ID: 1081857091

View in Genome Browser
Species Human (GRCh38)
Location 11:46310815-46310837
Sequence TGTCAGATGAGGCAGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081857085_1081857091 14 Left 1081857085 11:46310778-46310800 CCAAGGGCGAGCTTGTAAAGGAG 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1081857091 11:46310815-46310837 TGTCAGATGAGGCAGCACCCAGG 0: 1
1: 0
2: 2
3: 15
4: 219
1081857083_1081857091 29 Left 1081857083 11:46310763-46310785 CCTATGATGTCTATGCCAAGGGC 0: 1
1: 0
2: 1
3: 10
4: 115
Right 1081857091 11:46310815-46310837 TGTCAGATGAGGCAGCACCCAGG 0: 1
1: 0
2: 2
3: 15
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081857091 Original CRISPR TGTCAGATGAGGCAGCACCC AGG Intronic
902683010 1:18056998-18057020 TGTCAGAGGAGGCACATCCCAGG - Intergenic
903186448 1:21632003-21632025 TGTCAGAGGAGGCAGCGTGCAGG - Intronic
904807900 1:33144724-33144746 TGACTGATGAGGAAGCATCCTGG - Intergenic
905633413 1:39531752-39531774 CCTCAGAGGAGGCAGCACCGAGG - Intergenic
905664331 1:39753419-39753441 CCTCAGAGGAGGCAGCACCGAGG + Intronic
906304233 1:44706351-44706373 TGTCAGAGTAGGCAGGGCCCAGG + Intronic
907260665 1:53216125-53216147 TGTGAGAAGAGCCAGCAGCCTGG - Intronic
907453799 1:54562603-54562625 TCTCAGATGGGGCAGCTGCCGGG + Intronic
909402776 1:75252841-75252863 TGTCAGGTGAGGTACCACCAGGG - Intronic
911221830 1:95255577-95255599 TGTCTGATAAACCAGCACCCTGG - Intergenic
911292919 1:96079902-96079924 TGTCTGATCACGCAGGACCCTGG - Intergenic
914965810 1:152256359-152256381 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
915221597 1:154379464-154379486 TGCCAGATGGGGCAGAAGCCTGG + Intergenic
915221615 1:154379543-154379565 TCCCAGATGGGGCAGCAGCCAGG + Intergenic
916301803 1:163283895-163283917 TTTCAGATGAGAAAGCAGCCTGG + Intronic
917456769 1:175192682-175192704 TGTCAGACGGGGCAGCAACCAGG - Exonic
920971617 1:210748118-210748140 TGACACATGATGCATCACCCTGG - Intronic
1064400229 10:15014866-15014888 TGTCAGATCAGGTAGCCCCAGGG + Intergenic
1066421374 10:35267636-35267658 TGTCACAAGAGGGAGCAACCAGG - Intronic
1067034162 10:42900536-42900558 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1067120076 10:43465424-43465446 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1067497497 10:46773700-46773722 GGTCAGATGAGGCAGAGCCCAGG - Intergenic
1067509513 10:46883444-46883466 TGTCAGAAGAGGCAGAATCAGGG - Intergenic
1067597155 10:47566715-47566737 GGTCAGATGAGGCGGAGCCCAGG + Intergenic
1067652741 10:48168411-48168433 TGTCAGAAGAGGCAGAATCAGGG + Intronic
1069556176 10:69399995-69400017 CATCAGCTGAGGCAGCACACAGG + Intronic
1070670214 10:78372481-78372503 TGTCAGCTGAGGCAGCGACAGGG + Intergenic
1072224182 10:93352605-93352627 TTTCAGATAAGTCAGCCCCCAGG - Intronic
1073800279 10:107034139-107034161 TGTCACATCTGGAAGCACCCTGG + Intronic
1073977164 10:109115152-109115174 TCTCACATGTGGCAGCTCCCAGG + Intergenic
1076154983 10:128197202-128197224 TGTAAGATGTGGCAGCTCCCGGG - Intergenic
