAGAAGCCTGG - Exonic
1114285090 14:21233983-21234005 CCTCTCCTGCTACAGCAGCCCGG + Exonic
1114517000 14:23306845-23306867 CGTTTCCTGGTGCAGGAGCTGGG - Exonic
1114758581 14:25286215-25286237 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1116058588 14:39894452-39894474 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1116414751 14:44666824-44666846 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1118478525 14:66141371-66141393 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
1118540078 14:66813821-66813843 CCTGTCCTGGGGCCCTAGCCTGG + Intronic
1118881099 14:69826508-69826530 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1120710762 14:87790695-87790717 CCTCTCCTAGTGTAGTTGCCTGG - Intergenic
1120973327 14:90227961-90227983 CCTCTCTTGAGGCAGTTGCCAGG + Intergenic
1121436134 14:93921420-93921442 CCTGTGCTGGTGAAGTTGCCTGG - Intronic
1121832388 14:97063496-97063518 CCTCTCCTGCTGCCCCAGCCTGG + Intergenic
1122292395 14:100686837-100686859 CCACTCCTGGTGAAGCTGCCTGG - Intergenic
1122996569 14:105268464-105268486 CCTCTCTTGGCCCCGTAGCCTGG - Intronic
1123131982 14:105994531-105994553 CCTCTCCTGGGGCCCTAGCCTGG - Intergenic
1123582218 15:21725661-21725683 CCTCTCCTGGGGCCCTAGCCTGG - Intergenic
1123618868 15:22168257-22168279 CCTCTCCTGGGGCCCTAGCCTGG - Intergenic
1124111966 15:26798840-26798862 GCTCTGCTGGTGTAGTGGCCAGG + Intronic
1126959749 15:53978362-53978384 CCTCTCCTGCCGCCGTAGCACGG - Intergenic
1128788679 15:70416704-70416726 CCTCTCGTGGGGCAGACGCCAGG - Intergenic
1129673976 15:77622439-77622461 ACTCACCTGGTGGAGTGGCCGGG - Intronic
1129912116 15:79236517-79236539 CCTCTCCTGCTCCAGCAGCCCGG - Intergenic
1129961722 15:79692549-79692571 CCTCCCCTGAGGCAGTTGCCGGG - Intergenic
1130142459 15:81239729-81239751 CCTTTCCTGGTGTTTTAGCCAGG + Intronic
1131761052 15:95623017-95623039 TGTCTCCTGTTGCAGTAGTCTGG - Intergenic
1132534748 16:472546-472568 CATCTCCTCGTGAAGAAGCCGGG - Intronic
1133326421 16:4944936-4944958 CCTCTCCTGCTCCAGCTGCCAGG - Intronic
1135186653 16:20321634-20321656 CCTCTCCTGTTCCCTTAGCCTGG - Intronic
1136590377 16:31214752-31214774 CAGCTCCTGGTGCAGGAGGCCGG - Exonic
1136684028 16:31983718-31983740 CCTCTCCTGCTTCAGGACCCCGG + Intergenic
1136784654 16:32927270-32927292 CCTCTCCTGCTTCAGGACCCCGG + Intergenic
1136885129 16:33926536-33926558 CCTCTCCTGCTTCAGGACCCCGG - Intergenic
1137929821 16:52576268-52576290 CTTCACCTGGTGCAGTGGCAAGG - Intergenic
1140597745 16:76436130-76436152 CCTCCCCTGAGGCAGTTGCCAGG - Intronic
1203087313 16_KI270728v1_random:1191276-1191298 CCTCTCCTGCTTCAGGACCCCGG + Intergenic
1145191283 17:20843333-20843355 CCGTTCCTGGTGCACTGGCCAGG - Intronic
1145787800 17:27605350-27605372 CTTCTCCTGGAGCCCTAGCCAGG - Intronic
1145979768 17:29004753-29004775 CTTCTCCCGCTGCAGTAGGCTGG - Intronic
1146237869 17:31185133-31185155 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
1146758500 17:35454667-35454689 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1146836163 17:36112617-36112639 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1146904453 17:36609059-36609081 CCTCTCATGGGGCTGCAGCCAGG - Intergenic
1147135918 17:38434218-38434240 CTTCTCCTGGAGGAGGAGCCAGG + Intronic
1147144954 17:38479421-38479443 CCTCTCCTGCTTCAGGACCCCGG + Exonic
1147861084 17:43523868-43523890 CCTCTCCAGCAGCAGTAGCCAGG + Exonic
