ID: 1081855081

View in Genome Browser
Species Human (GRCh38)
Location 11:46297806-46297828
Sequence GCTGAGCTTGGAACCAATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 111}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081855081_1081855087 -5 Left 1081855081 11:46297806-46297828 CCACCATTGGTTCCAAGCTCAGC 0: 1
1: 0
2: 1
3: 11
4: 111
Right 1081855087 11:46297824-46297846 TCAGCTCGGGGACAGAGTTTAGG 0: 1
1: 0
2: 0
3: 10
4: 80
1081855081_1081855088 -4 Left 1081855081 11:46297806-46297828 CCACCATTGGTTCCAAGCTCAGC 0: 1
1: 0
2: 1
3: 11
4: 111
Right 1081855088 11:46297825-46297847 CAGCTCGGGGACAGAGTTTAGGG 0: 1
1: 0
2: 0
3: 7
4: 100
1081855081_1081855089 -3 Left 1081855081 11:46297806-46297828 CCACCATTGGTTCCAAGCTCAGC 0: 1
1: 0
2: 1
3: 11
4: 111
Right 1081855089 11:46297826-46297848 AGCTCGGGGACAGAGTTTAGGGG 0: 1
1: 0
2: 0
3: 4
4: 107

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081855081 Original CRISPR GCTGAGCTTGGAACCAATGG TGG (reversed) Intronic
900240902 1:1616760-1616782 TCTGAGTTCGGAACCCATGGAGG + Intronic
902930272 1:19726221-19726243 GGTGAGCTTGGAAACAAAGATGG + Intronic
905849746 1:41264947-41264969 GCTCAGATAGGAACCAAGGGAGG - Intergenic
911682011 1:100727643-100727665 TGTGAACTTGGAACCATTGGAGG - Intronic
916570480 1:166021653-166021675 GCTGAGCTTGTAAGCAAAGATGG + Intergenic
919713770 1:200753994-200754016 TCTGATCTTGGAAGAAATGGGGG - Intronic
921067088 1:211630838-211630860 GCTGGGTTTGGACCCAGTGGAGG + Intergenic
921555869 1:216598291-216598313 GTTTAGCTTGGAACCTCTGGTGG + Intronic
921960250 1:221026623-221026645 AATGAGCTTTGACCCAATGGAGG - Intergenic
924939111 1:248799229-248799251 TCTGAGCTTGGAAACAAAGCAGG - Intergenic
1064611098 10:17103412-17103434 GCTGAGCTTTGAACAAGAGGTGG - Intronic
1066101222 10:32120394-32120416 GCCAAGCTGGGAACCAGTGGAGG + Intergenic
1067239385 10:44477342-44477364 GCAAGGCTTGGAACCAAGGGAGG + Intergenic
1070249708 10:74763388-74763410 GCTCTGCTTGGAACCACTTGGGG + Intergenic
1073318102 10:102597011-102597033 GCTGAGCATGGGACAAATGCTGG - Intronic
1074993829 10:118738111-118738133 GCTGAGGTGGATACCAATGGTGG + Intronic
1076241712 10:128913638-128913660 GCTGAGCTGGGAAGAACTGGAGG - Intergenic
1081855081 11:46297806-46297828 GCTGAGCTTGGAACCAATGGTGG - Intronic
1083760051 11:64810639-64810661 GCTGAGCCTGGAAATAGTGGCGG + Intronic
1084329775 11:68423617-68423639 GCTGAGCGGGGAAGCCATGGGGG + Exonic
1086610163 11:88746072-88746094 GCAAAGGTTGGAACCAAAGGGGG - Intronic
1089407338 11:118209153-118209175 GCTGAGACTGTAACCAAAGGAGG - Intronic
1090438011 11:126702920-126702942 GCTGACCTTGCAAGGAATGGAGG - Intronic
1095396491 12:41768146-41768168 TCTCAGCTTGAAGCCAATGGAGG - Intergenic
1096197551 12:49658329-49658351 GCTGAGCCTGGAAGCAAGAGTGG + Intronic
1096595644 12:52693306-52693328 ACTGAACGTGGAGCCAATGGAGG - Intronic
1104669476 12:130670503-130670525 GCTGACCATGGAACCCCTGGGGG - Intronic
1105624464 13:22099503-22099525 GCTGAGCTTGAAGGCAATGAAGG + Intergenic
1114311826 14:21474769-21474791 GATGAGGGTGGAACTAATGGTGG - Intronic
1117875638 14:60248636-60248658 GCTGCCCTTCGAACCCATGGTGG - Intronic
1120626456 14:86832242-86832264 CCAGTGCTTGGACCCAATGGTGG - Intergenic
1121032511 14:90671156-90671178 GCTGAACTTTAAACAAATGGTGG + Intronic