1077147584 11:1052914-1052936 TGTCAGAGGTGGCACCTCCCTGG + Intergenic
1077207096 11:1349930-1349952 CGTAAGATGTGGCTGCACCCAGG - Intergenic
1077264698 11:1642840-1642862 GGGGAGCTGAGGCAGCACCCTGG + Intergenic
1077534964 11:3119653-3119675 TGTCACCCGAGGCAACACCCAGG + Intronic
1077661414 11:4071863-4071885 CCTCAGTAGAGGCAGCACCCTGG - Intronic
1077663659 11:4090498-4090520 GGTTAGAAGAGGCAGCATCCTGG + Intronic
1078427334 11:11262357-11262379 TGGTGGATGAGGCAGCATCCTGG + Intergenic
1079511167 11:21212111-21212133 TGTCAGAAGAAGCAGAACCATGG - Intronic
1079929725 11:26543043-26543065 TGACGGATGAGGAAGCTCCCAGG + Intronic
1081857091 11:46310815-46310837 TGTCAGATGAGGCAGCACCCAGG + Intronic
1082166431 11:48955683-48955705 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1083326503 11:61875834-61875856 CGTCAGGTGAGGCTGCAGCCCGG - Exonic
1083465684 11:62844349-62844371 TGTAAAATGAGGCAGGACACAGG - Intergenic
1083479303 11:62933586-62933608 TCTCAGCTGAGGCAGGACCGGGG + Intergenic
1084261227 11:67980066-67980088 TGTCAGATCAGGTAGCCCCAGGG + Intergenic
1084807403 11:71588485-71588507 TGTCAGATCAGGTAGCCCCAGGG - Intronic
1084816887 11:71653005-71653027 TGTCAGATGAGACAGTGACCAGG - Intergenic
1084847348 11:71910948-71910970 TGTCAGATCAGGTAGCCCCAGGG - Intronic
1084924812 11:72502738-72502760 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1085017736 11:73186195-73186217 TTGCAGCTGAGGGAGCACCCAGG - Intergenic
1085480866 11:76821569-76821591 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1086411819 11:86551435-86551457 TGCCAGATAAGTCTGCACCCAGG - Intronic
1088428173 11:109728295-109728317 ACTCAGCTGAGGAAGCACCCAGG - Intergenic
1088489310 11:110371415-110371437 TGTCAGAGGAGTCAGGGCCCAGG + Intergenic
1090279174 11:125441503-125441525 TGTCAGATCAGGCAACACTTTGG + Intergenic
1090331978 11:125939521-125939543 TGCCAGATGGGGCAGAACCCAGG + Intergenic
1091936887 12:4441743-4441765 TGGGAGATGAGGCAGCTCCGGGG + Intronic
1092185518 12:6475730-6475752 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1093289193 12:17300879-17300901 TGTCAGGTCAGGCAGCTCCAGGG - Intergenic
1094319669 12:29171403-29171425 TCCCAGATGGGGCAGCAGCCGGG - Intronic
1094319732 12:29171680-29171702 TGCCAGATGGGGCAGCAGCTGGG - Intronic
1095068828 12:37815115-37815137 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1095719209 12:45382241-45382263 TGTCACATGAGGTAGAACCAAGG - Intronic
1102059496 12:109922160-109922182 TGTCAGAGGAGGGAGGCCCCTGG - Intronic
1102508886 12:113401142-113401164 TGTCAGAAGAGCCAGCTGCCAGG - Intronic
1102733443 12:115135791-115135813 ATCCAGATCAGGCAGCACCCAGG + Intergenic
1102752576 12:115308467-115308489 TCTCAGAAGAGGCAGAACACAGG + Intergenic
1103510571 12:121470860-121470882 TGCCAGATCAGACAGCAACCTGG - Intronic
1105892156 13:24689548-24689570 GGTCAAATGAGGCACCACCCAGG + Intronic
1109274891 13:60292592-60292614 TGTTAGATGACCCTGCACCCTGG + Intergenic
