ID: 1081853438

View in Genome Browser
Species Human (GRCh38)
Location 11:46289722-46289744
Sequence TCCTCTCCAGGCTAGTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 3, 3: 6, 4: 119}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081853438_1081853444 -8 Left 1081853438 11:46289722-46289744 CCATCCAACTAGCCTGGAGAGGA 0: 1
1: 0
2: 3
3: 6
4: 119
Right 1081853444 11:46289737-46289759 GGAGAGGAGAGAAAATGAGGGGG 0: 1
1: 6
2: 18
3: 287
4: 1638
1081853438_1081853442 -10 Left 1081853438 11:46289722-46289744 CCATCCAACTAGCCTGGAGAGGA 0: 1
1: 0
2: 3
3: 6
4: 119
Right 1081853442 11:46289735-46289757 CTGGAGAGGAGAGAAAATGAGGG 0: 1
1: 1
2: 8
3: 100
4: 860
1081853438_1081853447 16 Left 1081853438 11:46289722-46289744 CCATCCAACTAGCCTGGAGAGGA 0: 1
1: 0
2: 3
3: 6
4: 119
Right 1081853447 11:46289761-46289783 TCCAGCTCTAGTGGTAAGTTGGG 0: 1
1: 0
2: 0
3: 3
4: 61
1081853438_1081853445 7 Left 1081853438 11:46289722-46289744 CCATCCAACTAGCCTGGAGAGGA 0: 1
1: 0
2: 3
3: 6
4: 119
Right 1081853445 11:46289752-46289774 TGAGGGGGCTCCAGCTCTAGTGG 0: 1
1: 0
2: 2
3: 15
4: 148
1081853438_1081853446 15 Left 1081853438 11:46289722-46289744 CCATCCAACTAGCCTGGAGAGGA 0: 1
1: 0
2: 3
3: 6
4: 119
Right 1081853446 11:46289760-46289782 CTCCAGCTCTAGTGGTAAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 79
1081853438_1081853443 -9 Left 1081853438 11:46289722-46289744 CCATCCAACTAGCCTGGAGAGGA 0: 1
1: 0
2: 3
3: 6
4: 119
Right 1081853443 11:46289736-46289758 TGGAGAGGAGAGAAAATGAGGGG 0: 1
1: 1
2: 18
3: 241
4: 2775

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081853438 Original CRISPR TCCTCTCCAGGCTAGTTGGA TGG (reversed) Intronic
900707383 1:4089167-4089189 CCCTCCCCAGGGTGGTTGGAAGG - Intergenic
901950866 1:12745126-12745148 TCCTCTGCATGTTAATTGGAAGG + Intergenic
902655600 1:17865910-17865932 TCCTCTACAGGCCAGTAGCAAGG + Intergenic
904515263 1:31049642-31049664 TTCTCTCCAGCCTAGGTGAAAGG + Intronic
905338795 1:37264267-37264289 TCTTCTCCAGGCAAGGAGGAAGG - Intergenic
906881287 1:49594232-49594254 TTATCTCCAGGGTAATTGGAAGG + Intronic
910706854 1:90139538-90139560 TCCTCTCCTGGCTACTTTCATGG + Intergenic
912596283 1:110880198-110880220 TCCTCTAGATGGTAGTTGGAAGG + Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
915060081 1:153174414-153174436 TCCTCACCAGGCTAGTTTTGTGG - Intergenic
917688500 1:177443147-177443169 TCCTCGCCAGTCTTGTTGGTTGG + Intergenic
917912330 1:179662468-179662490 TGCTCTCCCAGCTACTTGGAAGG + Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
922335743 1:224617051-224617073 TCCTCTCCAGGCTAGTGCCCAGG - Exonic
1064507384 10:16047888-16047910 TCTTCTCCAGGCTAGCATGAAGG - Intergenic
