ID: 1081860386

View in Genome Browser
Species Human (GRCh38)
Location 11:46330179-46330201
Sequence AGGAGCCATTTGGCCAAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081860375_1081860386 23 Left 1081860375 11:46330133-46330155 CCCAATCCCAGGCAAAGTTCTGA No data
Right 1081860386 11:46330179-46330201 AGGAGCCATTTGGCCAAACTGGG No data
1081860379_1081860386 16 Left 1081860379 11:46330140-46330162 CCAGGCAAAGTTCTGATCTCGGA No data
Right 1081860386 11:46330179-46330201 AGGAGCCATTTGGCCAAACTGGG No data
1081860377_1081860386 17 Left 1081860377 11:46330139-46330161 CCCAGGCAAAGTTCTGATCTCGG No data
Right 1081860386 11:46330179-46330201 AGGAGCCATTTGGCCAAACTGGG No data
1081860376_1081860386 22 Left 1081860376 11:46330134-46330156 CCAATCCCAGGCAAAGTTCTGAT No data
Right 1081860386 11:46330179-46330201 AGGAGCCATTTGGCCAAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081860386 Original CRISPR AGGAGCCATTTGGCCAAACT GGG Intergenic
No off target data available for this crispr