ID: 1081855367

View in Genome Browser
Species Human (GRCh38)
Location 11:46300052-46300074
Sequence GAACTGGACTCCCCTACGCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081855366_1081855367 -8 Left 1081855366 11:46300037-46300059 CCTCTATTGGACATGGAACTGGA 0: 1
1: 0
2: 8
3: 18
4: 150
Right 1081855367 11:46300052-46300074 GAACTGGACTCCCCTACGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 73
1081855361_1081855367 13 Left 1081855361 11:46300016-46300038 CCTGTGCTGGATGAGAAGAGCCC 0: 1
1: 0
2: 0
3: 26
4: 134
Right 1081855367 11:46300052-46300074 GAACTGGACTCCCCTACGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 73
1081855364_1081855367 -7 Left 1081855364 11:46300036-46300058 CCCTCTATTGGACATGGAACTGG 0: 1
1: 0
2: 0
3: 12
4: 122
Right 1081855367 11:46300052-46300074 GAACTGGACTCCCCTACGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 73
1081855360_1081855367 14 Left 1081855360 11:46300015-46300037 CCCTGTGCTGGATGAGAAGAGCC 0: 1
1: 1
2: 2
3: 15
4: 177
Right 1081855367 11:46300052-46300074 GAACTGGACTCCCCTACGCCAGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081855367 Original CRISPR GAACTGGACTCCCCTACGCC AGG Exonic
900440085 1:2650487-2650509 GAACAGGACCCCACTACCCCAGG + Intronic
902733739 1:18386506-18386528 TAACTGGGCTCACCTAGGCCAGG - Intergenic
903223362 1:21881129-21881151 GAGCTGGCCTCCCCTCCTCCCGG - Intronic
903556331 1:24196158-24196180 AAACGGGACTCTTCTACGCCCGG + Intergenic
907471649 1:54677975-54677997 AAACTGCAATCCCCTACCCCTGG - Intronic
923283581 1:232468418-232468440 GAGCTGGACTCCCTGACTCCGGG - Intronic
924553133 1:245097099-245097121 AAAATGGACTTCCCTACTCCCGG - Intronic
1075354712 10:121761007-121761029 GAACTCGCCTCCCCTGCTCCAGG - Intronic
1075592916 10:123705415-123705437 TAACTGTACTCCCCTACTTCTGG - Intergenic
1075801523 10:125157548-125157570 TAACTGGGGTCCCCTACCCCTGG + Intronic
1081855367 11:46300052-46300074 GAACTGGACTCCCCTACGCCAGG + Exonic
1084172681 11:67408225-67408247 GAACTGCTCTTCCCTAAGCCAGG - Intronic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1091212190 11:133871691-133871713 GAACAGGAGTCCCCAACCCCTGG + Intergenic
1092294717 12:7189225-7189247 GGACTGGACTCCCCAGCCCCTGG + Intronic
1095177585 12:39111063-39111085 GAACAGGGGTCCCCAACGCCTGG + Intergenic
1095792467 12:46182385-46182407 GACTTGGACTCCCGTACCCCAGG + Intergenic
1100871508 12:98914840-98914862 GAAATAGACTTCCCTAAGCCAGG + Intronic
1102537492 12:113592055-113592077 GAGCCCAACTCCCCTACGCCTGG - Intergenic
1105601407 13:21891778-21891800 GATCTGGACTCCCCGGCTCCCGG - Intergenic
1106753048 13:32794540-32794562 GAACAAGACTCACCTACACCTGG - Intergenic
1112711029 13:102129105-102129127 GAAGTGCACTCCACTACACCCGG - Intronic
1113282668 13:108806765-108806787 GTACTGGACTCCCCTCCACTTGG + Exonic
1115444298 14:33471748-33471770 AAACTGGAGTCCCCAACCCCCGG + Intronic
1119853420 14:77882249-77882271 GAGCTGGCCCCCCCTACACCTGG - Intronic
1121993586 14:98584512-98584534 GGCCAGGACTCACCTACGCCTGG + Intergenic
1122947887 14:105021408-105021430 GAACTGAACGCGCCTGCGCCTGG + Intergenic
1125045019 15:35235230-35235252 GAACTGGACTTTCCTACCCCTGG - Intronic
1129224347 15:74158322-74158344 GAACAGCACTCCCCTACCTCAGG - Intergenic
1130715056 15:86325428-86325450 GAACTGCATTCCCCAACTCCAGG - Intronic
1132237680 15:100234359-100234381 GGACTGGACTACCATATGCCAGG - Intronic
