ID: 1081866519

View in Genome Browser
Species Human (GRCh38)
Location 11:46363381-46363403
Sequence AGGGAAACTGAGGCCCGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1103
Summary {0: 1, 1: 2, 2: 24, 3: 178, 4: 898}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081866509_1081866519 27 Left 1081866509 11:46363331-46363353 CCTGTGACAAATTGTCAGCTCAG 0: 1
1: 0
2: 1
3: 8
4: 110
Right 1081866519 11:46363381-46363403 AGGGAAACTGAGGCCCGTGAGGG 0: 1
1: 2
2: 24
3: 178
4: 898
1081866510_1081866519 4 Left 1081866510 11:46363354-46363376 CCACTCTGACAGCCTCCCCAGAC 0: 1
1: 0
2: 1
3: 31
4: 339
Right 1081866519 11:46363381-46363403 AGGGAAACTGAGGCCCGTGAGGG 0: 1
1: 2
2: 24
3: 178
4: 898
1081866513_1081866519 -8 Left 1081866513 11:46363366-46363388 CCTCCCCAGACACACAGGGAAAC 0: 1
1: 0
2: 2
3: 46
4: 499
Right 1081866519 11:46363381-46363403 AGGGAAACTGAGGCCCGTGAGGG 0: 1
1: 2
2: 24
3: 178
4: 898

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081866519 Original CRISPR AGGGAAACTGAGGCCCGTGA GGG Intronic
900096301 1:941494-941516 AGGGAGGCTGAGGCCCATCAGGG + Intronic
900396864 1:2456682-2456704 GGGGAAACTGAGGCCCAAGGAGG - Intronic
900479883 1:2892938-2892960 GGGGAAACTGAGGCACGGGGGGG + Intergenic
900697729 1:4022634-4022656 AAGGAAACTGAGGCCCAGGAAGG - Intergenic
900906969 1:5566045-5566067 GGGTAAACTGAGGCTCGAGAGGG + Intergenic
901223177 1:7595675-7595697 GGGGAAACTGAGGCCCAGGCTGG + Intronic
901599159 1:10409051-10409073 AAGGAAACTGAAGTCCATGAAGG - Intronic
901634891 1:10665941-10665963 AAGGAAACTGAGGCCCAGGGAGG + Intronic
901665801 1:10825564-10825586 AAGGAAACTGAGGCTCAGGAAGG + Intergenic
901758417 1:11455385-11455407 GGGGAAACTGAGGCCCAGGGAGG + Intergenic
901866854 1:12112029-12112051 AGGTAAACTGAGGCCCGGGGAGG - Intronic
901873723 1:12153799-12153821 GGGGAAACTGAGGCCTGAGAAGG + Intergenic
901879493 1:12185565-12185587 AGGCAAACTGAGGCTCCAGACGG + Intronic
901910290 1:12451972-12451994 AGGAAAACAGAGGCCCGCAAAGG + Intronic
901952694 1:12761259-12761281 GGGGAAACTGAGGCCCGGAGAGG + Exonic
902174240 1:14637419-14637441 AGGAAAACTGAGGCTCGGAAAGG + Intronic
902184904 1:14717760-14717782 GGGGAAACTGAGGCCCAAGAGGG + Intronic
902201852 1:14839300-14839322 ATGGAAATTGAGGCCAGGGAAGG - Intronic
902292623 1:15445323-15445345 AGGGAAACTGAGGCACGGAGAGG + Intronic
902399281 1:16149165-16149187 AAGGAAACTGAGGCCTGAGGCGG + Intronic
902449091 1:16485325-16485347 GGGGAAACTGAGGCCCAAGAGGG - Intergenic
902466594 1:16622267-16622289 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
902468482 1:16632032-16632054 TGGGAAACTGAGGCCCAAGAGGG - Intergenic
902505653 1:16937956-16937978 GGGGAAACTGAGGCCCAAGAGGG + Intronic
902508064 1:16950782-16950804 AGGGAAACTGAGGCCCAGAGAGG + Intronic