1121729658 14:96177557-96177579 GCTGAGCTAGGATTCCATGGCGG + Intergenic
1122466182 14:101935099-101935121 GCTGACCCTGGAACCAGTGCTGG + Intergenic
1122923955 14:104891384-104891406 GCTGAGCTTGAAGCCCATGAGGG + Intronic
1127653511 15:61033159-61033181 ACTGAGCTTGGAACAAATTTAGG + Intronic
1127659297 15:61085043-61085065 GCTGAGCTTAGCAACAAGGGGGG - Intronic
1127672359 15:61207439-61207461 GCTGAGCTTCTAGCTAATGGAGG - Intronic
1129701969 15:77773471-77773493 GGTGAGATTTGAACCAATGCAGG + Intronic
1129953925 15:79615940-79615962 CCAGAGCTTGGCAGCAATGGAGG + Intergenic
1135668143 16:24352896-24352918 GCAGAACATGGAACCAAGGGTGG - Intronic
1139483328 16:67242711-67242733 GCTGAGCCTGGGAAGAATGGGGG - Intronic
1139951390 16:70673361-70673383 GCTGACCTTCCAACCAATGGTGG + Intronic
1143408148 17:6691642-6691664 GCTGAGCTGGGGGCCAAAGGAGG + Intronic
1146918409 17:36692911-36692933 TCTGTGCTAGGAACCAATGCAGG - Intergenic
1153083381 18:1255014-1255036 GCTGAGTTTAGAACCAGTGTCGG + Intergenic
1153242724 18:3045222-3045244 GCTGAGGGTGGAAGGAATGGAGG + Intergenic
1159861789 18:73658311-73658333 GCTGACCTGTGAACCAATGATGG + Intergenic
1159985166 18:74833235-74833257 GATGAGCTTGGCACCACTGTAGG + Intronic
1160122331 18:76142016-76142038 GCTGGGCTTGGAAGCAAAGCTGG - Intergenic
1162736604 19:12750397-12750419 GCTGGGCTTGGAACCTCGGGCGG + Intergenic
1163374782 19:16923317-16923339 GATGAGTTTGGACCCAGTGGCGG + Intronic
1163842787 19:19621510-19621532 GCTGAGCTTGGGACCAACCCTGG + Intergenic
1164534221 19:29072979-29073001 CCAGAGGTTGCAACCAATGGGGG + Intergenic
1164639548 19:29813596-29813618 GCTGAGCTGGGGATCAATGCAGG - Intronic
1165479592 19:36054798-36054820 GCGGCGCTTAGAACCAATGGGGG - Intergenic
927736842 2:25531754-25531776 GATGACCTTGGAACAACTGGAGG - Intronic
927889880 2:26741634-26741656 ACTGAGCCTGGAAGGAATGGTGG + Intergenic
934951858 2:98580990-98581012 GCTGAGCCTGGAACCCGAGGCGG + Intronic
938016375 2:127870683-127870705 GCTGAGTTTGGAACCAATTGTGG - Intronic
938562090 2:132482102-132482124 GCTGAGCATGGAACCACTCTTGG - Intronic
948690633 2:239701255-239701277 GCTGGGCCTGGAACCAAAGCCGG - Intergenic
1170518027 20:17152213-17152235 TTTGAGCTTGGAACAAATAGTGG - Intergenic
1173903197 20:46606138-46606160 ACGGAGCTTGGAACCTGTGGAGG + Intronic
1181716602 22:24735164-24735186 ACTGTGCATGAAACCAATGGTGG + Intronic
1184153002 22:42649298-42649320 GCTGAGCTGGGCCCCCATGGTGG + Intronic
1184391306 22:44205049-44205071 GCTGAGCTCTGAATCACTGGGGG + Intronic
953173083 3:40525095-40525117 CCTGAACTTGGTCCCAATGGCGG + Exonic
954986626 3:54799958-54799980 TGTGAGCTTGGAGCCAATGTAGG - Intronic
956420958 3:69085728-69085750 GCTGAGCTTGGGATCAAAAGGGG + Intronic
960138695 3:114131239-114131261 GCTGAGCTTGGGCGCTATGGTGG + Exonic
962137898 3:132756673-132756695 GTTGAGTTAGGAAGCAATGGAGG + Intergenic
963044608 3:141093559-141093581 GCTGGGCTTGAGACCCATGGTGG + Intronic
967595824 3:191326038-191326060 GATGAGCTAGGAAGCACTGGGGG + Intronic
977719420 4:100222898-100222920 GCTGTCCTTGGAACCCAGGGTGG + Intergenic
979997770 4:127453015-127453037 AATGAGATTGGAAACAATGGAGG + Intergenic
981966503 4:150610193-150610215 GCTGAGTTTGGAAACCATTGAGG + Intronic
983196883 4:164816757-164816779 GCTCAGCTTGTAACCATTTGTGG + Intergenic
