ID: 1081865355

View in Genome Browser
Species Human (GRCh38)
Location 11:46356666-46356688
Sequence CATCCAGGGTGGAGCCTGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 240}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081865348_1081865355 1 Left 1081865348 11:46356642-46356664 CCGCGGTGTTTTGTTTGCCAGAA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1081865355 11:46356666-46356688 CATCCAGGGTGGAGCCTGAGGGG 0: 1
1: 0
2: 1
3: 17
4: 240
1081865342_1081865355 28 Left 1081865342 11:46356615-46356637 CCACGTGGTGCCACGTGGAAAAG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081865355 11:46356666-46356688 CATCCAGGGTGGAGCCTGAGGGG 0: 1
1: 0
2: 1
3: 17
4: 240
1081865345_1081865355 18 Left 1081865345 11:46356625-46356647 CCACGTGGAAAAGGGACCCGCGG 0: 1
1: 0
2: 0
3: 2
4: 33
Right 1081865355 11:46356666-46356688 CATCCAGGGTGGAGCCTGAGGGG 0: 1
1: 0
2: 1
3: 17
4: 240
1081865347_1081865355 2 Left 1081865347 11:46356641-46356663 CCCGCGGTGTTTTGTTTGCCAGA 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1081865355 11:46356666-46356688 CATCCAGGGTGGAGCCTGAGGGG 0: 1
1: 0
2: 1
3: 17
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081865355 Original CRISPR CATCCAGGGTGGAGCCTGAG GGG Intronic
900912544 1:5611808-5611830 CATGCAGGGTGGAGGATCAGTGG + Intergenic
900919563 1:5661958-5661980 TGTCCCGGGTAGAGCCTGAGAGG - Intergenic
901236347 1:7669601-7669623 CAGGCAGGCTGGAGCCTGGGAGG - Intronic
901436971 1:9252897-9252919 CAACCAGGGTGGACACTGGGAGG - Intronic
903056445 1:20639486-20639508 CACCCAGGGTGGAGCATGTCAGG + Intronic
903811829 1:26038964-26038986 CAGCCAGGGTGGGGACTCAGCGG - Exonic
905409421 1:37757992-37758014 GATCCAGGGTGGAGACAGAGGGG - Intronic
906100171 1:43255279-43255301 CTCCCAGGATGGCGCCTGAGAGG - Intronic
906281070 1:44554230-44554252 TGTCCTGGGTGAAGCCTGAGTGG - Intronic
910701017 1:90074203-90074225 CATGCAGGAGGGAACCTGAGGGG - Intergenic
913521870 1:119652188-119652210 TTTCCAGGGTGGAGTTTGAGAGG + Intergenic
913714952 1:121523962-121523984 GATGGAGGTTGGAGCCTGAGTGG + Intergenic
915441157 1:155946267-155946289 CATCCCTGTTGGAGCCTGTGGGG - Intergenic
915636380 1:157189888-157189910 CATCCAGGCTGGAGCCAGGGAGG + Intergenic
916327738 1:163582110-163582132 CAGCCAGGTTTGAGCTTGAGGGG + Intergenic
917838692 1:178960332-178960354 CATCAAGGTTTGAGACTGAGTGG + Intergenic
917880809 1:179333955-179333977 CAACCATGGCGGAGCCAGAGGGG + Intronic
920048523 1:203149298-203149320 CATCCAGGGTTGTGGCAGAGCGG + Intronic
920128928 1:203715932-203715954 AATCTGGGGTGGGGCCTGAGTGG - Intronic
921049556 1:211501302-211501324 CACCAAGGGTGGAGCTGGAGAGG + Intergenic
921535756 1:216346781-216346803 GCTTCAGGGTGGAGCCTTAGAGG - Intronic
924037219 1:239949754-239949776 CATCCATGGAGGAGACCGAGGGG - Intergenic
