ID: 1081864697

View in Genome Browser
Species Human (GRCh38)
Location 11:46353032-46353054
Sequence CTCTGTGGCCGCGGAGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 273}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081864686_1081864697 25 Left 1081864686 11:46352984-46353006 CCAGAGACGTGGTTAGGTCGGGA 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1081864697 11:46353032-46353054 CTCTGTGGCCGCGGAGGGGAGGG 0: 1
1: 0
2: 2
3: 22
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081864697 Original CRISPR CTCTGTGGCCGCGGAGGGGA GGG Intronic
900387152 1:2415969-2415991 CTCAGAGGCCGGGGAGGAGAGGG + Intergenic
900895697 1:5481494-5481516 AGCTGTGGCCAGGGAGGGGAGGG - Intergenic
901207507 1:7505455-7505477 CTCTGGGGCCGTGGAGAGGGTGG - Intronic
901640890 1:10692481-10692503 CTCTGTGGGAGTGGAGGGCAGGG + Intronic
902894378 1:19468760-19468782 CTCAGTGGCCCAGGAGGGCATGG - Intronic
903506727 1:23841266-23841288 TTCTGTGGCAGTAGAGGGGATGG + Intergenic
903986887 1:27234970-27234992 CTCGGCGCCCGCGGAGGGCAGGG - Intronic
905409086 1:37755965-37755987 CTGTGTGGCAGAAGAGGGGAGGG + Intronic
908887894 1:68810886-68810908 TTCTGTGGCAGGGGAGGGCAGGG + Intergenic
910150849 1:84143007-84143029 CTCTTTGGAAGCAGAGGGGAGGG - Intronic
912594040 1:110856395-110856417 CACTGTGGCAGCGGAGGAGATGG - Intergenic
913172293 1:116243813-116243835 CTCTTTGGCAGCTGAAGGGAAGG - Intergenic
916576753 1:166073864-166073886 CACTGTGGCAGCCTAGGGGAGGG - Intronic
916761744 1:167823462-167823484 CTTTGGGGCCTCGGAGGGGAGGG + Intronic
917487600 1:175468950-175468972 CTTGGTGGCAGGGGAGGGGAGGG + Intronic
918406215 1:184214043-184214065 CTCTGGGCCTGAGGAGGGGAGGG - Intergenic
919752814 1:201048756-201048778 GTCTGTGGACCGGGAGGGGACGG + Intronic
920196727 1:204232792-204232814 CTCTGTGGTCCCAGAGGGCAGGG + Intronic
922496512 1:226062262-226062284 GTCTCGGGCCGCGGCGGGGAGGG - Intronic
922762786 1:228142800-228142822 GTTTGGGGCCGAGGAGGGGATGG + Intronic
923612130 1:235504657-235504679 CTCGGCGGCCGCGGGGGCGAAGG + Intergenic
924426190 1:243952420-243952442 CACTGTGCCGGCCGAGGGGAGGG + Intergenic
1063976789 10:11423847-11423869 TTCTGTGGTCGGGGATGGGAAGG + Intergenic
1065028064 10:21557755-21557777 CTCTGTGGCTGGAGTGGGGAGGG + Intronic
1065046586 10:21751875-21751897 CTCTGTGGGCGGGGGGGGGGGGG + Intergenic
1067232256 10:44420063-44420085 CTCTGTGGAGGAGGAGAGGAAGG + Intergenic
1067946970 10:50695814-50695836 CTCTATTGCCGGGGAGGGGTTGG - Intergenic
1069158251 10:65054724-65054746 CTTTGTGGCCTCGGAAAGGAAGG - Intergenic
1070882280 10:79860807-79860829 CTCTATTGCCGGGGAGGGGTTGG - Intergenic
1071648850 10:87377118-87377140 CTCTATTGCCGGGGAGGGGTTGG - Intergenic