1109546842 13:63842919-63842941 TGTCAGATCAGGTAGCCCCAGGG - Intergenic
1110730721 13:78876385-78876407 TGTCACATGGGGCAGCCACCTGG + Intergenic
1111374101 13:87355229-87355251 TGCCAGAGCAGGCAGCACCAGGG + Intergenic
1113374920 13:109756137-109756159 TGTTAGATGAGGCACCAACAAGG - Exonic
1113550058 13:111185801-111185823 AGGCAGATCAGGCAGCACCCAGG - Intronic
1114632419 14:24167738-24167760 TGTCAAATGAGGCAGCAAGAAGG - Intergenic
1115338630 14:32268607-32268629 TGTCAGATAAAGAATCACCCAGG - Intergenic
1116582329 14:46658422-46658444 TGCCAGATGAGTCAGCACAGGGG + Intergenic
1120190173 14:81433463-81433485 TGGCAGATGATGAAGGACCCTGG - Intronic
1122026788 14:98883851-98883873 TGGCAGCTGTGGCAGCTCCCTGG - Intergenic
1123628074 15:22241215-22241237 TGTCAGCTGAGGCAGGACAAAGG + Intergenic
1126069570 15:44854106-44854128 TGTCAGATGTCGCTGCACTCAGG + Intergenic
1126909131 15:53399751-53399773 TGCCAAAGGAGGGAGCACCCCGG - Intergenic
1128447573 15:67777407-67777429 GGTCAGAAGAAGCAGCATCCCGG + Intronic
1129071753 15:72957203-72957225 TGGCAGAGGTGGCAGCATCCAGG + Intergenic
1130340836 15:82998367-82998389 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1131173966 15:90198645-90198667 TGCCAGGTGAGGGAGCAGCCAGG + Intronic
1131536642 15:93242509-93242531 TGGTCCATGAGGCAGCACCCAGG - Intergenic
1132677020 16:1125065-1125087 TGTCAGAGGCGGCCCCACCCGGG - Intergenic
1133741893 16:8658201-8658223 TGCCACATGAAGGAGCACCCGGG + Intergenic
1135273273 16:21086954-21086976 TGTCTGATGTGCCTGCACCCAGG - Exonic
1135513902 16:23113331-23113353 TATCACATGAGACAGAACCCAGG + Intronic
1135711052 16:24717594-24717616 TGTCAGATAAAGCAAAACCCAGG + Intergenic
1139766750 16:69237074-69237096 TGAAGGATGGGGCAGCACCCAGG + Intronic
1141194852 16:81852796-81852818 TGTCAGCTGGGGCAGCTCACTGG + Intronic
1141975875 16:87516119-87516141 TGTCAGCTGAGGCAGGACAAAGG - Intergenic
1141998980 16:87653218-87653240 TTTCAGAGCAGGCATCACCCTGG - Intronic
1142232891 16:88908002-88908024 AGGCAGATGAGGCTGCAGCCAGG - Intronic
1142547656 17:715672-715694 AGCCAGATGACGCAGCGCCCTGG + Intronic
1146936956 17:36817999-36818021 TTTCAGAAGAGGCAGGAGCCAGG + Intergenic
1147572356 17:41579181-41579203 TGTCAGAGGAGGCAGCCCCAAGG - Intergenic
1147904404 17:43813520-43813542 TGGCAGGGGAGGCATCACCCAGG + Intronic
1148213095 17:45819918-45819940 TGCCAGCAGAGGCAGCTCCCAGG + Intronic
1151311246 17:73293614-73293636 TGTCAGATGGAACAGCACGCTGG + Intronic
1152618224 17:81347550-81347572 TGGCAGAGGAGCCAGCACCAGGG + Intergenic
1154089615 18:11344756-11344778 TCCCAGATGGGGCAGCAGCCGGG - Intergenic
1156042409 18:32837249-32837271 TGTCATATCAGGGAGCCCCCAGG + Intergenic
1157519771 18:48337333-48337355 CGTCATATGAGGTACCACCCTGG - Intronic
1157561112 18:48647129-48647151 TGCCTGATGATGCAGCAGCCTGG + Intronic
1161499358 19:4605023-4605045 TGTGACAGGGGGCAGCACCCAGG + Intergenic
1163519999 19:17786499-17786521 AGGCAGCTGAGGCAGGACCCTGG + Intronic