902631735 1:17708762-17708784 GGGGAAACTGAGGCCAGTAGAGG - Intergenic
902662151 1:17912603-17912625 GGGGAAACTGAGGCCAGAGAGGG + Intergenic
902682036 1:18050418-18050440 GAGGAAACTGAGGCCCATAAAGG - Intergenic
902725652 1:18334420-18334442 AAGGAAACTGAGGCTCAGGACGG - Intronic
902758087 1:18562403-18562425 AGAGAAACTGAGGCCCAGAAAGG - Intergenic
902778704 1:18690872-18690894 GGGGAAAGTGAGGCCCGAGGAGG + Intronic
902806431 1:18863940-18863962 AGGGAAACTGAGGCCTGGAAAGG + Intronic
902813641 1:18903603-18903625 GAGGAAACTGAGGCCCGGAAAGG - Intronic
902839225 1:19064922-19064944 AGGGAAACTGAGGCCCAGGAGGG - Intergenic
902893536 1:19462516-19462538 GGGGAAACTGAGGCCCAAGGAGG + Intronic
903016401 1:20364920-20364942 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
903022048 1:20401466-20401488 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
903154638 1:21435616-21435638 GGGGAAACTGAGGCCCAAGAGGG + Intergenic
903231420 1:21924587-21924609 AGGAAAACTGAGGCCCGGGGAGG + Intronic
903287950 1:22288617-22288639 AAGGAAACTGAGGCCCATGATGG + Intergenic
903357784 1:22758679-22758701 AGGGAAACTGAGGCCTAGAAAGG - Intronic
903440703 1:23385935-23385957 AGGGAAACTGAGGCCCACACAGG - Intronic
903467011 1:23558824-23558846 AGGGAAACTGAGGCCAGAGAGGG - Intronic
903474175 1:23607961-23607983 AGGGAAACTGAGGCCTGAAGTGG - Intronic
903536937 1:24073158-24073180 GAGGAAACTGAGGCCCAGGAAGG + Intronic
903543340 1:24108782-24108804 AGGGAAACTGAGGTCTGAGAGGG + Intronic
903654088 1:24938354-24938376 GGGGAAACCGAGGCCCAGGAAGG + Intronic
903654983 1:24943502-24943524 GGGGAAACTGAGGCTCGGCAAGG + Intronic
903861762 1:26368696-26368718 AGGGAAACTGAGTCCAGGAAGGG - Intronic
903931676 1:26865616-26865638 AGGGAAACTGAGGCCCAGGGAGG - Intergenic
903974999 1:27143690-27143712 AGGGAAACTAAGGCCCAGGAAGG + Intronic
904203662 1:28838431-28838453 GGGGAAACTGAGGCCTGGAAAGG - Intronic
904301248 1:29556244-29556266 GGGGAAACTGAGGCCCAGGGAGG - Intergenic
904404304 1:30275927-30275949 GGGGAAACTGAGGCCCAGGGAGG + Intergenic
904430965 1:30463796-30463818 GGGGAAACTGAGGCCAGGGAAGG - Intergenic
904468702 1:30722967-30722989 GGGGAAACTGAGGTCAGTGAGGG - Intronic
904611681 1:31729273-31729295 AGGGAAACTGAGACCCAGGGAGG + Intronic
904623083 1:31787281-31787303 AGGGAAACTGAGGCTCAGAAAGG + Intergenic
905210841 1:36373129-36373151 GAGGAAACTGAGGCCCCTGAAGG - Intronic
905274791 1:36810217-36810239 ATGGGAACTCAGGCCTGTGATGG - Intronic
905340446 1:37274094-37274116 GGGGAAACTGAGGCCAAGGAGGG - Intergenic
905394005 1:37655753-37655775 AGGGAATCTGAGCCCCAGGAAGG - Intergenic
905410040 1:37762259-37762281 GGGGAAACTGAGGCTCCAGAGGG + Intronic
905445884 1:38028383-38028405 AGAGACACTGAGACCAGTGATGG + Intergenic
905627421 1:39498134-39498156 GGGGAAACTGAGGCCAAGGAGGG - Intronic