1074869059 10:117562740-117562762 TTCTGTGGGTGCTGAGGGGAGGG + Intergenic
1075334324 10:121597799-121597821 CTCTGTGGCTGCATAGGTGATGG - Intronic
1075408744 10:122211875-122211897 CACTGTGACCGCAGAGAGGAAGG - Intronic
1076462891 10:130658485-130658507 CTTTGTAGCAGTGGAGGGGATGG + Intergenic
1076501289 10:130938210-130938232 CACTGGGGCGGCGGAGGGGCCGG - Intergenic
1076635714 10:131880732-131880754 CTCTGCTGCCTCAGAGGGGAGGG - Intergenic
1076922879 10:133464784-133464806 CCCGGTGCCCGCAGAGGGGAAGG - Intergenic
1077065273 11:638233-638255 TTCTCTGGCCGCAGAGGGGCTGG - Intronic
1081614206 11:44580906-44580928 CTCAGTGCCTGGGGAGGGGAAGG + Intronic
1081864697 11:46353032-46353054 CTCTGTGGCCGCGGAGGGGAGGG + Intronic
1083620524 11:64047187-64047209 CTCTGGGGCAGGGGAGGGGAGGG - Intronic
1083828067 11:65214171-65214193 CTCCGTGGCCGCGCCCGGGATGG - Intergenic
1083938476 11:65882617-65882639 GACTGTGGCCGCTGTGGGGATGG + Exonic
1084275898 11:68050791-68050813 ATCTGTGGCAGCGAAGGTGAAGG - Exonic
1085195696 11:74670366-74670388 CTCTGTGGCAGCTTAGGGCAGGG - Intergenic
1086060685 11:82696640-82696662 CTCTGGGACCTCTGAGGGGATGG - Intergenic
1086623212 11:88913455-88913477 CTCTGAGACAGGGGAGGGGAAGG - Intronic
1089500733 11:118929871-118929893 CCCTGAGGCGGCGGTGGGGAGGG - Intronic
1090080071 11:123606443-123606465 CTCTGTGGCAGCTCTGGGGAAGG + Intronic
1090664397 11:128905288-128905310 CTCTGCGGCTGCGGAGGAGGCGG - Intronic
1091238560 11:134037381-134037403 CTCCTGCGCCGCGGAGGGGAGGG + Intergenic
1091397538 12:163201-163223 TTCTGTGGAGGGGGAGGGGAGGG - Intronic
1092172956 12:6384738-6384760 CTCTGAGGCCGCGAGGGGGCTGG - Intronic
1094147414 12:27244591-27244613 CTCGGGGGCCGGGGAGTGGAAGG - Intronic
1096024763 12:48350967-48350989 CTCTGCGGCGGCGGAGGTGCGGG + Intronic
1102506326 12:113386861-113386883 GGCTGTGGCCAGGGAGGGGAGGG - Intronic
1103418609 12:120761832-120761854 CTCTGTGAGGGTGGAGGGGAAGG - Intergenic
1104602135 12:130161597-130161619 CTCTGCGGCTTCGGAGGGGGCGG + Intergenic
1104965287 12:132506187-132506209 GACTGTGGCCGGGGTGGGGAGGG + Intronic
1105209422 13:18249088-18249110 CTCTGTGGCCCAGAAGGAGAGGG + Intergenic
1105837003 13:24221003-24221025 CTCTGTGGCCTTGGAGGTAATGG + Intronic
1109221400 13:59644366-59644388 CTCTGTGTCTGTGGAGGGAAGGG + Intergenic
1110032142 13:70629207-70629229 TTATGTGGCAGTGGAGGGGAAGG + Intergenic
1113096269 13:106667153-106667175 CTCTGTGACCACAGAGGGAAAGG - Intergenic
1113583829 13:111449149-111449171 TTCTGAGGCTGCGCAGGGGAAGG - Intergenic
1114879145 14:26762146-26762168 CTCAGTGGGGGCGGAGGGGAGGG - Intergenic
1115591990 14:34874147-34874169 GCGTGTGGCCGCGGCGGGGAGGG + Intronic
1118725490 14:68625903-68625925 CACTGTGGCCACTCAGGGGAAGG - Intronic