1066282156 10:33927981-33928003 GCCTCTCCAGTCCAGCTGGAGGG + Intergenic
1067693212 10:48517719-48517741 TCCTCTCCAAGCAGGTAGGAGGG + Intronic
1069691957 10:70359548-70359570 TACTCTCCATGCTAGTTTGGAGG + Intronic
1069818797 10:71214979-71215001 CCCTCTCCAGGCTGGTGGGCAGG - Intronic
1076775875 10:132697748-132697770 TGTGCTCCAGGCTGGTTGGATGG + Intronic
1078260504 11:9702531-9702553 TACTCCCCAAGCTACTTGGAAGG - Intronic
1081658554 11:44873957-44873979 GCCTCTCCAGGCCAGCTGGGTGG + Intronic
1081853438 11:46289722-46289744 TCCTCTCCAGGCTAGTTGGATGG - Intronic
1083444726 11:62700203-62700225 TGCACTCCAGGCTAGGTGGCAGG + Intronic
1084915398 11:72425428-72425450 TCATCTTCATGTTAGTTGGAAGG + Intronic
1085031007 11:73270825-73270847 TCTCCTCCAGGCTAGGTGGCTGG + Intronic
1088582531 11:111330025-111330047 TCCTCTCAAGGCTACTTGGAAGG + Intergenic
1088714515 11:112537108-112537130 TCCTCTCCGGGGGAGTTGTATGG - Intergenic
1095613450 12:44160060-44160082 TGCTTTCCAGGCTAGTAGCAGGG - Intronic
1097170691 12:57111028-57111050 TCCTCCCCTGGCTGGGTGGATGG - Intronic
1097198584 12:57259110-57259132 CCCACTCAGGGCTAGTTGGAAGG - Intronic
1103817692 12:123671665-123671687 ACCTCTCCAGGCTCCTTGGGAGG - Intronic
1106248899 13:27969235-27969257 GCCTCTGCAGCCTAGTGGGAAGG - Exonic
1107169994 13:37329697-37329719 TGCTCTCCAGGCTTATTGCATGG + Intergenic
1111119139 13:83823538-83823560 TCCTGCCCAGGCAACTTGGAAGG - Intergenic
1112822077 13:103349272-103349294 TCCTCTCCAGGCTAGACACATGG + Intergenic
1117678944 14:58183692-58183714 TCCTCTGAAGGTTAGTTGGCTGG + Intronic
1117721730 14:58635293-58635315 TCCCCTCCAGTCTAGTTGCCTGG - Intronic
1119441395 14:74631130-74631152 TCCTCCCCATGCCAGCTGGACGG + Intergenic
1119654936 14:76410519-76410541 TCCTCTGCAGGTTTCTTGGAGGG - Intronic
1121319037 14:92980402-92980424 TCCACTCCAAGCCAGGTGGAGGG + Intronic
1122846145 14:104500268-104500290 TCCTGTCCTGGTCAGTTGGAAGG - Intronic
1123940687 15:25215175-25215197 TCCTCTCCGGGATCGGTGGAAGG + Intergenic
1127492451 15:59478094-59478116 TCCTTTCCATGCCAGTTTGATGG + Intronic
1129154482 15:73709354-73709376 TGCACTCCAGGCTGGGTGGATGG + Intronic
1130147184 15:81283018-81283040 CCCTCTCCAGGCCACTGGGAGGG + Intronic
1131192200 15:90325711-90325733 TACTCTCCAGGCCAGTCAGATGG + Intergenic
1131493373 15:92882311-92882333 ACCCCTCCAGGCTAGCTGGAGGG - Intergenic
1139222222 16:65195346-65195368 TCCTTCCCAGGATTGTTGGAAGG + Intergenic
1139798227 16:69500002-69500024 TCCTCTCACTGCTAATTGGAAGG + Intergenic
1142709548 17:1715803-1715825 CCCTCCCCAGGCTAGATGGCCGG + Intergenic
1145870583 17:28270065-28270087 TCCTCTCCAGTCTAGCAGGCAGG - Intergenic
1148074176 17:44926183-44926205 AGCTCTGCAGGCCAGTTGGATGG + Exonic