1064284274 10:13978904-13978926 AATCATGGGTGGAGCTTGAGGGG - Intronic
1064640235 10:17408122-17408144 GATCCAGAGCGGAGCCTGACTGG - Intronic
1067084911 10:43232840-43232862 CAGCAAGGGTGGACTCTGAGAGG - Intronic
1069744285 10:70705237-70705259 CATCCAGGACGCAGCCTCAGGGG - Intronic
1069873642 10:71548241-71548263 CATGCGGGGTGGAGACAGAGAGG + Intronic
1071274456 10:84040363-84040385 CATCCAGGCTGGAGCTGCAGTGG + Intergenic
1073115885 10:101091409-101091431 CCTGCTGGGTGGGGCCTGAGGGG - Intronic
1073814018 10:107185742-107185764 CCTTGAGGGTGGAGGCTGAGAGG + Intergenic
1076251090 10:128984405-128984427 CAGCCAGGCTGGAGCCTGCATGG - Intergenic
1076437991 10:130459597-130459619 CATCCAAGGTGAAGAGTGAGGGG + Intergenic
1076438109 10:130460063-130460085 CATCCAAGGTGAAGAGTGAGGGG + Intergenic
1076477397 10:130762235-130762257 CATCCACGGTCAAGCCTGAATGG - Intergenic
1076843392 10:133057433-133057455 GAGCCAGGGAGGAGCCTGTGGGG - Intergenic
1077013875 11:391573-391595 CCTCCAGGGCAGAGCCTGCGTGG - Intergenic
1077055393 11:589903-589925 CGTGCAGGGTTCAGCCTGAGAGG + Intronic
1077114428 11:876947-876969 CATCCAGGCTGGAGCCTGCCAGG + Intronic
1077362843 11:2148321-2148343 CACCCAGGGTGGTGTCTGTGGGG - Intronic
1077364875 11:2157589-2157611 CACCCAAGGTGGTGCCTGACAGG + Intronic
1078250727 11:9614313-9614335 CGTCCTGGGTGGAGCCCCAGGGG - Intergenic
1080827680 11:35861550-35861572 CGTCCAGGGAGGAGAGTGAGAGG + Intergenic
1080868422 11:36215212-36215234 CAGCCAGGGAGGAGCAGGAGTGG + Intronic
1081810287 11:45910496-45910518 CAGCCAGGGTAGACACTGAGGGG + Intronic
1081865355 11:46356666-46356688 CATCCAGGGTGGAGCCTGAGGGG + Intronic
1083731123 11:64653315-64653337 CTGGCAGGGAGGAGCCTGAGAGG - Intronic
1088907355 11:114164735-114164757 TATCCAGGGCTGTGCCTGAGGGG + Intronic
1090204497 11:124877037-124877059 GGTCCAGGGTGCAGCCTGAGTGG + Intronic
1091339907 11:134802253-134802275 CAAGCAGGCTGGAGCCTGTGGGG - Intergenic
1092786699 12:12033030-12033052 CATCCTGATTGGGGCCTGAGAGG - Intergenic
1095965554 12:47864774-47864796 CCTCCAGAGTGGGGCCTGAGAGG - Intronic
1099049011 12:77761096-77761118 CATCCAGGCTGGAGTGTTAGTGG + Intergenic
1100316175 12:93446794-93446816 CAGGCATGGTGGAGGCTGAGTGG - Intergenic
1101321610 12:103677887-103677909 GATCCAGGGTGGTGACTAAGAGG - Intronic
1102347559 12:112169469-112169491 CCTCCAGCGTGGAGCCTGGCGGG + Intronic
1102483474 12:113240166-113240188 CAACTAGGCTGGAGGCTGAGTGG - Intronic
1104943219 12:132404484-132404506 CCTCCCTGGTGGATCCTGAGGGG + Intergenic
1106483810 13:30155701-30155723 CATCCAAGGTGGTGCCCGGGTGG + Intergenic
1107691191 13:42955260-42955282 CCTCCAGGGTGGGGACTGGGGGG + Intronic
1113313801 13:109157688-109157710 CATCCAGGGTGCATTCTAAGGGG - Intronic
1113322596 13:109250279-109250301 CATTCAGGGTGGAGGATTAGGGG - Intergenic