1121265756 14:92601592-92601614 CTCTCTGGGAGCAGAGGGGACGG - Intronic
1121547671 14:94773794-94773816 CTCTGTGGCCGGGCAGGAGACGG - Intergenic
1122239172 14:100350699-100350721 CTGTGGGGCCCAGGAGGGGATGG + Intronic
1122776395 14:104118713-104118735 GTCTGTGGCATCGGAGGGGTTGG + Intergenic
1122968870 14:105144357-105144379 CCCTGAGGCCGCAGAGGGGGTGG - Intronic
1123010603 14:105347897-105347919 CTCTGTTGCTGAGGAGTGGAGGG - Intronic
1123118956 14:105908272-105908294 GTCTTTGGCAGTGGAGGGGAGGG + Intergenic
1125747719 15:42008498-42008520 GTATGTGGCCACAGAGGGGAGGG - Intronic
1129884336 15:79027980-79028002 GTCTGTGGTCATGGAGGGGAAGG + Intronic
1131026064 15:89142683-89142705 CTCAGGGGCTGTGGAGGGGAAGG - Intronic
1135597462 16:23755131-23755153 GTCGGCGGCTGCGGAGGGGACGG + Intronic
1137514138 16:49128098-49128120 CTCTGTGGCCCCAGAGAGAAGGG - Intergenic
1137935167 16:52628166-52628188 CTCTGGGGACTCAGAGGGGAAGG + Intergenic
1141054571 16:80803867-80803889 CTTTGCGGCCTTGGAGGGGAAGG - Intronic
1141864471 16:86740661-86740683 CTCTGGGGACTCGGTGGGGAAGG + Intergenic
1142090366 16:88206781-88206803 CTCTGTGGGAACGGAAGGGAGGG + Intergenic
1142117937 16:88369861-88369883 TTCTGAGGGCGCGGTGGGGACGG - Intergenic
1142246062 16:88970595-88970617 CCCTGTGGCCCCGGAGGGAAGGG - Intronic
1142367517 16:89657851-89657873 CTCCGCGGCCGCGGAGGTGTGGG + Exonic
1142377147 16:89712007-89712029 CCCTGGGGCCGCTGCGGGGAGGG - Intronic
1142385170 16:89759438-89759460 CTCTGTGGATACGGATGGGAAGG + Intronic
1142592705 17:1013342-1013364 CCCTGTGGCCGCCGTGGGGGAGG + Intronic
1143272108 17:5683472-5683494 TTCTGGGGCCGTGGAGGGCAGGG + Intergenic
1143586832 17:7854640-7854662 CGCTGGGGCTGCGGAGGGGTGGG + Exonic
1144496413 17:15749018-15749040 CTTTGTGGCCTCGGAAAGGAAGG + Intronic
1144497396 17:15757238-15757260 CACCGTGGCCCCGGTGGGGAGGG - Intergenic
1144605996 17:16666422-16666444 CTTTGTGGCCTCGGAAAGGAAGG + Intergenic
1144629188 17:16861722-16861744 CACCGTGGCCCCGGTGGGGAGGG - Intergenic
1144905169 17:18635681-18635703 CTTTGTGGCCTCGGAAAGGAAGG - Exonic
1145272772 17:21413507-21413529 CCCTGTGGGCGGGGAGGGGTGGG + Intronic
1145310980 17:21700970-21700992 CCCTGTGGGCGGGGAGGGGTGGG + Intronic
1145826005 17:27877755-27877777 CTCTGTGGCAGCACAGGGGCTGG + Intronic
1146209649 17:30932077-30932099 CACTGTGGCCGCAGAGGCCAAGG + Intronic
1146653653 17:34622595-34622617 CTGGGTGGCCACTGAGGGGAGGG - Intronic
1146681967 17:34815026-34815048 CTCTGTGGTGGTGGTGGGGATGG - Intergenic
1146936126 17:36813659-36813681 TGCTGTGGCCACGGAGGGGAAGG - Intergenic
1147163358 17:38580209-38580231 CTCTGTGGCTGGGCAGGGGATGG - Intronic
1147307504 17:39573926-39573948 CTTGGTGGGCGGGGAGGGGAGGG + Intergenic