1156177637 18:34565545-34565567 TCCTCTGCAGGCTAAGTGGGTGG + Intronic
1158220554 18:55146274-55146296 TCCTCCCCAGGTTGGTGGGAAGG + Intergenic
1158772503 18:60536676-60536698 GCTTCTCCAGGCTAGTTGGAAGG - Intergenic
1159982681 18:74804858-74804880 TCCTCGGCAGGGTGGTTGGAAGG - Intronic
1160743988 19:701983-702005 CCCTCTCCAGTCTGGCTGGAAGG - Intergenic
1161080260 19:2307026-2307048 TCCTCTCCAGGCCACTTCCAGGG + Intronic
1164512913 19:28911992-28912014 TCCCTTCCAGGCTAGAGGGAAGG - Intergenic
1165396946 19:35569620-35569642 GCCTCTCCAGGCCAGGTGCAGGG + Intergenic
1166136007 19:40777723-40777745 TCCTCTCTAGACCAGTGGGAGGG + Intronic
1167077424 19:47257925-47257947 TCTTTTGCAGGCTGGTTGGAGGG + Intronic
929861265 2:45679808-45679830 TCCTCTCTACCCTAGCTGGAGGG - Intronic
931317745 2:61148472-61148494 TCCTTTCCAGGCCAGGTGCATGG - Intronic
932880252 2:75494621-75494643 TCCCCTCAAGACTAGATGGAGGG - Intronic
933299394 2:80525261-80525283 CCCTCTCCTGCCTGGTTGGATGG + Intronic
941719833 2:168801182-168801204 TCCTCTCCACTCTTGTTGCAAGG + Exonic
942749592 2:179272800-179272822 ACCTCTCCAGGGCAGCTGGAAGG - Intergenic
944464204 2:199983930-199983952 TCCTCTCCAGGCTAATTTAGGGG + Intronic
945406678 2:209457310-209457332 ACCTCTCCAGACTAGGTGGTGGG - Intronic
948213464 2:236211850-236211872 TCCTCTCCTGGCCAGGTGTAGGG + Intronic
949000182 2:241608881-241608903 TCTTCTCCAGGGTAGCTGCAGGG - Intronic
1169339966 20:4789312-4789334 TCCCCTGCAGGCTTGTTAGACGG + Intronic
1169499791 20:6148308-6148330 GCCTCTCCAGGCCAATGGGAAGG + Intergenic
1170664718 20:18376435-18376457 TCTTCTCCACACTAGTTGAAAGG - Intergenic
1175958224 20:62622164-62622186 TGCCCTCCAGGCAGGTTGGATGG + Intergenic
1178892124 21:36528896-36528918 TCCTCCTCAGGCTTGGTGGAGGG - Intronic
1181388112 22:22559098-22559120 TCCTCTGCAGGCTCGGGGGAGGG - Intronic
1185293222 22:50038774-50038796 TGCACTCCAGCCTAGGTGGACGG + Intronic
949226225 3:1699405-1699427 TCCTGTCCAGCCAATTTGGAAGG - Intergenic
950542515 3:13620856-13620878 TCCTCTCTGGGCTCGTAGGACGG - Intronic
961820834 3:129574941-129574963 TCCTCTTTGGGCTACTTGGAGGG - Intronic
962470567 3:135704143-135704165 TCCTCACCAGCCAAGCTGGAGGG - Intergenic
968846316 4:3043763-3043785 TCCTCAGCAGGCAAGATGGAGGG - Intergenic
969471383 4:7391404-7391426 TCATCTCCAGGCAAGTTGGACGG + Intronic
970937916 4:21596558-21596580 TCCTCTCCAGGAAAGGTAGATGG - Intronic
971199026 4:24495159-24495181 TCCTCTCCAGCCTAATGGGCTGG + Intergenic
972239203 4:37171714-37171736 TCCTCTTCAGCCAAGGTGGATGG + Intergenic
976890841 4:90045657-90045679 TCCACTAAAGGCTAGTAGGAAGG - Intergenic
985640916 5:1063148-1063170 TCCTCTCCAGGCGTGAAGGACGG + Intronic