984126087 4:175812670-175812692 GCTGAGCTGTGAACAGATGGAGG + Intronic
989576013 5:42989352-42989374 ACTGTGCTTGGTACCAATGGAGG - Intergenic
990143757 5:52735265-52735287 TCTGAGCCTGGAACCATTGCAGG - Intergenic
992561545 5:77957750-77957772 GCTGGGTTTGGGACCAAGGGTGG - Intergenic
999203848 5:149834571-149834593 GCTGTGCTTGGCACCAGTGGAGG + Intronic
999719252 5:154386507-154386529 CCTGAGCTTGGAAAGACTGGAGG + Intronic
999883854 5:155898214-155898236 GATGACTTTGGAACCAATGCAGG + Intronic
1000053763 5:157585359-157585381 ACTGTGCTTGGAACCAATCAGGG - Intergenic
1001568473 5:172715270-172715292 CCTGAGCTTGGTGCCCATGGTGG - Intergenic
1002936975 6:1682367-1682389 GCTGAGCTTGGTAGCAGTGGAGG - Intronic
1005631549 6:27712794-27712816 GCAGAGCATTGAACCAATTGTGG + Intergenic
1006190526 6:32204980-32205002 GCAGAGCTGGGAATCAATGAAGG + Intronic
1006781697 6:36636666-36636688 GCTGCTCTGGGGACCAATGGGGG + Intergenic
1006918511 6:37612437-37612459 ACTGAGCTTCGAATCAAGGGAGG + Intergenic
1011644396 6:89443806-89443828 GGAGAGCTTGGAACCAAGAGGGG + Intronic
1014257156 6:119172579-119172601 GCTGATTTTGGAAGCAATGCTGG + Intergenic
1018363028 6:163091444-163091466 GCTGAGTTTGGAACCAATTAAGG - Intronic
1019443884 7:1061020-1061042 GCTCAGCGTGGAGCCAAGGGGGG - Intronic
1021827542 7:24570845-24570867 GCTGAGTTGGGAACCAATGATGG + Intergenic
1021920102 7:25476254-25476276 CCTGAGCCTGGAAGCAAAGGAGG - Intergenic
1027183791 7:75957543-75957565 GCGGAGCTTGCCACCAAGGGAGG + Intronic
1027994655 7:85410392-85410414 GCTGAGCATGAAATAAATGGTGG + Intergenic
1031341625 7:120609807-120609829 GCTGAGCTTTCAACCAAGTGTGG + Intronic
1038374131 8:27021386-27021408 GCTTGGCATGGAAACAATGGAGG + Intergenic
1041185411 8:55295180-55295202 GTGGAGCTTGAAAGCAATGGAGG - Intronic
1042141426 8:65682872-65682894 GCTGATCTTGAAACCAATGACGG - Intronic
1048107839 8:131430774-131430796 GCTGAGCTTGGAGCCCCTTGAGG - Intergenic
1048496967 8:134943297-134943319 GCTGCACTTGGAGCAAATGGGGG - Intergenic
1051587856 9:18746109-18746131 GCTCAGCTTGACACCAGTGGAGG + Intronic
1052032352 9:23643261-23643283 GGGGAGCTTGAAACCAGTGGTGG - Intergenic
1054255555 9:62808383-62808405 GCTGAGCATTGAAGGAATGGTGG - Intergenic
1054335751 9:63807225-63807247 GCTGAGCATTGAAGGAATGGTGG + Intergenic
1055451530 9:76435386-76435408 GCTGAATTTGGGACCAGTGGGGG - Intronic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1060006344 9:120003376-120003398 GCAGAGCCTGGAACCAAGGCAGG + Intergenic
1060720013 9:125970386-125970408 GCTGGGCCTGGCACTAATGGGGG + Intergenic
1185481418 X:449266-449288 TCTGAGCTTGGAACCCAGGAGGG - Intergenic
1188602207 X:31981515-31981537 GCTGAGCTTGGAATGAATTGAGG + Intronic
1189516992 X:41722753-41722775 ACTGAGTTTGGAGACAATGGAGG + Intronic
1192528469 X:71867654-71867676 TCAGAGCTGGAAACCAATGGTGG - Intergenic
1192911389 X:75608355-75608377 GCTGATCTAGGAAACAGTGGCGG - Intergenic
1196866185 X:120073256-120073278 GCTGAGCTTGGAAAAAAAGGCGG + Intronic
1196876912 X:120163025-120163047 GCTGAGCTTGGAAAAAAAGGCGG - Intronic
1197315803 X:124964584-124964606 GCTGAGCTAGGAGCCACTGAAGG + Intergenic
1197451970 X:126630042-126630064 GCAGAGATTGGAACAGATGGAGG - Intergenic
1198154624 X:133946634-133946656 GCTGAACTGGGAAGCAAGGGAGG + Intronic