1148338697 17:46860215-46860237 TTCTGTGGCTGAGGACGGGAAGG + Intronic
1148471430 17:47896241-47896263 CTCGGTGGCGGCGGAGGCGGCGG + Exonic
1148747845 17:49928271-49928293 CTCTCTGGTCCCGGAGGGCAGGG - Intergenic
1148858794 17:50593416-50593438 CTGAGTGGCAGAGGAGGGGAGGG - Intronic
1149543450 17:57485835-57485857 TGCTCTGGCCGTGGAGGGGAGGG + Intronic
1149991176 17:61384438-61384460 ATCTGTGGCACAGGAGGGGAGGG - Intronic
1150135352 17:62692381-62692403 CTCAGTGGCCTCGGTGGGGCTGG - Exonic
1151828571 17:76537130-76537152 TTCTGAGGCCGGGGAGAGGAGGG + Intronic
1152344580 17:79743246-79743268 CTCTGTGGCTGGGCTGGGGAGGG + Intergenic
1152642720 17:81455892-81455914 CTCCGTGGCCTCGGCGGGGCTGG + Intronic
1152741874 17:82022013-82022035 CTCTGTGGCCTGGGAAGGGAGGG - Intronic
1152945400 17:83195131-83195153 CTCTGTGGTCCCGGAAGCGAAGG - Intergenic
1156164552 18:34402716-34402738 CTCTGTGGTGGCGGTGGGGTTGG - Intergenic
1157391445 18:47306892-47306914 CTCTGGGGAGTCGGAGGGGAAGG + Intergenic
1157654272 18:49369926-49369948 CTCTGTGAGCACTGAGGGGAGGG - Intronic
1158220912 18:55149843-55149865 CCCTGTGGCCAAGGAGGGGTAGG + Intergenic
1158670223 18:59467834-59467856 CCCTGTGTACGCTGAGGGGAGGG + Intronic
1160578936 18:79872910-79872932 CTGTGTGGCGGCCGTGGGGAGGG + Intronic
1160653430 19:246608-246630 CTCCGCGTCCCCGGAGGGGAGGG + Intergenic
1160760355 19:781084-781106 CTGTGGGGCCCCGGAGGGGCGGG + Intergenic
1160868618 19:1266994-1267016 CGCTGTGGCCGCGCAGGGCTGGG + Intronic
1160944099 19:1633194-1633216 CTCTGTGGCCCCCGATGGAAGGG - Intronic
1161224150 19:3135199-3135221 CTCTGGGGCCCCGCAGGTGAGGG + Intergenic
1161936660 19:7376447-7376469 CCCTGTGGCTGGGGAGGGGGTGG + Intronic
1162241988 19:9362707-9362729 CTCTGCAGCCGCAGAGGGAAAGG - Intronic
1162426904 19:10602514-10602536 CTCCATGGCCGCGGCGGGGCGGG - Intronic
1162753158 19:12841073-12841095 TTCTGGGGCCCTGGAGGGGAGGG - Intronic
1162804301 19:13129056-13129078 CACTGTGGCCGGGGTGGGGCAGG + Intronic
1163152820 19:15425025-15425047 CTCGGTGGCTGCGGGGCGGAGGG + Exonic
1163553810 19:17981629-17981651 CTCTGGGGGCGCGGTGGGGCTGG + Intronic
1163720415 19:18895836-18895858 CGCAGTGGCCGCGGAGCGCAGGG + Exonic
1164498670 19:28793551-28793573 CTCGGGGGCCGCGGAGGAGGAGG - Intergenic
1164734184 19:30528676-30528698 CACTGTGGCCCAGGAGGAGAGGG + Intronic
1166101869 19:40576099-40576121 CTCTGAGGCGGCGGAGTGCAGGG - Exonic
1167417889 19:49386735-49386757 GGCAGTGGACGCGGAGGGGAAGG + Intergenic
1167423053 19:49415028-49415050 CTCTGTGGGTGTGGAGTGGATGG - Intronic
1167456977 19:49601562-49601584 GGCTGTGGCGGCGGAGGGGGTGG - Exonic
1167688342 19:50969901-50969923 CTCCCTGGCCATGGAGGGGAGGG + Intergenic
