ID: 1081854058

View in Genome Browser
Species Human (GRCh38)
Location 11:46292992-46293014
Sequence GACCAATGGTGTGACAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081854058_1081854061 4 Left 1081854058 11:46292992-46293014 CCTTCATTGTCACACCATTGGTC 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1081854061 11:46293019-46293041 AGCCTTTTGAGAGCAGGAACTGG 0: 1
1: 0
2: 4
3: 23
4: 268
1081854058_1081854060 -2 Left 1081854058 11:46292992-46293014 CCTTCATTGTCACACCATTGGTC 0: 1
1: 0
2: 0
3: 10
4: 101
Right 1081854060 11:46293013-46293035 TCAGAAAGCCTTTTGAGAGCAGG 0: 1
1: 0
2: 3
3: 23
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081854058 Original CRISPR GACCAATGGTGTGACAATGA AGG (reversed) Intronic
900433406 1:2613430-2613452 GACCAAAGTGGTGACAAGGAGGG + Intronic
900557300 1:3287040-3287062 GATCAAGGGTGGGAAAATGAGGG - Intronic
903878123 1:26490296-26490318 GGCCACAGGTGGGACAATGAGGG + Intergenic
906216972 1:44047661-44047683 GACCAAGGATTTGAGAATGAGGG + Intergenic
908232273 1:62117543-62117565 GAACAATGTTGTGCTAATGAGGG - Intronic
909086463 1:71174408-71174430 GAAGAATGGTGTGACAGAGAAGG - Intergenic
911241736 1:95475340-95475362 AACCACTGGAGTGAAAATGAAGG - Intergenic
911341148 1:96639706-96639728 GAGAGAGGGTGTGACAATGAAGG + Intergenic
912207640 1:107525882-107525904 TACCACTGCTGTAACAATGAGGG + Intergenic
917707459 1:177648839-177648861 TACCAGTGCTGTGAAAATGAAGG + Intergenic
919432964 1:197519766-197519788 GTCCAGTGGTGGGACAATCAGGG + Intronic
920924411 1:210328602-210328624 GACCACTGGTGTTGGAATGACGG + Intronic
923022997 1:230179814-230179836 CACCAAAGGCGTGACAATGAAGG - Intronic
924425110 1:243943372-243943394 GACCAATGGTTAGAATATGAGGG + Intergenic
924476009 1:244382515-244382537 GAGCAATGGTAAGACATTGAAGG + Intronic
1065648884 10:27866499-27866521 GTCCAATTGTGTTACTATGAAGG + Intronic
1072828048 10:98628483-98628505 GAGAAATGATGTGCCAATGAAGG + Intronic
1073036699 10:100568901-100568923 GATCAATGGTATGATAAAGAGGG + Intergenic
1077902904 11:6504406-6504428 GACCATTGCTGAGGCAATGATGG - Intronic
1079573603 11:21975655-21975677 GACCAATGCTGTGAGAATGTTGG - Intergenic
1081206501 11:40281608-40281630 AACTAATGGTTTGATAATGATGG - Intronic
1081854058 11:46292992-46293014 GACCAATGGTGTGACAATGAAGG - Intronic
1086834255 11:91601346-91601368 GAGGAATGGTGTCACATTGAGGG - Intergenic
1088815137 11:113415520-113415542 GACCAGCAGGGTGACAATGAAGG + Exonic
1093131083 12:15392350-15392372 GAAGAATGGTGTTACAATGAGGG + Intronic
1093914291 12:24783667-24783689 GCCCAGTGGTGTGTCCATGAGGG - Intergenic
1097888734 12:64756415-64756437 GACCTATGGTGTGATTATGCTGG + Intronic
1100243366 12:92731838-92731860 GAAAGATGGTGTGAAAATGAAGG + Intronic
1103323956 12:120108169-120108191 GACCATGGGTGGGAAAATGATGG + Intronic
1108306362 13:49138786-49138808 TACCACTGGTTTGACAATGTTGG - Exonic