1163966466 19:20751525-20751547 TGTCAGATCAGGTAGCCCCAGGG + Intronic
1164017330 19:21264674-21264696 TCCCAGATGGGGCAGCAGCCGGG - Intronic
1164106106 19:22107920-22107942 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1164927384 19:32140777-32140799 TGTCCTAGGAGGCAGCTCCCAGG + Intergenic
1165547851 19:36556678-36556700 TGGCAGATGGGGCAGCAGCCAGG - Intronic
1166338785 19:42124881-42124903 AGTCAGATGAGTGAGCACCTTGG + Intronic
1166346827 19:42171694-42171716 TGCCACATGAGTCTGCACCCCGG + Intronic
1166863978 19:45825315-45825337 TGTCAGAGGTGGCAGCACCCTGG - Exonic
1167000381 19:46742287-46742309 TGGCAGAGAAGGCAGCCCCCAGG - Intronic
1167209159 19:48122361-48122383 CCCCAGATGAGGCAGCACCTGGG - Intronic
1167432537 19:49462689-49462711 GGTCACATGCGGCAGCCCCCCGG - Exonic
1167525028 19:49978238-49978260 TGTCTGATTTGGCACCACCCTGG - Intronic
1167876696 19:52419914-52419936 TGCCAAATGAGGGAGCACTCAGG + Intergenic
1168628314 19:57936258-57936280 GGCAAGATGAGGCAGCACACAGG - Intergenic
925130654 2:1491986-1492008 TGCCAGATGTGGAAGCACCAGGG + Intronic
925231603 2:2237813-2237835 TGCCCAATGAGGCAGAACCCAGG - Intronic
927392357 2:22609638-22609660 TGTCAAATGAGGCAGCCCGACGG - Intergenic
929359896 2:41074818-41074840 TGCTAGAGAAGGCAGCACCCTGG - Intergenic
929561255 2:42957882-42957904 TGCCAGATGAGCCAGCAGCTGGG - Intergenic
930518440 2:52434787-52434809 TGTCAGGTCAGGCAGCCCCAGGG - Intergenic
931698490 2:64889952-64889974 TGTCAGGTCAGGCAGCCCCAGGG + Intergenic
933994843 2:87660767-87660789 TGACTGATGAGGCAGTGCCCAGG - Intergenic
938374279 2:130795609-130795631 AGTCAGATGAGCCAGCAGTCAGG - Intergenic
940290746 2:152075440-152075462 TGTCAGATGAGGCTGTACAGAGG + Intronic
942552291 2:177131827-177131849 TGTCAGAGGAGCCAGGAGCCTGG + Intergenic
943265111 2:185720565-185720587 TGTCAGATGAGGCATGTCACAGG + Intergenic
943396746 2:187347271-187347293 TGTCTGATGAGTGAGCACACTGG + Intronic
948587178 2:239026757-239026779 TGAGAGGTGAGGCAGCACCGGGG + Intergenic
948942774 2:241204402-241204424 GGTCAGATGAGGCAGGGGCCAGG + Intronic
1169155287 20:3324444-3324466 TCTCAGATGATGCAGACCCCAGG + Intronic
1171084458 20:22224637-22224659 TGTCACATGAGGGAAAACCCAGG + Intergenic
1171145055 20:22774370-22774392 TGACACAAGAGGCAGCCCCCAGG - Intergenic
1171848494 20:30291888-30291910 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1174254909 20:49247314-49247336 TGTCAGACCAGGCAGCATGCTGG + Exonic
1176104806 20:63380918-63380940 TGCCACAGGGGGCAGCACCCAGG - Intergenic
1180190083 21:46158782-46158804 TGTCTCCTGGGGCAGCACCCGGG - Intergenic
1182399806 22:30066778-30066800 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1183340936 22:37281034-37281056 TCACTGATGAGGCAGCAACCAGG + Intergenic
1183831863 22:40422496-40422518 TAACTGATGAGGCAGCACCCGGG + Intronic
1184343334 22:43898137-43898159 TGTCAGACTTGGCAGCATCCTGG - Intergenic
949158012 3:850392-850414 TGTCAGGTCAGGCAGCCCCAGGG - Intergenic
950170711 3:10837379-10837401 TGTCAGTGGAGCCAGTACCCTGG - Intronic