1113589119 13:111485962-111485984 CAGCCTGGATGGAGACTGAGCGG + Intergenic
1117772179 14:59144932-59144954 CTTCTAGCTTGGAGCCTGAGTGG + Intergenic
1118038304 14:61891989-61892011 CATCCAGGGGCGAGGCTGACTGG + Intergenic
1119520081 14:75278735-75278757 CAACCACGGTGGCGCCAGAGGGG - Intergenic
1121609724 14:95269641-95269663 CATCCAGGAAGGAGCCTGGTGGG - Intronic
1122199489 14:100113846-100113868 CAGGCAAGTTGGAGCCTGAGAGG + Intronic
1122288747 14:100668189-100668211 CTTCCTGGATGGAGTCTGAGAGG + Intergenic
1122290219 14:100676756-100676778 CAGCCAGGCAGGAGCTTGAGGGG - Intergenic
1122701898 14:103595340-103595362 CAAGCATGGGGGAGCCTGAGAGG - Intronic
1122712021 14:103665855-103665877 CCTCCAGGGTGGCGCCTGTGCGG - Intronic
1122892479 14:104739199-104739221 CATGCAGGGAGGAGGCTGACAGG - Intronic
1124206257 15:27723596-27723618 CACCCAGGGAGGAGCAAGAGGGG + Intergenic
1124291308 15:28455929-28455951 CATCGAGGGTGGCGGCTGCGGGG + Intergenic
1126915922 15:53466326-53466348 AATGCAGGATGGAGCCAGAGTGG - Intergenic
1127627753 15:60796874-60796896 CATCCAGGATGTAGCCTGTATGG - Intronic
1128322188 15:66701751-66701773 CTTCCAGGGTTGAGCCTCTGAGG - Intergenic
1129166971 15:73784262-73784284 CAGCCATGGAGGAGTCTGAGGGG - Intergenic
1130879899 15:88046070-88046092 CACCCAGGCTGGAGCATCAGTGG + Intronic
1130913022 15:88283950-88283972 CTTCCAGGGTGCAGCCTGTCAGG + Intergenic
1130945298 15:88546469-88546491 CATGCAGGGAGGAGCCTGCCGGG + Intronic
1131189348 15:90301348-90301370 CAGCCCGGAAGGAGCCTGAGGGG - Intronic
1132185143 15:99797336-99797358 CAGCCTGGAGGGAGCCTGAGGGG - Intergenic
1132431845 15:101767219-101767241 CAGCCTGGAGGGAGCCTGAGGGG + Intergenic
1132863063 16:2081000-2081022 CATCCAGGAAAGAGCCTGTGAGG - Intronic
1132899179 16:2244121-2244143 CAGCCTGGGTGGAGGCTGTGTGG - Intronic
1133262859 16:4563337-4563359 CCTCCAGGGTTGAGCCCGGGAGG - Intronic
1136617937 16:31410191-31410213 CAGACAGGGTGGAGAGTGAGAGG + Intronic
1136707468 16:32201742-32201764 CATCGAGGGTGGTGGCTGCGGGG - Intergenic
1136760443 16:32727675-32727697 CATCGAGGGTGGTGGCTGCGGGG + Intergenic
1136807660 16:33142711-33142733 CATCGAGGGTGGTGGCTGCGGGG - Intergenic
1139355838 16:66366689-66366711 CGTCCAGGGCTGAGCGTGAGTGG - Exonic
1139474186 16:67194423-67194445 CCTCCAGGCTGGTGCCTGATGGG - Exonic
1139550078 16:67668084-67668106 CATTGAGGCTGGAGCGTGAGTGG + Exonic
1140213563 16:72989768-72989790 CATGCAGGGTGGAGCTGGAATGG - Intronic
1141272420 16:82553455-82553477 CAAGAAGGGTGGAGCCTGGGTGG + Intergenic
1141657498 16:85423890-85423912 CATCCTGGATGGGGCCTCAGGGG - Intergenic
1203062596 16_KI270728v1_random:987990-988012 CATCGAGGGTGGTGGCTGCGGGG + Intergenic
1143564332 17:7712337-7712359 CATCCACGCGGGAGGCTGAGGGG - Intergenic
1143970585 17:10792339-10792361 CAGCCAGGGTGAGGCCCGAGGGG + Intergenic