1108570704 13:51747228-51747250 GACCAATGATATCAGAATGAGGG + Intronic
1108976062 13:56444465-56444487 GAGCATTAGTGAGACAATGAGGG + Intergenic
1112184267 13:97113065-97113087 TGCCAATGGTGTGAAAAGGATGG - Intergenic
1116484995 14:45436972-45436994 GACCAATGCTGTTGGAATGAGGG + Intergenic
1120034102 14:79676074-79676096 AACCAATGCTGAGATAATGAAGG - Intronic
1120855476 14:89208237-89208259 ACCCATTGGCGTGACAATGATGG + Intronic
1131651355 15:94403267-94403289 AACAAATGCTGAGACAATGACGG - Intronic
1134821470 16:17250896-17250918 CACCAATGATGAGAAAATGAGGG - Intronic
1138797432 16:59986079-59986101 GTGCAATGGTGTAACCATGATGG + Intergenic
1139124093 16:64056705-64056727 TCCCAATGGAGTGACAATGTCGG + Intergenic
1143944383 17:10577435-10577457 GACTAATGCTGTATCAATGAAGG + Intergenic
1150588647 17:66541161-66541183 GAACAAAGATGTGACCATGAGGG + Intronic
1153817193 18:8800780-8800802 GATTAATGGTGTGGGAATGATGG + Intronic
1154259093 18:12813461-12813483 GACCATTGGTGTCAGAATAAAGG - Intronic
1160231316 18:77051742-77051764 AAGCAGTGGTGTGACAGTGATGG + Intronic
1165639161 19:37369771-37369793 GACCAATGGTCTTATGATGATGG - Intergenic
925900131 2:8503264-8503286 CACCTATTGTGTGAAAATGACGG - Intergenic
926842669 2:17099833-17099855 GACAAATGGGGGGAGAATGATGG - Intergenic
930721831 2:54645615-54645637 GACCAATGGAGTTACATTTAGGG - Intronic
932918462 2:75882560-75882582 GAGCAAAGGTGTGACAATAAAGG - Intergenic
936790928 2:116150575-116150597 GAACAAAGATGTGACAATGACGG - Intergenic
937060389 2:118976483-118976505 GAGAAATGGTGAGACTATGAGGG - Intronic
942104390 2:172618393-172618415 GTCCAATGTTTGGACAATGATGG + Intergenic
942135412 2:172920019-172920041 GACCAAGGGTGAGATAGTGAAGG - Intronic
943723877 2:191233053-191233075 GACAGATGCTGAGACAATGAAGG - Intergenic
945054599 2:205857479-205857501 GACCAAGGGTGTTACAATGGTGG - Intergenic
948388917 2:237598270-237598292 GACCAAGGGGGGGACAATGGGGG - Intronic
1169468999 20:5867136-5867158 GAGCAATGGTGGGACACTAATGG - Intergenic
1169653182 20:7892490-7892512 GACCAATTGTGTGGCTGTGATGG - Intronic
1173830784 20:46085938-46085960 GACCATTGGTTTGACACTGAAGG + Intronic
1173883561 20:46437471-46437493 CTCCAAGTGTGTGACAATGATGG + Intergenic
1178908247 21:36653808-36653830 GACCAATGGAGGGACCATCAAGG - Intergenic
1183602937 22:38850542-38850564 GACCACTGGTGAGCCAAGGAGGG - Intergenic
951168188 3:19507262-19507284 AACCACTGCTGTGGCAATGACGG + Intronic
958572055 3:95897986-95898008 GAACATTACTGTGACAATGAGGG - Intergenic
962098271 3:132315008-132315030 GTCCAAGGGTGAGACAAGGAAGG + Intergenic
964617378 3:158682342-158682364 AATCCATGCTGTGACAATGATGG + Intronic
971119170 4:23684969-23684991 GAACAGTGGGGTGATAATGAGGG - Intergenic
971698736 4:29939313-29939335 GGCAAATGGAGTGAGAATGAGGG + Intergenic
972965963 4:44510077-44510099 GACTAATGGTGTGATGATAAGGG - Intergenic
976965226 4:91030945-91030967 GACAGAAGGTGTGACCATGAAGG - Intronic