987376131 5:17236610-17236632 TCCTCTCCTGTGTAGTTAGATGG + Intronic
998041416 5:138953081-138953103 TCCTTTGTGGGCTAGTTGGATGG - Intronic
998523884 5:142825154-142825176 TCCTTTACAGGATAGTTGTAAGG + Intronic
999369612 5:151045938-151045960 TTCTCCCCAGGCTAGTGTGACGG - Exonic
1003195659 6:3911974-3911996 TCCTCTCCCTGCTAGGTGCAAGG + Intergenic
1004201094 6:13548883-13548905 TGCTCTCCCAGCTATTTGGAAGG + Intergenic
1006039605 6:31243513-31243535 TCCTCTGCAGGCTAGCAGGCTGG + Intergenic
1006843531 6:37047460-37047482 GGCTCTCCAGGCTCGTGGGATGG - Intergenic
1010067327 6:71699089-71699111 TCTTCTCAAAGCAAGTTGGAGGG - Intergenic
1011215663 6:85003093-85003115 TCCTCACCAGGCTAGTCAGAAGG + Intergenic
1016704392 6:147089888-147089910 TCCTCACCATGCTGGATGGAGGG - Intergenic
1017704615 6:157110704-157110726 TCCTCTCCATATTTGTTGGAAGG - Intronic
1021031653 7:15744703-15744725 TCTTCTCCAGGCTAGTAGGCAGG + Intergenic
1029556887 7:101276578-101276600 ACCTCTCCTGGCAAGTGGGACGG + Intergenic
1030251902 7:107455827-107455849 TGCACTCCAGCCTAGGTGGATGG - Intronic
1034593047 7:152160240-152160262 TCATCTCCAGGCTAGTTCTGTGG + Intronic
1041685014 8:60635904-60635926 TCCTCTCCAGGCTGCTTGCTGGG + Intergenic
1044146001 8:88714511-88714533 CCCTCTCCAGGGGAGTTTGATGG + Intergenic
1046930200 8:119834138-119834160 TCATCACCAGGACAGTTGGAGGG - Exonic
1047237830 8:123057848-123057870 TCCTCTCCTGGCCACGTGGAAGG + Intronic
1047711768 8:127559575-127559597 TTCTCTCCAGCATAGTTGGTTGG - Intergenic
1049483738 8:142840523-142840545 TCCTCTCCAGGACAGTGAGAGGG - Intronic
1051717013 9:19995544-19995566 ACCTCTCCTTGCTAGTAGGAGGG - Intergenic
1053311990 9:37026207-37026229 TCCGGGCCAGGCCAGTTGGAGGG - Intronic
1053348014 9:37392370-37392392 ACCTCTCCAGGCGACTCGGAAGG - Intergenic
1057328420 9:94088791-94088813 TCCTTTCCAGCCTGGTTTGAAGG - Intronic
1059434906 9:114270376-114270398 TCATCTCTAGGCTGGTTGGCTGG - Intronic
1061750451 9:132773341-132773363 TCCTCTCCAGCCTTCCTGGATGG + Intronic
1187504196 X:19865488-19865510 TCCACTCCCAGCTAGTTGGAAGG - Intronic
1198679704 X:139168644-139168666 TCCCCTCCAGGCAAGAAGGAAGG + Intronic
1199511856 X:148631141-148631163 TCCTCTTTAGGTTAGTTGCAGGG + Intronic
1200050202 X:153425228-153425250 TACTTGCCAGGGTAGTTGGAAGG + Intergenic
1201786391 Y:17786298-17786320 TCCTCTCCAGGATGATTGGGAGG + Intergenic
1201815162 Y:18119690-18119712 TCCTCTCCAGGATGATTGGGAGG - Intergenic
1201851630 Y:18489412-18489434 TCCTCTCCAGGATGATTGGAAGG - Intergenic
1201881690 Y:18830968-18830990 TCCTCTCCAGGATGATTGGAAGG + Intergenic
1202329908 Y:23738143-23738165 TCCTCTCCAGGATGATTGGGAGG + Intergenic
1202540862 Y:25931911-25931933 TCCTCTCCAGGATGATTGGGAGG - Intergenic