1168324262 19:55530099-55530121 CTCGGGGGCCGTGTAGGGGATGG + Exonic
1168358443 19:55717674-55717696 TTCTGTGGCCGGAGACGGGAGGG + Intronic
924987858 2:288006-288028 CTCGGGGTCCGCGGAGGTGAGGG - Exonic
925031121 2:650405-650427 CTCTCTGTCCCCTGAGGGGAAGG + Intergenic
925142463 2:1559436-1559458 CTCTGTGGCTGAGGAGGAGGGGG - Intergenic
926125488 2:10269433-10269455 CTCTCAGGCCGCGGTGGGGCTGG - Intergenic
932180758 2:69643867-69643889 TTCTGTCGCCACGGATGGGAAGG + Intronic
933808244 2:86015637-86015659 CACTGTGGCAGGGGAGGGAAGGG - Intergenic
934754609 2:96816508-96816530 CTGGGTGGCCCCGGAGGGGGCGG + Exonic
936029177 2:109057978-109058000 CTTTGTGGCTGCGGAGGGGCAGG + Intergenic
938614550 2:132983850-132983872 TGCTGTGGCCTGGGAGGGGAAGG - Intronic
940029140 2:149241928-149241950 CTCTGTGGACTCAGTGGGGATGG + Intergenic
940357697 2:152763588-152763610 CTCTCTGGCAGTTGAGGGGATGG + Intergenic
941367145 2:164621982-164622004 ATCTTTGGCTGCGGAGTGGATGG - Intergenic
946250113 2:218406483-218406505 CTCAGAGGCCGCAGAGGGGCGGG - Intergenic
947593037 2:231395869-231395891 GTCTGTGGCCACGGAGGAGGGGG - Intronic
948046839 2:234951898-234951920 AGCTGAGGCCGCGGAGGGGGTGG - Intergenic
948589691 2:239040988-239041010 TTCTGTGGCCGAGGCAGGGAGGG + Intergenic
948954199 2:241273881-241273903 CTAAGTGGCAGGGGAGGGGAGGG + Intronic
1169143473 20:3238604-3238626 CGCTGCGGCCGCGCAGGGCACGG + Intronic
1172771339 20:37384311-37384333 CTCGGCGGCCGCGGGGGCGAAGG - Exonic
1172944089 20:38674552-38674574 CTCTGGGGGCGGGGTGGGGACGG - Intergenic
1174149901 20:48478556-48478578 AACTGAGGCCGGGGAGGGGAGGG - Intergenic
1174157356 20:48524528-48524550 ATCTGTGGCTGTGGAAGGGAAGG - Intergenic
1174614766 20:51827335-51827357 CACTGTGGCCCCGCAGTGGACGG + Intergenic
1174694146 20:52540653-52540675 CTCTGTGAACTGGGAGGGGAAGG - Intergenic
1174708816 20:52684224-52684246 CTCTGGGAACGCAGAGGGGATGG - Intergenic
1174869198 20:54167865-54167887 CACTGTGGCTGCTGATGGGAGGG - Intronic
1175368397 20:58470814-58470836 CTCTGTGGCCACAGTGGGGTTGG - Intronic
1175430593 20:58899863-58899885 TTCTGTGGCCGGGGAGGGGAGGG + Intronic
1175933661 20:62505268-62505290 CTCAGTGCCCCCAGAGGGGAGGG + Intergenic
1175987661 20:62771947-62771969 CAGAGTGGCCGCCGAGGGGACGG + Intergenic
1178975359 21:37216685-37216707 CACTGCGGACGCGGAGGGGGCGG - Intergenic
1179678653 21:43002309-43002331 TTCTGTGGCCTGGGAGGGGAGGG - Intronic
1180216065 21:46324480-46324502 GGCTGTGGCCGCGGCGGGGGCGG - Intronic
1182456810 22:30456989-30457011 CTCTGTGGCAGCTGAGTGGAGGG - Intronic
1182605149 22:31497011-31497033 CTCCGTGGCCCAGGAGCGGAAGG + Intronic
1183314069 22:37127672-37127694 CCCTGTGGACGGGGAGGGGAGGG + Exonic