1146669074 17:34724413-34724435 CAGACATGGTGGAGTCTGAGTGG - Intergenic
1147369264 17:39980583-39980605 AACCCAGATTGGAGCCTGAGGGG + Intergenic
1148332528 17:46820883-46820905 CATCCACAGTGGTGTCTGAGTGG - Intronic
1148767723 17:50048952-50048974 CATCAAGGCTGGAGCCTGGCGGG + Intergenic
1150236051 17:63593392-63593414 CATCCAGAAAGTAGCCTGAGAGG - Exonic
1150681572 17:67288863-67288885 GATCCTGGGTAGAGCCTGGGTGG + Intergenic
1151479515 17:74361948-74361970 AATCCATGGAGGAGGCTGAGTGG - Intergenic
1151678200 17:75610617-75610639 CAGCCAGGGAGGGGCCAGAGAGG - Intergenic
1154329248 18:13415912-13415934 CTTCCAGGATGGAGGTTGAGAGG + Intronic
1156536832 18:37872412-37872434 CTTCCTGAGTGAAGCCTGAGGGG + Intergenic
1156766494 18:40662966-40662988 CATCAATGGTGGAGCCAGAAAGG + Intergenic
1157683148 18:49622554-49622576 GATCCAGGTTAGAGCCAGAGGGG - Intergenic
1158489280 18:57895324-57895346 CACCCACGGAGAAGCCTGAGGGG + Intergenic
1160230342 18:77044026-77044048 CCTCCAGGGAGGAGGCAGAGAGG - Intronic
1160917948 19:1506704-1506726 CAGCCAGGGTGGGGGATGAGTGG - Intronic
1161265990 19:3365043-3365065 CATGCAGAGGGGAGCCTGTGGGG + Intronic
1161284109 19:3459965-3459987 CATCCAGGGTGGACTGTGAGGGG - Intronic
1161655547 19:5512243-5512265 CTTCCCTGGTGGAGCCTGTGAGG - Intergenic
1162125814 19:8499040-8499062 CTTCCAGAGGGGAGTCTGAGCGG + Exonic
1162844570 19:13382410-13382432 CTTCCAGGGAGGAGGCTGTGAGG - Intronic
1163745361 19:19043480-19043502 AACCCAGGGTACAGCCTGAGAGG + Intronic
1163834868 19:19567146-19567168 CAACCAGGATGGAGCCTCTGGGG - Intronic
1166071929 19:40393007-40393029 CTTCCTGGGTGGGGCCAGAGTGG + Intergenic
1166214371 19:41325800-41325822 TATCCAGGTTGGAGCCTCACTGG + Intronic
1166353739 19:42215052-42215074 CATCAAGGAAGGGGCCTGAGGGG - Intronic
1167413180 19:49356858-49356880 CATCCAGGGTGGGGAGTCAGTGG - Intronic
1167613083 19:50516754-50516776 TCTCCAGGGTGAAGGCTGAGGGG + Intergenic
926099274 2:10103654-10103676 CTTCCCTGGTGGAGCCTGAGAGG - Intergenic
926268937 2:11350418-11350440 CTTCCAGGGTGGGTCATGAGGGG - Intergenic
926395828 2:12441088-12441110 CACACAGGGTGGAGGCTCAGGGG + Intergenic
926803586 2:16684115-16684137 TATCCAGGGCTGAGCCTCAGTGG - Intergenic
931273780 2:60726191-60726213 CACCCAGGCTGGAGTGTGAGTGG - Intergenic
932098390 2:68873096-68873118 CAGCCGGGGTGCAGCCAGAGAGG + Intergenic
932108635 2:68972461-68972483 AATCCAGGGTGCATCCTCAGAGG + Intergenic
932909290 2:75788973-75788995 GGTCCAGGGTGAGGCCTGAGAGG - Intergenic
933303698 2:80571192-80571214 CATGCAGGTTGGGGTCTGAGCGG + Intronic
933580184 2:84117063-84117085 CTACTAGGGTGGAGCCTAAGTGG + Intergenic
933998822 2:87689495-87689517 AACCCAGGGTGGATGCTGAGTGG + Intergenic
937153767 2:119703688-119703710 AATCCAGCTTGGAGCCAGAGGGG - Intergenic
938146420 2:128838415-128838437 CAGCCAGGCAGGGGCCTGAGGGG + Intergenic