1148063766 17:44854088-44854110 CTTATCCTGGTGGTGTAGCCTGG - Intronic
1149236339 17:54594734-54594756 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1150533824 17:66014356-66014378 CCTCTCCTGGGACCATAGCCTGG - Intronic
1156537454 18:37878036-37878058 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1157089951 18:44625578-44625600 CCCCTCCAGGTGCAGCTGCCAGG + Intergenic
1158587820 18:58756519-58756541 CCTCCCCTGGTGGAGTTGCACGG - Intergenic
1158587967 18:58757380-58757402 CCTCCCCTGGTGGAGTTGCACGG + Intergenic
1158618076 18:59005933-59005955 CCTCTCCTGGTGCTAGAGCAAGG + Intergenic
1159287466 18:66372974-66372996 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1159559415 18:69977654-69977676 CCTCCCCTGAAGCAGTTGCCAGG - Intergenic
1160799152 19:959808-959830 CCTCTCCCGGTCCAGGGGCCCGG - Intronic
1160994916 19:1878089-1878111 CCGTTCCTGGTGCACTGGCCAGG + Intronic
1161077094 19:2291090-2291112 AATCTCCAGGTGCAGCAGCCCGG + Exonic
1161439928 19:4285157-4285179 CCTCTCCTGGCTGTGTAGCCTGG + Intronic
1161454579 19:4363603-4363625 CCTCCCCTGCTGCAGCGGCCAGG + Intronic
1162176269 19:8832500-8832522 CCTGGCCTGGGGCAGTAGCGGGG + Exonic
1163265387 19:16217621-16217643 CCTCTCCTGGGGCCCCAGCCTGG - Intronic
1163600784 19:18247966-18247988 CCTGTCCAGGTTCAGCAGCCTGG + Intronic
1167158933 19:47755376-47755398 CAGCTCCTGGTGCCGGAGCCGGG - Exonic
1168539692 19:57199831-57199853 CCTCCCCTGAGGCAGTTGCCAGG - Intronic
1202675481 1_KI270711v1_random:2249-2271 CCTCTCCTGTTGCAAAAGCTTGG - Intergenic
925021761 2:575281-575303 CCTCTCCTGGTTCAGTCACACGG + Intergenic
926810721 2:16753177-16753199 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
927008578 2:18878616-18878638 CCTCTCCTGAGGCAGTTTCCAGG + Intergenic
929270165 2:39963273-39963295 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
929270233 2:39963942-39963964 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
930909826 2:56618341-56618363 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
931838187 2:66121852-66121874 CTTATCCTGGTGCAATGGCCAGG + Intergenic
932655764 2:73610121-73610143 CCTCTCCTGCTGCAGTCTCTGGG - Intronic
932971886 2:76553685-76553707 CATATTCTGGAGCAGTAGCCAGG - Intergenic
935183723 2:100713312-100713334 CCTCCCCTGAGGCAGTGGCCAGG + Intergenic
936811985 2:116413481-116413503 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
937800003 2:126072255-126072277 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
938380618 2:130834466-130834488 CCTTTCCTGCTAGAGTAGCCAGG + Intergenic
939086188 2:137721211-137721233 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
939730718 2:145781519-145781541 CCTCTCTTCGTGCTGTGGCCAGG + Intergenic
940036856 2:149320587-149320609 CCTCACCTGGCGCAGTGGCCCGG + Intergenic
940472454 2:154116051-154116073 CCTCCCCTGAGGCAGTTGCCAGG - Intronic
942405207 2:175646646-175646668 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
942542540 2:177029696-177029718 CCTCTGCAGGTGAATTAGCCAGG - Intergenic
942740077 2:179166272-179166294 CCTCTCTTGGAGCACAAGCCTGG + Intronic
943239531 2:185365088-185365110 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
943318165 2:186414143-186414165 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
943601235 2:189923524-189923546 CCTCTCCTGCTACAGCAGCCCGG - Intronic
945146357 2:206742532-206742554 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