1183847431 22:40553877-40553899 CTCTGTGGCTTTGGAGGGTACGG - Intronic
1184173317 22:42772226-42772248 CTCTGTGTGTGCAGAGGGGAAGG - Intergenic
1185258172 22:49848257-49848279 ATCTGTGGCCGGGGAGGGAAAGG - Intergenic
1185345131 22:50307641-50307663 TTGTGTGGCCGAGGAGGGGCCGG + Intergenic
949260729 3:2099755-2099777 GTCTGGGCCCGGGGAGGGGACGG - Intronic
950614624 3:14148813-14148835 CCCAGTGGCCGTGGACGGGAAGG - Exonic
950765086 3:15267568-15267590 CTCTGTGGCCACTGAAGGGAAGG - Intronic
952755806 3:36865509-36865531 CTCTCTGGCCAAGGAAGGGAAGG + Intronic
953789629 3:45937397-45937419 CTCTGTGGCCCCCAAGGGCAGGG + Intronic
953982143 3:47418287-47418309 CACAGTGGCCGGGTAGGGGAGGG - Intronic
955235682 3:57137037-57137059 CTTTGGGGTTGCGGAGGGGAAGG + Intronic
955336308 3:58089004-58089026 CACTGTGGCAGGGGAGGGAAGGG - Intronic
961512875 3:127413733-127413755 CTTTATGGCAGGGGAGGGGAAGG - Intergenic
961660058 3:128463741-128463763 GTCTGTGGCCGTGGTGGGGGAGG + Exonic
961678688 3:128584230-128584252 CTCTCTCCCCGTGGAGGGGAAGG + Intergenic
963040184 3:141064720-141064742 CTCTCAGGCCAGGGAGGGGAGGG + Intronic
965367045 3:167813883-167813905 CTGTGTGGCTGCAGTGGGGAGGG - Intronic
966252960 3:177887451-177887473 CTCTGTGGTGGCAGAGTGGAGGG - Intergenic
966982844 3:185153570-185153592 CCCTGTGGCCGCGCTGGGGCAGG - Intergenic
967976881 3:195040493-195040515 CACTGAGGCCTCAGAGGGGAGGG + Intergenic
969337356 4:6519489-6519511 CTGTGTGGCTGCAGAGGAGAGGG - Intronic
969438000 4:7199605-7199627 CTCTGTGGCCTGGGTGGGGCGGG + Intronic
969503599 4:7570161-7570183 TTCAGTGGCTGCGGAGGGGAGGG + Intronic
972312175 4:37891438-37891460 CCGCCTGGCCGCGGAGGGGAAGG + Intronic
972769286 4:42181481-42181503 CTCTTTGGCTGCTGTGGGGAAGG + Intergenic
978072596 4:104491471-104491493 CTCTGGGGCAGCGGCGGGGGCGG - Exonic
980969363 4:139555436-139555458 CTCGGGGGCAGCTGAGGGGAGGG + Intronic
981121586 4:141057550-141057572 CTTTGGGGACTCGGAGGGGAAGG - Intronic
981516814 4:145619147-145619169 TTCTCTGGCGGGGGAGGGGAGGG - Exonic
981942418 4:150296910-150296932 CTCTGTGCCGGCGGTGGGGGTGG - Intronic
986206639 5:5630705-5630727 CTGTGTGGCCCTGGAGGGCAAGG - Intergenic
986928897 5:12794625-12794647 CTGTGCGGCCGCGAAGGGCAGGG + Intergenic
987132485 5:14872059-14872081 CGCTGAGGGCGCGGCGGGGACGG + Intergenic
988564932 5:32313031-32313053 CTCTGGGCCCGCGCACGGGATGG - Intergenic
990553602 5:56909157-56909179 CTCTGGGGCCACGGAGAGAAGGG + Intergenic
995153400 5:108879402-108879424 CACTGGGGCCTCTGAGGGGAGGG - Intronic
998146693 5:139733331-139733353 CGCTGAGGCAGCGGAGGGAAGGG - Intergenic
998545666 5:143025320-143025342 CTCTGAGGCAGCGAAGGGCAGGG - Intronic
1000336049 5:160242394-160242416 CTCTGTGACCGAGGAAGGGAAGG - Intergenic