950769365 3:15299094-15299116 TGTTAGACCAGTCAGCACCCAGG + Intronic
951946487 3:28142733-28142755 TGTCACAAGAGCCACCACCCAGG + Intergenic
953645512 3:44750087-44750109 TGTCAGATAAAGAATCACCCAGG - Exonic
958948678 3:100393646-100393668 TGTCAAACGAGGCAGAACCTAGG + Intronic
960862007 3:122164491-122164513 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
961190151 3:124953560-124953582 TGTCTGCTGAGGCCTCACCCTGG + Intronic
961277923 3:125742179-125742201 TGTCAGATCAGGTAGCCCCAGGG - Intergenic
961358010 3:126351160-126351182 TGTCACAGGTGGCAGAACCCAGG - Intronic
961459972 3:127043986-127044008 TGACAGATGAGGCAGCAGAAGGG - Intergenic
961762311 3:129180603-129180625 TGTCAGATGCTGCAGCAGCAAGG - Intronic
962010539 3:131386509-131386531 GATCAGATGAGGCAGCACTTGGG + Intronic
965650076 3:170923796-170923818 TGTCAGATGGGGCGGCTGCCAGG - Intergenic
966255704 3:177914469-177914491 TGCCAGATGGGGCAGCAGCCAGG + Intergenic
967082735 3:186065147-186065169 TGTGGGATGAGCCATCACCCTGG + Intronic
968618021 4:1590389-1590411 CATCAAATGAGGGAGCACCCGGG - Intergenic
968670634 4:1849165-1849187 TCTCAGCTGTGCCAGCACCCTGG - Exonic
970289948 4:14561241-14561263 TGTGTGATGAGGCAGCTCCTGGG - Intergenic
972617467 4:40713928-40713950 TGTCTGATGAAGCTGCATCCTGG + Intergenic
974453509 4:62096189-62096211 TGCTAGCTGAGGCAGCCCCCTGG - Intergenic
975798180 4:78031626-78031648 TGTAAGCTGAGGGAGGACCCTGG - Intergenic
978376261 4:108077721-108077743 TCCCAGATGGGGCAGCAGCCGGG - Intronic
978928907 4:114287201-114287223 TCCCAGTTGAGGCAACACCCTGG - Intergenic
980592244 4:134905241-134905263 TGCCAAATGAGGGAGCACCTGGG + Intergenic
981538410 4:145824104-145824126 TGTTAAATGAGGGAGCTCCCTGG - Intronic
983509260 4:168589876-168589898 GGCCAAATGAGGCAGCACGCAGG - Intronic
985049102 4:185971979-185972001 GGTTAGGTGAGGCAGCATCCTGG - Intergenic
985641632 5:1066007-1066029 TGTCTGATGAGGCTGCACCACGG + Intronic
985987404 5:3527869-3527891 CTTCAGATGAGGCACCAACCTGG + Intergenic
987143389 5:14967529-14967551 TGTCATCTGAGGCTGCACCTTGG + Intergenic
988760671 5:34306906-34306928 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
991027987 5:62051864-62051886 TGTCAGCTGAGGCAGGTCACTGG + Intergenic
992030283 5:72714105-72714127 CCTCAGACCAGGCAGCACCCTGG + Intergenic
992956190 5:81911036-81911058 TTTCAGATGAGGCAGCATCTTGG + Intergenic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1002136358 5:177110259-177110281 TGCCAGATGAGGCCAAACCCAGG + Intergenic
1008054654 6:46933914-46933936 GGTCAGATGAGGCAAAACCAAGG - Intronic
1012321685 6:97855306-97855328 TGGAAGGTGAGGCAGCAACCAGG + Intergenic
1012611796 6:101227870-101227892 TGTCAGGTCAGGCAGCCCCAGGG + Intergenic
1018979484 6:168591287-168591309 TGTCAGAGAAGGGAGCACACAGG + Intronic
1019813056 7:3179092-3179114 TTCCAGATGAGACAGCACCCAGG - Intergenic
1024530524 7:50388502-50388524 TGGCAGAGGAGACAGCACTCTGG - Intronic
1024728764 7:52231283-52231305 TGTCAGAACAGGCAGGACTCAGG - Intergenic