938250575 2:129812817-129812839 CATCCTGGGTGCAGCCTCACAGG + Intergenic
938696104 2:133836990-133837012 CTTTCAGGCTGGACCCTGAGGGG + Intergenic
938997390 2:136694829-136694851 CATCCAGGGAAGATCCTCAGAGG - Intergenic
939289463 2:140175032-140175054 AATCCAGGGTGAAACCAGAGAGG + Intergenic
942971487 2:181962481-181962503 TATCCAGGGAGGAGAGTGAGAGG + Intronic
946402081 2:219473496-219473518 CCTCCAGGGTTGGGCCTGGGAGG - Exonic
946903212 2:224392402-224392424 CACCCAGGTTGGAGCATTAGTGG - Intronic
947527698 2:230889336-230889358 CATCAAGGGAGGAGCCTGGTGGG - Intergenic
948464938 2:238147826-238147848 CGTCCAGGGTGGTGCCTGTGGGG - Exonic
1169548761 20:6679548-6679570 CCTCCAGGTTGGAAGCTGAGTGG - Intergenic
1171203091 20:23257300-23257322 CATCCTGGCTGGAGCCCAAGGGG + Intergenic
1171999177 20:31758722-31758744 CATCTAGTGGGGATCCTGAGAGG + Intronic
1173498587 20:43536163-43536185 CAGCCAGTGGGCAGCCTGAGAGG - Exonic
1174062572 20:47843189-47843211 CATCGAGGGTGGAGCCTTCCAGG - Intergenic
1174073062 20:47912309-47912331 CATCGAGGGTGGAGCCTTCCAGG + Intergenic
1174182709 20:48684805-48684827 CATTGTGGCTGGAGCCTGAGTGG - Intronic
1174196608 20:48776695-48776717 CTTCCAGAGAGGAGACTGAGTGG - Intronic
1174199098 20:48794569-48794591 CAGCCAGGCTGGAGCCTGCCAGG + Intronic
1174538708 20:51272963-51272985 CATCCAGTGTGGCCACTGAGTGG + Intergenic
1174565711 20:51463179-51463201 CAGCCAGAGTGGAGGCTGAGGGG - Intronic
1175332859 20:58176905-58176927 CATCCAGGGTCTAGCCTGGCAGG + Intergenic
1175928213 20:62481092-62481114 CTGCCAGGGTGGAGACTGGGGGG - Intergenic
1178857690 21:36264061-36264083 CATACAGTGTGGAGGGTGAGGGG - Intronic
1179658014 21:42857398-42857420 CACCCAGGGTGGGGCCCGAGGGG - Intronic
1183107206 22:35622936-35622958 CACCCATGCTGGAGCCAGAGTGG - Intronic
1183171748 22:36193473-36193495 CATACAGGGCAGAGTCTGAGAGG - Intronic
1183405658 22:37629481-37629503 CATCCAGGCTTGGGCCTGAAGGG - Exonic
1183459337 22:37940569-37940591 CTTCCTGTGTGGAGCCTGGGAGG - Intronic
1184523640 22:45009374-45009396 CTTCCAGGCTGGAGCCTGCCCGG - Intronic
1184946945 22:47810654-47810676 CATCCTGGAGGGAGCCTGACTGG + Intergenic
1185106291 22:48871729-48871751 CATCCAGGGAGGAAGCTGGGAGG - Intergenic
1185373568 22:50471746-50471768 CTCCCAGGGTGGAGGCTGGGAGG + Intronic
949105522 3:197222-197244 CCTCCCGGGTGCAGGCTGAGGGG - Intronic
949944588 3:9179981-9180003 CTTCCAGGCTGCAGCCTGCGAGG + Intronic
953884525 3:46707804-46707826 CAGCCTGCATGGAGCCTGAGTGG + Intronic
956894880 3:73649324-73649346 AATACAGGGTGCAGCCTCAGTGG - Intergenic
957156239 3:76548883-76548905 AATCCATGGTGGAGCTGGAGTGG - Intronic
959598367 3:108152153-108152175 CCTCCAGGGTGGAAGCAGAGAGG + Intergenic
961474167 3:127136487-127136509 AAGCCAGGGTAGAGCCTCAGTGG + Intergenic
961543265 3:127615033-127615055 CATACAGGATGCAGCCTGATGGG + Intronic