1006169877 6:32086617-32086639 CCCTGTGGCTGCTGTGGGGAGGG - Intronic
1006340494 6:33443853-33443875 CTCTGTTGCCGTGGACGGGCGGG - Exonic
1006438970 6:34041511-34041533 GTCAGTGGACACGGAGGGGAGGG - Intronic
1006819372 6:36879427-36879449 CACTGGGGCCGCTGAGGGAAAGG + Intronic
1007697621 6:43743849-43743871 ATCTGTGGCCTGAGAGGGGAAGG + Intergenic
1008872885 6:56292393-56292415 CTCTTTGGCGGGGGAGGGGGGGG - Intronic
1013770996 6:113628164-113628186 GCCTGAGGCCTCGGAGGGGATGG + Intergenic
1015678885 6:135781638-135781660 CTCTGTGGCCGCTCAGGGCAGGG - Intergenic
1015935642 6:138404223-138404245 CCCTGTCGCCGCGGAGGGGCGGG + Exonic
1018759264 6:166876694-166876716 CTCTGTGGCTCCGAAGGGCAGGG + Intronic
1019735062 7:2646507-2646529 CTCTGGGGACCCGGTGGGGAGGG + Intronic
1019983923 7:4641731-4641753 CTCTGTGGCCGGGCAGGGGAGGG - Intergenic
1021125942 7:16851202-16851224 GTCTGCGGCTGCGGAGGGCACGG + Intergenic
1022048612 7:26643638-26643660 CTCAGTGGCGGCGGGGGGGGGGG + Intronic
1022214305 7:28243196-28243218 CTCTGTGTCCCAGGAGGGCAAGG + Intergenic
1023080759 7:36524037-36524059 CTCTGAAGTCACGGAGGGGATGG - Intronic
1024237871 7:47411695-47411717 CGCTGTGGCCGCAGATGGGTTGG - Intronic
1026015091 7:66666217-66666239 CTCTGAAGCCGGGGAGGGGACGG + Intronic
1026889833 7:73975283-73975305 CTCGGGGGCGGCTGAGGGGACGG - Intergenic
1026891493 7:73985367-73985389 CTCTGAAGCCGGGGAGGGGATGG + Intergenic
1027224221 7:76233954-76233976 CTCTGAGGCCAGAGAGGGGAGGG + Intronic
1029276772 7:99409760-99409782 CTCTGTGGGCGGGGGGGGGGTGG + Intronic
1031485081 7:122315653-122315675 CCCTGTGGCTGCGGTTGGGAAGG - Intergenic
1032076943 7:128840536-128840558 CTCTGTGCCCTCTGAGGAGATGG - Exonic
1032754686 7:134878067-134878089 CTCTGTGGGTGGGGAGGTGAAGG - Intronic
1034342770 7:150368842-150368864 CGCTGTCGCCGCGGCGGGGCGGG + Exonic
1034420869 7:150989957-150989979 CTCTGTGGCCACAGGGAGGATGG - Intergenic
1035221385 7:157408443-157408465 CTGTGTGTCCCCAGAGGGGAGGG - Intronic
1035283645 7:157793078-157793100 CGCTGTGCCCGGGGAGAGGAAGG + Intronic
1035512951 8:206342-206364 CTCCGCGTCCCCGGAGGGGAGGG + Intergenic
1035781137 8:2229164-2229186 CTCTGTGGGCTCAGTGGGGATGG + Intergenic
1036642809 8:10594566-10594588 CTGTGGGGCTGGGGAGGGGAGGG + Intergenic
1036663968 8:10726767-10726789 CTCTGTGGCTGGGAGGGGGAAGG - Intronic
1036752720 8:11453577-11453599 CCCTGTGGAGGTGGAGGGGAGGG + Intronic
1037551698 8:19980051-19980073 TTCGGTGGCAGCGGAGGTGAGGG + Intergenic
1037758966 8:21729401-21729423 CCCTGTGGGCCTGGAGGGGAGGG - Intronic
1038252908 8:25923018-25923040 CTCTGTGGCCTCTGAGTGAAGGG - Intronic
1038828355 8:31032434-31032456 GTCTGTGGCAGCGGAGCTGAAGG - Exonic
1039889184 8:41672782-41672804 CTCCGTGGCCGCCAAGGGGATGG + Exonic