945641848 2:212441359-212441381 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
946328455 2:218996898-218996920 CCTCTCCTGGCACAGTAGGCAGG - Intergenic
946528186 2:220542455-220542477 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
948247127 2:236495936-236495958 CCTTTCCTGCTGCATCAGCCAGG - Intronic
948794401 2:240394805-240394827 CCTCTCCAGGGGCACTGGCCAGG + Intergenic
1170525010 20:17228142-17228164 CCTCTCCAGCTCCTGTAGCCGGG - Intronic
1173292514 20:41727122-41727144 CTTCTCCTGGGGCCCTAGCCTGG - Intergenic
1173709469 20:45141738-45141760 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1175755262 20:61525547-61525569 CCCCTCCAGCTGCAGAAGCCGGG + Intronic
1176102097 20:63368999-63369021 CCTCTCCACTTGCAGGAGCCAGG - Intronic
1176264591 20:64202576-64202598 CCTCTCCTGGGGCAGTCATCTGG - Intronic
1177505937 21:22017005-22017027 CCTCTCCTGAGGCAGTTGCCAGG - Intergenic
1177912863 21:27053736-27053758 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1177934022 21:27319407-27319429 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1178435099 21:32551275-32551297 TTTCTCCTGGTGCAGTGGCAGGG - Intergenic
1178977426 21:37231821-37231843 CCTGTCCTGATGCAGGAGGCGGG + Intronic
1179490260 21:41736643-41736665 CAACTCCTGGTTCAATAGCCTGG + Intergenic
1179596029 21:42443773-42443795 CTGCTGCTGGTGCAGTAACCGGG + Intronic
1180192599 21:46173227-46173249 CCTCTCCTGGGGCCCCAGCCTGG + Intronic
1181043192 22:20202619-20202641 CATCTGCTGGTGCAGGAGGCCGG - Intergenic
1181120974 22:20668623-20668645 CCGTTCCTGGTGCACTGGCCAGG + Intergenic
1181333940 22:22115649-22115671 CCGTTCCTGGTGCACTGGCCAGG + Intergenic
1182357690 22:29729727-29729749 CCTCACCTGGAGCTGTGGCCTGG + Exonic
1182584909 22:31339365-31339387 CCTCTGCTGCTGCAGTCCCCAGG + Intronic
1183028725 22:35085907-35085929 GCTCTCCTGGTTCAGAAGACAGG + Exonic
1183342221 22:37287690-37287712 CCTCTCCTGGGGCAGAGGCGTGG + Intronic
1184050674 22:42001744-42001766 CCTGTCCTGGTGCGGTAACCTGG - Intronic
1184828940 22:46971859-46971881 ACTCTGCTGGCGCAGGAGCCCGG - Intronic
1184979315 22:48084885-48084907 CCTCTGCAGCTGCAGCAGCCAGG - Intergenic
1184980695 22:48094092-48094114 CCTCTCCCGGTGCAGGGGACGGG - Intergenic
949125988 3:445646-445668 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
949245541 3:1922422-1922444 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
949417985 3:3833677-3833699 TCTCTCCTGAGGCAGTTGCCAGG - Intronic
949494068 3:4615226-4615248 TCTCTCCAGGTGCAGAAGTCAGG + Intronic
950520245 3:13493828-13493850 CCTGACCTGGTGCAGGGGCCAGG - Intronic
950859472 3:16135036-16135058 CCTCTCATGTTGCTGTAGTCAGG + Intergenic
951258786 3:20482203-20482225 CCTCTCCTGGGGCTCCAGCCTGG + Intergenic
951281252 3:20752666-20752688 CCTCTCCTGCTGCAATAACATGG + Intergenic
951384214 3:22025268-22025290 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
951971078 3:28444358-28444380 CCTCCCCTGATGCAGCTGCCAGG - Intronic
953493097 3:43366069-43366091 CCACTCCTGGTGCCCTGGCCTGG - Exonic
954456998 3:50605084-50605106 CCTCACCTGGTGCTGCAGCCTGG - Intergenic
954511938 3:51132988-51133010 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
955146201 3:56322684-56322706 CCCCTCCTTGTGCTGCAGCCTGG - Intronic
955870456 3:63432951-63432973 CCTCTCCTGAATCAGAAGCCAGG - Intronic
956094640 3:65703187-65703209 CATCTTCTGGTTCAGTAGTCAGG - Intronic