977032775 4:91907871-91907893 GACCAAAGGTGTGAGAATCAGGG + Intergenic
985561962 5:592543-592565 GACCAATGGTGTGTCCAGGTGGG - Intergenic
986472600 5:8091108-8091130 GCCCAATTGTGTTACAATGGGGG + Intergenic
987369566 5:17180705-17180727 GAACGATCTTGTGACAATGAGGG + Intronic
992199289 5:74368124-74368146 GGCCAATGGTGGGGCAATGGTGG + Intergenic
992861568 5:80916272-80916294 GAACAATGCTGTGTCCATGAAGG - Intergenic
996102759 5:119461432-119461454 AACCAATGTTGTGAGAATGTGGG + Intronic
996764781 5:127025034-127025056 GATCAATGGTGGTCCAATGACGG + Intronic
1000830786 5:166098655-166098677 AAACAAAGGTGTTACAATGAAGG + Intergenic
1001261846 5:170236537-170236559 GGACAATGGTGAGCCAATGAGGG - Intronic
1001378787 5:171288394-171288416 GACTGATGGTGTGACAAAAAAGG - Intronic
1001561438 5:172671788-172671810 GCCCAATGGTGGGGTAATGAAGG - Intronic
1001943105 5:175754496-175754518 GAGCAAAGATGGGACAATGATGG - Intergenic
1002681405 5:180968173-180968195 GACCAGTGGTGGACCAATGAAGG - Intergenic
1006386592 6:33734459-33734481 CACCAATACTTTGACAATGAGGG + Intronic
1006634306 6:35451467-35451489 CCCCAGTTGTGTGACAATGAGGG + Intergenic
1017556931 6:155581960-155581982 GACCAAATGTGGGAGAATGAGGG - Intergenic
1018553347 6:165024337-165024359 GACCAAAAGTGTGACAATTTGGG + Intergenic
1023057773 7:36303558-36303580 GGCCAGTGGTGTGACACTGCAGG + Intergenic
1024295685 7:47840122-47840144 GACACATGGTGTCACAAAGATGG - Intronic
1031952217 7:127904034-127904056 GATCACTGGTATAACAATGAAGG - Intronic
1032026719 7:128448447-128448469 GAGCAACATTGTGACAATGAAGG - Intergenic
1032552495 7:132797419-132797441 GACCAATGGGGTCACCATAAAGG - Intronic
1040980262 8:53239724-53239746 GAGCAGTCATGTGACAATGAAGG - Intronic
1044997754 8:97853417-97853439 GACCAGTGGTGGGGCAACGAAGG + Intergenic
1045734868 8:105283142-105283164 TGCCAATGGGGTGAAAATGAGGG - Intronic
1046868358 8:119176208-119176230 GATCACCGGTGTGACAAGGAGGG + Intronic
1048777177 8:137960049-137960071 GGCCAATGATGTGAGAATGATGG + Intergenic
1051369741 9:16348237-16348259 GACCAATGGGCTGGCAGTGACGG - Intergenic
1051995746 9:23215245-23215267 GACCAAAGTTGGGACAATTATGG + Intergenic
1052643419 9:31199941-31199963 GAGCAATGGTATGACATTCAAGG + Intergenic
1053216442 9:36274505-36274527 GACCAACAGTGTGAAAAAGAAGG - Intronic
1058801285 9:108546743-108546765 GGCCAATGGGGTGGGAATGAGGG - Intergenic
1059371475 9:113842960-113842982 GTCCAATGGTGTTACCAAGAAGG + Intergenic
1060258136 9:122050626-122050648 GACCAAGCCTGTGACAATGTGGG - Intronic
1061569802 9:131470207-131470229 GACCTACGGTGTTACAGTGAGGG - Intronic
1061722394 9:132560738-132560760 GACCATTGGTTTGACAAAGGAGG - Intronic
1189338957 X:40189788-40189810 GACTAATGGTGTGATTATGCTGG - Intergenic
1191931954 X:66383355-66383377 TACCACTGGTGTGATAATGATGG - Intergenic
1195915195 X:109928673-109928695 GAACAATGGTGTGCAAATGGAGG - Intergenic
1198038689 X:132827218-132827240 GAATAATGCTGTGACAAAGATGG - Intronic