961789730 3:129366748-129366770 CCTCCAGGGTGGAGTGTGTGCGG - Intergenic
962324619 3:134422972-134422994 CTTCCTGGGTGCAGGCTGAGAGG - Intergenic
966923754 3:184631140-184631162 CAGCCAGCATGGAGCCGGAGTGG + Intronic
967963244 3:194941784-194941806 TGTCCCTGGTGGAGCCTGAGTGG + Intergenic
968300444 3:197609008-197609030 GATACAGGATGGACCCTGAGAGG - Intergenic
968626249 4:1627962-1627984 CATCCAGTGATGAGGCTGAGAGG + Intronic
969247750 4:5946257-5946279 CAGCCAGGCTGGGGCTTGAGGGG + Intronic
969524281 4:7696218-7696240 CACCCAGGGTGGGGCCTCTGGGG + Intronic
979758220 4:124368124-124368146 AGTCGAGGGTGGAGACTGAGAGG - Intergenic
983264756 4:165496606-165496628 CATCTGGGATGGGGCCTGAGGGG + Intronic
985785091 5:1889144-1889166 CTTCCGGGGTGGAGCCTGCTGGG - Intergenic
986674195 5:10168999-10169021 CAGCCATGCTGGAGCATGAGGGG - Intergenic
989962781 5:50436491-50436513 GATGGAGGTTGGAGCCTGAGTGG - Intronic
990346494 5:54876708-54876730 CAGCTAGGGTGGAGGCTGAGGGG + Intergenic
990765524 5:59178016-59178038 CCTAGAGGGTGGGGCCTGAGTGG + Intronic
992023976 5:72652766-72652788 TATCCAGGAGGGAGCCTGTGAGG - Intergenic
992178143 5:74171097-74171119 CAGCCAGGGTGGAGGCAGAAAGG + Intergenic
993841889 5:92890241-92890263 GATACAGGGTGGAGCCCTAGAGG - Intergenic
999738540 5:154531415-154531437 CATCCAGCATGCAGCCTGAAAGG + Intergenic
1000183200 5:158833020-158833042 CATCCTGGGAAGAGCCAGAGAGG - Intronic
1002167603 5:177358114-177358136 CACCCAGGGTGGAGCCCAGGAGG + Intronic
1002346560 5:178551969-178551991 CATCCTGAGTGGAGGCAGAGGGG - Intronic
1002536612 5:179879485-179879507 CTGCCAGGGTGCAGCCTGGGTGG + Intronic
1004544858 6:16588177-16588199 GAGCCAGGGTGGTGCCGGAGAGG - Intronic
1006828519 6:36954677-36954699 CAGCCAGGGTGGTGCTTGTGTGG + Exonic
1007284946 6:40740969-40740991 CCTCCAGGGTGGAACCTTTGTGG + Intergenic
1009810065 6:68650810-68650832 CATCAAGAAAGGAGCCTGAGAGG + Intronic
1010176207 6:73031006-73031028 ACTTCAGGGTGGAGCCAGAGTGG - Intronic
1010941346 6:81921466-81921488 CCACCAGGGTGGAGTCAGAGAGG + Intergenic
1013069739 6:106717597-106717619 CATCCATGATGGATCCTGTGTGG - Intergenic
1016372488 6:143389920-143389942 CAGACAGGGTGAGGCCTGAGGGG + Intergenic
1018810188 6:167293371-167293393 GAACCAGGGTGGAGCTGGAGTGG - Intronic
1018816660 6:167337428-167337450 CAGGCACGGTGGAGCCTGGGGGG + Intronic
1018923396 6:168190864-168190886 CATCCAGGAGGGAGACTGAGGGG + Intergenic
1019156518 6:170042741-170042763 CCTTCAAGGTGGATCCTGAGTGG + Intergenic
1019551517 7:1605256-1605278 CATCCATGCTGCAGCCTGTGTGG - Intergenic
1019614646 7:1953682-1953704 CATCCGTGGTGGAGCCTTGGTGG + Intronic
1025231875 7:57207957-57207979 CATCGAGGGTGGAGCCTTCCAGG + Intergenic
1026554292 7:71392447-71392469 CCTCCAGGGTGGAGTCCCAGGGG - Intronic
1027484662 7:78746373-78746395 CAGAAAGGGTGGAGCTTGAGAGG - Intronic