956509315 3:69977867-69977889 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
956984456 3:74681504-74681526 CCTCTCCGGAAGCCGTAGCCGGG - Intergenic
957754285 3:84466877-84466899 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
957897796 3:86446256-86446278 CCTCACCTGAGGCAGTTGCCAGG + Intergenic
958499516 3:94887653-94887675 CCTCCCCTAATGCAGTTGCCAGG + Intergenic
958715414 3:97774405-97774427 CCTCCCCTGAGGCAGTTGCCAGG - Intronic
958789170 3:98631073-98631095 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
959227095 3:103599788-103599810 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
960258187 3:115533502-115533524 CCTCTCCTGGGGCCCCAGCCTGG - Intergenic
961649653 3:128411031-128411053 CCTCTCCTGGGGCAGTCGGCTGG - Intergenic
962953029 3:140237603-140237625 TCTCTCCTGGTACTGCAGCCTGG + Intronic
963605424 3:147408895-147408917 CGTCTCCGGGTGCAGCAGGCGGG - Intronic
965191149 3:165531040-165531062 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
966044650 3:175533414-175533436 CCTCCCCTGAGGCAGTTGCCAGG - Intronic
967505609 3:190249674-190249696 CCTCACCTGAGGCAGTTGCCAGG - Intergenic
967794142 3:193580177-193580199 CCTCTCCTGCTGATATAGCCTGG + Intronic
968232257 3:197010962-197010984 CCTCTCCTTGTGAAGACGCCTGG + Intronic
968615672 4:1576772-1576794 CCTCTCCTGGGGCTGTCCCCAGG - Intergenic
968701767 4:2060879-2060901 GCGCTCCTGGTGGAGGAGCCGGG - Intronic
969064857 4:4470741-4470763 CCTTTCCTGGTGCAGGGCCCAGG - Intronic
969491850 4:7503987-7504009 GCTCTCCGGGTGGAGTAGCAGGG - Intronic
970101166 4:12524311-12524333 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
970604678 4:17667956-17667978 CAGCTCCTGGGGCAGCAGCCAGG + Intronic
971002808 4:22341355-22341377 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
972084911 4:35204540-35204562 CCTCTCCTAAGGCAGTTGCCAGG + Intergenic
972192582 4:36612782-36612804 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
972805642 4:42527541-42527563 CCTCCCCTGAAGCAGTTGCCAGG + Intronic
972830604 4:42809927-42809949 CCTCTCCTGGGGCCCCAGCCTGG - Intergenic
973118119 4:46486553-46486575 CCTTTCCTGAGGCAGTTGCCAGG + Intergenic
974975638 4:68887892-68887914 CCTCTCCTGAAGCAGTTGGCAGG - Intergenic
977430437 4:96925737-96925759 CCTCTCCTATGGCAGTTGCCAGG + Intergenic
978899404 4:113929334-113929356 CCTCCCCTGAGGCAGTTGCCAGG - Intronic
979766704 4:124472304-124472326 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
979898767 4:126191807-126191829 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
980148222 4:129015410-129015432 CCTCTCCTGGGGCCCCAGCCTGG - Intronic
980628347 4:135405168-135405190 CCTCTCCTGAGGCAATTGCCAGG + Intergenic
980791920 4:137631797-137631819 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
981511834 4:145566287-145566309 CCTCTCCTGGTACCCCAGCCTGG + Intergenic
981834532 4:149039963-149039985 CCTCCCCTGAGGCAGTTGCCTGG + Intergenic
982629914 4:157819380-157819402 CCTCTCCTGGTGCTCCAGCCTGG + Intergenic
982835177 4:160114071-160114093 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
983184740 4:164689123-164689145 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
985888621 5:2699312-2699334 GATCTCCTGGTGCAGTGGCCCGG + Intergenic
986086791 5:4460221-4460243 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
986742666 5:10717609-10717631 CCTCTTCTGAGGCAGTTGCCAGG + Intronic