1039903109 8:41767100-41767122 GGCTGCGGCCGCGGAGGGGCTGG - Intronic
1044712023 8:95067577-95067599 CTCTGTCCACACGGAGGGGAGGG + Intronic
1045143810 8:99316288-99316310 CTTAGTGGCAGCGGAGGGCAGGG + Intronic
1048183644 8:132218883-132218905 CTCTGTGGCCAAGGAGAGAAGGG - Intronic
1048251702 8:132871490-132871512 GTGTGTGGACGCAGAGGGGATGG + Exonic
1049006647 8:139859886-139859908 GTCTGTGGCCCCAGAGGGGCTGG - Intronic
1049122846 8:140755417-140755439 CGGTGTGGCCGCGGAGTAGAGGG - Intronic
1049433611 8:142576356-142576378 CTCTGGGGGTGCAGAGGGGAGGG - Intergenic
1049452594 8:142670097-142670119 CTGGGTGGCCGCGGAGGGCGTGG + Intronic
1049819813 8:144626787-144626809 GTCTCTAGCCGAGGAGGGGAGGG - Intergenic
1050243843 9:3667161-3667183 CTTTGAGGCCTTGGAGGGGAAGG + Intergenic
1051805654 9:20990185-20990207 CACTGAGGCCGAGGAGGAGAGGG - Exonic
1053264543 9:36701103-36701125 CTCTGAGCCCCTGGAGGGGAGGG + Intergenic
1054849786 9:69835924-69835946 CTCCGTGTCAGCGGAGGAGAGGG - Intronic
1055513392 9:77016147-77016169 AGCTGGGGCCGCGGTGGGGAGGG - Intergenic
1055994138 9:82139346-82139368 TTCTTTGGCCACGGAGGAGAAGG + Intergenic
1056757584 9:89391617-89391639 CTCTGAGGCCGAGGAGGTGGGGG - Intronic
1057050172 9:91917601-91917623 ATCTGTGCCCGCTGTGGGGAGGG - Intronic
1057141470 9:92729026-92729048 CTCTGTGGCCCAGGAGCTGAAGG - Exonic
1057705550 9:97392566-97392588 GTCTGTGGCTGGGGAGGGGCTGG - Intergenic
1060429140 9:123533847-123533869 CACAGTGGCCGTGGAGGAGAGGG - Intronic
1061073870 9:128328841-128328863 CCCTGTCGCTGTGGAGGGGAGGG + Intronic
1061236908 9:129348719-129348741 CGCTGTGGGAGGGGAGGGGATGG - Intergenic
1061715958 9:132519081-132519103 CTCTGTGACCCCAGAGGGCAGGG + Intronic
1061773259 9:132944275-132944297 CTCCTTGGCCCCCGAGGGGACGG - Intronic
1062428295 9:136516093-136516115 GCCTGGGGCCGGGGAGGGGAGGG + Exonic
1062461740 9:136665278-136665300 CTCTGGGCCTGCGGTGGGGACGG + Intronic
1185847108 X:3447864-3447886 CAGTGTGGCCTCGTAGGGGAAGG + Intergenic
1186582919 X:10840278-10840300 CTCTGGGGACTCGGTGGGGAAGG + Intergenic
1186857458 X:13639891-13639913 CTGTGTGGCAGAGGAGTGGAGGG - Intergenic
1188002150 X:24993324-24993346 CTCTGTGGACAGGGATGGGATGG + Intronic
1189260882 X:39678128-39678150 CTCTGGGGCTGTGCAGGGGATGG + Intergenic
1192125621 X:68498653-68498675 CTCGGTAGCCGGGGAAGGGAAGG + Exonic
1194075954 X:89394280-89394302 CTCTGTGGACTCAGGGGGGAAGG - Intergenic
1195138168 X:101931762-101931784 CACTATGGCGGCGGCGGGGAGGG - Exonic
1201063634 Y:10069535-10069557 CTCTCTGGCTGCTGAGGCGAGGG + Intergenic
1201416560 Y:13753238-13753260 CTCTCCTGCCGGGGAGGGGAGGG + Intergenic
1201436477 Y:13964321-13964343 TTTTGTGGCGGCGGTGGGGAAGG - Intergenic