1028709478 7:93890807-93890829 CCGCCGGGGCGGAGCCTGAGGGG + Exonic
1029222941 7:99004481-99004503 GCTCCAGGGTGGACCCTGTGGGG + Intronic
1029643015 7:101832897-101832919 CATGCAGGGAGGGGCCGGAGAGG + Intronic
1032428036 7:131837643-131837665 CAGCCATGGTGAAGGCTGAGGGG + Intergenic
1032894996 7:136240685-136240707 CATCCAGGAGGGGGCCAGAGGGG + Intergenic
1034270772 7:149802620-149802642 CAGCCAGGGAGGAGCCAGGGTGG - Intergenic
1036011572 8:4731223-4731245 CATCTTGTGTGGAGGCTGAGTGG - Intronic
1037584880 8:20269445-20269467 CACCCAGAGTGGAGACTAAGTGG + Intronic
1037998048 8:23367825-23367847 CCTGCAGGGTGCAGCCTGAGTGG + Intronic
1039316468 8:36378226-36378248 CAGCCAGGGAAGAGCCTGTGAGG + Intergenic
1041401640 8:57451353-57451375 CAACTAGGGTGGAGCCTGAGGGG + Intergenic
1042745987 8:72106566-72106588 CAGCCAGGGTACAGCCTGTGAGG + Intronic
1045294909 8:100864152-100864174 CAACCAGGTGTGAGCCTGAGAGG - Intergenic
1047515145 8:125547382-125547404 CAGCAAAGGTGGAGCCTGATAGG + Intergenic
1048447439 8:134502535-134502557 CATACAGCGTGAAGCCTGAGAGG - Intronic
1048475854 8:134741798-134741820 CATCAGGGCTGGAGCATGAGAGG - Intergenic
1049279500 8:141737134-141737156 CAGCCAGGGCGTAGCCTGACCGG - Intergenic
1051817168 9:21121664-21121686 AATCCAGGCTGGAGGCTGACTGG + Intergenic
1052857971 9:33418673-33418695 CCTCCAGGGAGGAGACTCAGAGG + Intergenic
1056752907 9:89364726-89364748 CTGCCAGGGTGGAGCCTGGCTGG + Intronic
1057124084 9:92602559-92602581 CAGCCATGCTGGGGCCTGAGGGG + Intronic
1057587855 9:96345770-96345792 CCTCCAGGGTGCAGCCAGTGAGG + Intronic
1057733594 9:97633143-97633165 CATGCGGGGTGGGGCCTGGGCGG - Intronic
1060917347 9:127398908-127398930 CACCCAGGGAGGGGCCTGAGTGG - Intronic
1061216997 9:129227354-129227376 CATCGAGGGCAGTGCCTGAGAGG + Intergenic
1061589523 9:131589561-131589583 CAGCCATGGTGGAGGCTGTGTGG - Intronic
1061848398 9:133400787-133400809 CATCCAGGATGGGGTCTGATGGG - Intronic
1061871756 9:133524661-133524683 CCTCCAGGATGGGGCCTGTGTGG + Intronic
1061890549 9:133616954-133616976 CCTGCAGGGTGGATCCTCAGAGG - Intergenic
1062155557 9:135046282-135046304 CATCCCTGGTGGACCCTGGGTGG + Intergenic
1062284243 9:135766051-135766073 CATCCAGGGTGGACCATCTGGGG + Intronic
1062284331 9:135766372-135766394 CATCCAGGGTGGATCATCTGGGG + Intronic
1062380255 9:136283680-136283702 CAGCCTGGGTGCAGCCAGAGGGG - Intronic
1062533190 9:137010585-137010607 CATGTAGGGTGGGGCCTGGGTGG - Intronic
1187039062 X:15574117-15574139 CATGAAGTGTGGTGCCTGAGAGG - Intronic
1190905956 X:54728613-54728635 ATTCCTGGGTGGAGCCTGAGAGG - Intergenic
1194764357 X:97832039-97832061 CATTCAGGATCCAGCCTGAGGGG - Intergenic
1195991905 X:110691244-110691266 CATCTAGGATGCAGGCTGAGGGG + Intronic
1198843158 X:140880612-140880634 CATCCAGAGGGCAGCCAGAGAGG + Intergenic