1024972393 7:55082666-55082688 TCTCAGATGAGGCTGCTGCCCGG - Intronic
1026134315 7:67646032-67646054 GGCAAGATGAGGCAGCACACAGG - Intergenic
1027869648 7:83691021-83691043 GGTCAGGTGAGGCAGCACAGAGG + Intergenic
1032059488 7:128712546-128712568 TGTCAGTTGGGGCTGGACCCAGG - Intronic
1034322869 7:150201230-150201252 TGGCAGGTGGGGCAGCACCTGGG - Intergenic
1034770316 7:153767893-153767915 TGGCAGGTGGGGCAGCACCTGGG + Intergenic
1036015303 8:4776439-4776461 TGTTATATTAGGCAGCACTCGGG + Intronic
1036906095 8:12709602-12709624 TGTCAGATCAGGTAGCCCCAGGG + Intergenic
1038049197 8:23793063-23793085 GGTTAGAGGAGGCAGGACCCTGG + Intergenic
1039396025 8:37225855-37225877 TAATAGATGAGGCAGCACCGTGG + Intergenic
1040043526 8:42939759-42939781 TCTCAGATGGGGCAGCTGCCGGG + Intronic
1041398630 8:57418272-57418294 TTACAGATGAGGCATGACCCCGG + Intergenic
1044996310 8:97841097-97841119 TCCCAGATGGGGCAGCAGCCGGG + Intronic
1049103670 8:140597882-140597904 TGGCAGATGACGCAACAGCCCGG - Intronic
1049446236 8:142632817-142632839 TGCCAGAGGAGGTAGCACCATGG + Intergenic
1049819120 8:144623767-144623789 TGTCAGAGGCCGCAGCACCCAGG + Intergenic
1049862646 8:144910473-144910495 TGTCACCAGAGGGAGCACCCAGG + Intergenic
1051331838 9:16031860-16031882 TGTGGGATGTGGCAGCCCCCAGG + Intronic
1055214916 9:73847674-73847696 TGCTAGATGTGGCAGCAACCAGG - Intergenic
1056047968 9:82738891-82738913 TTACAAATGAGGCAGCACCAAGG + Intergenic
1056120476 9:83482985-83483007 TGGCAGATGTGGCAGCACTTTGG + Intronic
1056326796 9:85486807-85486829 TTTCTGATGTGGCAGCAACCTGG + Intergenic
1056570625 9:87811539-87811561 TGTGAGAACAGGCAGCACACAGG + Intergenic
1057789986 9:98118480-98118502 TGACAGCTGAGGCTGCTCCCAGG + Intronic
1058722519 9:107776155-107776177 TCTCAGATGGGGCAGCTGCCGGG - Intergenic
1059425947 9:114221043-114221065 TGTGTGATGAGGCAACACCTTGG - Intronic
1060064897 9:120495543-120495565 TCTCAGATGGGGCAGCTGCCGGG - Intronic
1061874266 9:133536071-133536093 ACTCAGGTGAGGCAGAACCCAGG - Intronic
1062224271 9:135440544-135440566 TGTCAGATCGGGCAGCCCCAGGG + Intergenic
1062243681 9:135552667-135552689 CATCAGACGAGGCAGCACTCCGG + Intergenic
1187447971 X:19374441-19374463 GGACAGCTGGGGCAGCACCCTGG - Intronic
1188173315 X:26956188-26956210 TCTCAGAAGAGACAGCACTCAGG + Intergenic
1189511334 X:41665059-41665081 TGTCAGCTGAGCTATCACCCTGG - Intronic
1191069004 X:56380362-56380384 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1191069014 X:56380402-56380424 TCTCAGATGGGGCAGCTGCCGGG + Intergenic
1192237991 X:69308055-69308077 TCTCAGAGGAGTCAGCACCTGGG + Intergenic
1194399127 X:93421336-93421358 TGTCAAATAAGGCAGACCCCAGG - Intergenic
1194732776 X:97475115-97475137 TGTCAGATAAGGCAGCAGCCAGG - Intronic
1195731222 X:107969643-107969665 AGACAGCTGAGGTAGCACCCTGG - Intergenic
1201383543 Y:13413350-13413372 TGTCACATGGGGCAGCCACCCGG - Intronic
1202126673 Y:21574521-21574543 TGTCAGATCAGGCAGAACCAGGG - Intergenic