1132669014 16:1095146-1095168 GACCAGGACTCCCCGACTCCAGG - Intronic
1133774132 16:8884570-8884592 CAACTGGCCTCCCCTATGCTTGG - Intergenic
1137031148 16:35526030-35526052 GAACAGGACCTCCCTACTCCAGG - Intergenic
1138440243 16:57029947-57029969 GGAGTGGAATCCCCTACCCCAGG - Intronic
1141595806 16:85096255-85096277 TAACTTGACTCCCCCAGGCCAGG - Intergenic
1143473470 17:7190502-7190524 GAACTGGGCTCCTGAACGCCAGG - Exonic
1144461775 17:15464236-15464258 GATGTGGAGACCCCTACGCCAGG + Intronic
1151802209 17:76385135-76385157 CAGCTGGACTCCCCTCCCCCTGG + Exonic
1153041447 18:816203-816225 GCACTGGAATCCTCTACCCCTGG - Intergenic
1159035741 18:63275702-63275724 TAACTGGAATCCCCCATGCCTGG - Intronic
1164696078 19:30245360-30245382 GGACTAGACTCCCCAAAGCCAGG + Intronic
1164837471 19:31366594-31366616 GAACTTGACTCTCCCACACCTGG + Intergenic
1168455301 19:56502904-56502926 GAACAGGAGTCCCCAACCCCTGG + Intergenic
925348168 2:3184639-3184661 GCACTGGACACCCCTGCGCGTGG - Intergenic
925348180 2:3184677-3184699 GCACTGGACACCCCTGCGCGTGG - Intergenic
925348192 2:3184715-3184737 GCACTGGACACCCCTGCGCGTGG - Intergenic
925348204 2:3184753-3184775 GCACTGGACACCCCTGCGCGTGG - Intergenic
925348216 2:3184791-3184813 GCACTGGACACCCCTGCGCGTGG - Intergenic
925348228 2:3184829-3184851 GCACTGGACACCCCTGCGCGTGG - Intergenic
925348240 2:3184867-3184889 GCACTGGACACCCCTGCGCGTGG - Intergenic
925348250 2:3184905-3184927 GCACTGGACACCCCTGCGCGTGG - Intergenic
925348261 2:3184943-3184965 GCACTGGACACCCCTGCGCGTGG - Intergenic
942115075 2:172720871-172720893 CAACTGCACTCCCCTCCTCCAGG + Intergenic
946219164 2:218211577-218211599 CAACTGGACTCCCTTATGCCTGG - Intergenic
1169550376 20:6695973-6695995 GAACTGGGCTCCCCAACCCCTGG - Intergenic
1182431860 22:30303751-30303773 GAACAGGCCTCCTCTAGGCCAGG + Intronic
1185115111 22:48929486-48929508 AAACTGGACTCCCCTGCAGCAGG - Intergenic
950427391 3:12931792-12931814 GACCTGGCCTCCCCTACACTCGG - Intronic
950664153 3:14484804-14484826 GGCCTGGTCTCCCCTTCGCCAGG - Intronic
953553230 3:43921341-43921363 GATCTGGACACCTCTACTCCAGG - Intergenic
964881345 3:161426551-161426573 CAAGTGGACTACCCTGCGCCTGG - Intergenic
969728597 4:8940114-8940136 GAGCTGGAATCCCCTCCCCCGGG + Intergenic
972292868 4:37706458-37706480 AAGCTGGACTCCCCTACCTCAGG + Intergenic
992508285 5:77408983-77409005 GAACTGTACTCCCCTCAGCTGGG + Exonic
998186531 5:139983941-139983963 CAACTGCACTACCCTGCGCCAGG + Intronic
1001638219 5:173227860-173227882 GAACTGGACTCCCCAGGGACAGG - Intergenic
1006930414 6:37684492-37684514 GTCCTGGATTCCCCTAAGCCTGG + Intronic
1008192935 6:48482128-48482150 GGACTGGAGTCCCCAACCCCCGG - Intergenic
1012987674 6:105892539-105892561 GAACTGGACTGCACCAAGCCTGG - Intergenic
1016199029 6:141385097-141385119 GAACTGGACAGCCCTAGGCCAGG - Intergenic
1017189622 6:151638444-151638466 GAACTGGTCTCCACTGAGCCTGG + Intergenic
1021451581 7:20787147-20787169 GCACTGTCCTCTCCTACGCCTGG - Intergenic
1023350349 7:39314195-39314217 GTGCTGGACTCCCACACGCCGGG - Intronic
1029258157 7:99283447-99283469 CAACTGAACTCCCCAAAGCCTGG + Intergenic
1038277788 8:26136239-26136261 GAACTGGACTCCCAAACTCCTGG - Intergenic
1057740367 9:97706045-97706067 GAACTGGTCTCCCAGACTCCAGG + Intergenic
1185650537 X:1644847-1644869 GGACTGGACTCCACTACTCTTGG - Intergenic
1200746981 Y:6911394-6911416 GAAAGGGACTCCCCTCCACCGGG - Intronic