987504080 5:18747365-18747387 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
988005283 5:25402507-25402529 CCTCTCCTGAGGCAGTTGCCAGG + Intergenic
988161131 5:27519369-27519391 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
988766108 5:34379816-34379838 TCTCTCCTGATGGAGTTGCCAGG + Intergenic
988839042 5:35065464-35065486 TTTCTCCTGGGGCAGCAGCCAGG + Exonic
993412902 5:87594311-87594333 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
994291710 5:98034475-98034497 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
995776630 5:115730172-115730194 CCTCTCCTGAGGCAGTTGGCAGG - Intergenic
996079734 5:119244093-119244115 CCTCTCCTGGTGCCATGGTCAGG + Intronic
996909024 5:128634524-128634546 TCTCCCCTGATGCAGTTGCCAGG - Intronic
999811478 5:155131504-155131526 CCTCTCCTGCTTCTGGAGCCTGG + Intergenic
999980342 5:156951884-156951906 CCTCACCTGGTCCACTGGCCTGG + Intronic
1000730455 5:164828463-164828485 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1001689733 5:173624141-173624163 CCTCTCCTGGTGGTGGGGCCAGG - Intergenic
1002179550 5:177423928-177423950 CCTATGCTGGGGCAGTGGCCAGG - Intronic
1003973311 6:11320094-11320116 CATCTCATGGTACAGTAGGCAGG - Intronic
1004436673 6:15601974-15601996 CCTCTCCAGTAGCATTAGCCGGG + Intronic
1004507498 6:16258935-16258957 TCACTCCTGGTGCAGAGGCCAGG - Intronic
1005622794 6:27635489-27635511 CCTCCCCTGAAGCAGTTGCCAGG - Intergenic
1006253191 6:32807818-32807840 CCTCTCCTGGGGCCCTGGCCTGG - Intergenic
1006359198 6:33578052-33578074 CCACTCCTGGGGCAAGAGCCTGG + Intronic
1006638787 6:35478287-35478309 CCTCTCCTGGGACAGCAGCCTGG - Exonic
1006825599 6:36932789-36932811 CCTCTCCTGCTGCAGCCTCCCGG - Intergenic
1007379976 6:41483009-41483031 CCTCTCCCGGGGAAGTGGCCTGG - Intergenic
1007761354 6:44135324-44135346 CCTCTCCTGCCGCCGAAGCCTGG - Exonic
1008399957 6:51052985-51053007 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1008594843 6:53031664-53031686 CCTCTCTTGCTGCAGTACTCAGG - Intronic
1009308323 6:62119806-62119828 CCTCTCTTGAGGCAGTTGCCAGG + Intronic
1009621677 6:66085408-66085430 CCTTTCCTGGTGCCCTACCCTGG - Intergenic
1009806153 6:68604318-68604340 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1009934366 6:70216842-70216864 CCACGCCTGGTGAAGGAGCCTGG - Exonic
1010323248 6:74537968-74537990 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1010552108 6:77236225-77236247 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1010581045 6:77596242-77596264 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1010818267 6:80385611-80385633 CCTCTCCTGAGGCCGTTGCCAGG + Intergenic
1010995221 6:82524308-82524330 CCTTTCCTGTTTCAGTAGCGTGG + Intergenic
1011039684 6:83015755-83015777 CCTCCCCTGAGGCAGTTGCCAGG - Intronic
1011068708 6:83358834-83358856 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
1012820481 6:104080435-104080457 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1012866334 6:104622656-104622678 CCTCTCCTCCTTCAATAGCCTGG + Intergenic
1012871947 6:104683215-104683237 CCTCTGCTGGTGAAGTTGCCTGG - Intergenic
1013992148 6:116265686-116265708 CCTCTCCTGGGGCCCCAGCCTGG - Intronic
1016219880 6:141655113-141655135 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1016677345 6:146786899-146786921 TCTCTCCTACTTCAGTAGCCTGG - Intronic
1017616902 6:156255575-156255597 TTTCTCCTGGTGCAGTGGCAGGG - Intergenic
1017841477 6:158226115-158226137 CCTCTGCTAGGGCAGTCGCCAGG - Intergenic
1018448938 6:163887424-163887446 CCTCTCCCTTTGCAGTGGCCTGG - Intergenic
1019114478 6:169748319-169748341 CCTTTCCTTGTGTTGTAGCCTGG + Intronic
1019162995 6:170081272-170081294 GCCCTCCTGGTCCAGGAGCCAGG + Intergenic
1019277111 7:181610-181632 CCTCTCCTGCTGCAGAAACTTGG + Intergenic
1020118148 7:5487831-5487853 CCGCACCTGGTGCAGCACCCAGG - Intronic
1020567689 7:9818246-9818268 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1020709995 7:11595119-11595141 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
1021351197 7:19595954-19595976 CCACTCCTGGGGCCCTAGCCTGG - Intergenic
1022078564 7:26997844-26997866 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1022726505 7:32986523-32986545 CTCCTCCTGGTGCACTGGCCAGG - Intronic
1024897327 7:54275158-54275180 CCTGTCCTGGGGCCCTAGCCAGG - Intergenic
1024908643 7:54419643-54419665 CCTGTCCTGGCGCGGTAACCTGG + Intergenic
1024958587 7:54951578-54951600 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1025047081 7:55701110-55701132 CTCCTCCTGGTGCACTGGCCAGG + Intergenic
1025761832 7:64403000-64403022 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1026389884 7:69889813-69889835 CCTCTCCAAGGGCAGAAGCCTGG - Intronic
1028043542 7:86088969-86088991 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1028141416 7:87279485-87279507 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1029960919 7:104688670-104688692 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
1030376183 7:108755870-108755892 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
1031474765 7:122207838-122207860 CCTCCCCTGATGCAGTTGCCAGG - Intergenic
1031547535 7:123068557-123068579 CCTCTCCTGGGGCCCCAGCCTGG - Intergenic
1031553452 7:123143130-123143152 CCTCTCCTCGAGCAGTAGGAAGG + Intronic
1033613078 7:142984528-142984550 CCTCTCCTAGGGCCCTAGCCAGG - Intergenic
1034169613 7:149052872-149052894 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1034307743 7:150059136-150059158 CCTATCCTGGTGCAAGAGCCAGG - Intergenic
1034799105 7:154041533-154041555 CCTATCCTGGTGCAAGAGCCAGG + Intronic
1035044147 7:155953020-155953042 CATCTCCTGGTGCAGAAGGCAGG + Intergenic
1035359811 7:158303922-158303944 GCTCTCCTGGGGCTGTGGCCTGG - Intronic
1035546393 8:484926-484948 CCTCTGCTGCTGCAGTCGGCTGG - Intergenic
1035654199 8:1293250-1293272 CCTCTCCTGGTGCAGTGCAGGGG + Intergenic
1036217411 8:6892230-6892252 CCTATCCTGGTGCATTAGTCAGG - Intergenic
1036369635 8:8151671-8151693 CATCTCCTGGTGCAGTAACTAGG - Intergenic
1036848706 8:12186826-12186848 CCTCTCTTGGTGCAGTCCTCAGG - Exonic
1036870067 8:12429107-12429129 CCTCTCTTGGTGCAGTCCTCAGG - Exonic
1036881254 8:12513973-12513995 CATCTCCTGGTGCAGTAACTAGG + Intergenic
1037963997 8:23119257-23119279 CCCCTCCCTGTGCTGTAGCCTGG + Intergenic
1039039442 8:33393547-33393569 CCTCTCCTTCTGCAGGAGCATGG + Intronic
1039330293 8:36530370-36530392 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1043488865 8:80727750-80727772 GCTCTCCTGCTGCAGTGGGCTGG - Intronic
1044502725 8:92978241-92978263 CCTCTCCATGTGCTGTGGCCTGG + Intronic
1045544004 8:103112049-103112071 CCTCTTCTTGTGTAGTCGCCCGG - Intergenic
1046417973 8:113940320-113940342 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1046822799 8:118652626-118652648 CTTCTCCTGGTGCCTCAGCCGGG - Intergenic
1047907126 8:129484179-129484201 CCTCTCCCTGTGCTGTGGCCTGG - Intergenic
1047930366 8:129722529-129722551 GCTCTCCTGGGGCAGTAGAAGGG - Intergenic
1048084211 8:131159647-131159669 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1048776269 8:137950103-137950125 GCACTCCTGGTGCAGCAGCCTGG - Intergenic
1049504836 8:142990817-142990839 CCTCTCTTTGTGCGGTAGCCAGG - Intergenic
1049696803 8:143988044-143988066 CCACTCCTGCCTCAGTAGCCTGG + Intronic
1050447378 9:5739620-5739642 CCTCCCCTGAGGCAGTCGCCAGG - Intronic
1050475304 9:6034643-6034665 CCTCTCCTGGGGCTCCAGCCTGG + Intergenic
1050612650 9:7369175-7369197 GATCTCCTGGTGCTGAAGCCTGG - Intergenic
1051110200 9:13627142-13627164 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
1051881802 9:21848141-21848163 CCTCCCCTGAGGCAGTTGCCAGG + Intronic
1052227286 9:26105875-26105897 CCTCTCCTGAGGCAGTTTCCAGG + Intronic
1055551758 9:77438063-77438085 CCTCTCCTGGTGAGGTCTCCCGG - Intronic
1056028512 9:82526066-82526088 CCTCTCCTGGTGCTGGAGAGTGG + Intergenic
1057418368 9:94886009-94886031 ACTCTCTTGGTTCAGTGGCCAGG + Intronic
1058619157 9:106864390-106864412 TCACTCCTGGTGCAGTTCCCAGG + Intronic
1059066593 9:111092021-111092043 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1060033595 9:120236126-120236148 CCTCTCCTGGTGTGGTGGCTGGG - Intergenic
1061935525 9:133855478-133855500 CCTCTGCTCCTGCAGTGGCCGGG - Intronic
1061980772 9:134102267-134102289 CCTGTCCTGGAGTTGTAGCCAGG + Intergenic
1185632467 X:1525026-1525048 CCTCTCATAGTCCTGTAGCCAGG + Intronic
1186685764 X:11922924-11922946 CCTCTCCTGGGGCCCCAGCCAGG + Intergenic
1187124023 X:16436583-16436605 CCCCTCCTAGCGCAGCAGCCAGG - Intergenic
1187389242 X:18875123-18875145 CCTTTCCTGGTGCATTGCCCTGG + Intergenic
1189240259 X:39519311-39519333 CCTCTCCTCGCTCAGCAGCCCGG + Intergenic
1189558191 X:42166415-42166437 CCTCTCCTGGGGCCCCAGCCTGG - Intergenic
1191742854 X:64453802-64453824 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1192298043 X:69870491-69870513 CCTCCCCTGAGGCAGTTGCCAGG - Intronic
1192661884 X:73050260-73050282 CCTCACTTGGGGCAGTTGCCAGG - Intergenic
1192872238 X:75195308-75195330 CCTCTCCTGGGGCCCCAGCCTGG - Intergenic
1193876964 X:86872799-86872821 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1194130417 X:90074369-90074391 CCTCTCCTGGGGCCCCAGCCTGG - Intergenic
1194513729 X:94824743-94824765 CCTCCCCTGAGGCAGTTGCCGGG - Intergenic
1194833610 X:98656300-98656322 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1194925589 X:99819866-99819888 CCTCTCCTGGGGCCCCAGCCTGG + Intergenic
1195289135 X:103414550-103414572 CCTCTCCTGGGGCCCCAGCCTGG - Intergenic
1197001977 X:121450549-121450571 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1197044136 X:121975944-121975966 CCTCCCCTGAGGCAGTTGCCAGG + Intergenic
1197074377 X:122337401-122337423 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1197387129 X:125815175-125815197 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1197409541 X:126098334-126098356 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1197554593 X:127938053-127938075 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1198975145 X:142327763-142327785 CCTCTCCTGGGGCCCAAGCCTGG - Intergenic
1200340620 X:155391588-155391610 CCTCCCCTGAGGCAGTTGCCAGG - Intergenic
1201529938 Y:14980513-14980535 CTTCTCCTGAGGCAGTTGCCAGG - Intergenic