905651277 1:39658675-39658697 GGGGAAACTGGGGGCCATGAAGG + Intergenic
905669007 1:39778977-39778999 GGGGAAACTGAGGCCAAGGAGGG + Intronic
905847189 1:41242441-41242463 GGGAAAACTGAGGCCTGAGAGGG + Intergenic
905919848 1:41712072-41712094 GGGGAAACTGAGGTCCGGGGAGG + Intronic
906677930 1:47707122-47707144 AGGGAAACTGAGGTCCAGGTAGG + Intergenic
906679980 1:47719936-47719958 AGGGAAACAGAGGCCCAGGGAGG + Intergenic
906790251 1:48653020-48653042 AGAGAAACTGAGCCCAGAGAGGG + Intronic
906825009 1:48970007-48970029 AGGAAAACTGAGGCACAGGAAGG + Intronic
907094033 1:51758989-51759011 CGGGAAACTGAGGCCCATAGAGG + Intronic
907251150 1:53140764-53140786 AAGGAAACTGAGGCCCAGGGAGG + Intronic
907482919 1:54757157-54757179 GGGGAAACTGAGGCCCCAGCAGG + Exonic
907513658 1:54980326-54980348 AGGGAAACTGAGGCCCAGACAGG - Intergenic
907518458 1:55008091-55008113 GAAGAAACTGAGGCCCGGGAAGG + Intronic
907928843 1:58980148-58980170 GGGGAAACTGAGACCCTTGAAGG + Intergenic
908074789 1:60504012-60504034 CGAGAAACTGAGGGCCATGAAGG - Intergenic
908088455 1:60661709-60661731 TGGGACACTGAGGCCCATGAGGG + Intergenic
909867279 1:80688652-80688674 AAGGAAACTGAGGCACAAGATGG + Intergenic
910217571 1:84857818-84857840 GAGGAAACTGAGGCCCGAAAAGG - Intronic
911226028 1:95306694-95306716 GAGGAAACTGAGGCCCATGGAGG - Intergenic
913466281 1:119146420-119146442 ACGGAAAAAGAGGCACGTGAAGG - Intergenic
913530581 1:119731654-119731676 AAGGAAACTGAGGCCCAGGAAGG + Intronic
914429961 1:147612199-147612221 AAGGAAACTGAGGCCTGGAATGG + Intronic
915126730 1:153670728-153670750 GGGGAAACTTGGGCCCGGGATGG - Intronic
915273964 1:154775398-154775420 AGAGAAACTGAGGCTCGGCAAGG - Intronic
915275425 1:154784844-154784866 AGGGAAACTGAGGCTCGGAGAGG + Intronic
915455990 1:156041138-156041160 GGGAAAACTGAGGCCCGGAAAGG - Intronic
915595239 1:156893377-156893399 AGGAAAGCTGAGGCACGAGAGGG + Intergenic
915626700 1:157118336-157118358 AGGGAAACTGAGGCACGGAGAGG + Intergenic
916369531 1:164074618-164074640 AGGGGAACTGAGGCCAAGGAAGG - Intergenic
916619950 1:166486397-166486419 GGGGAAACTGAGGCACAGGAAGG + Intergenic
916839430 1:168584635-168584657 AGGGAAACTGAGGCATGTGTGGG + Intergenic
917235431 1:172887008-172887030 AGGGAAACTGAGGCCTGAAAAGG - Intergenic
917388059 1:174499606-174499628 AAGGAAACTGAGGCTCGGAATGG - Intronic
917487209 1:175466190-175466212 ATGGAAACTGAGGCTCATGGAGG + Intronic
918043254 1:180925992-180926014 GGGGAAACTGAGGCCCAGGGAGG + Intronic
919219723 1:194611695-194611717 AGGGAAACTGAGGCTCTTCCAGG - Intergenic
919855744 1:201704901-201704923 AGGGAAACTGAGGCCCAAAGAGG + Intronic
920073274 1:203318727-203318749 AGGAAAACTGAGGCTCATGAAGG - Intergenic
920184227 1:204150641-204150663 AGGGAAACTGAGGCAGGAGAGGG + Intronic
920433930 1:205936227-205936249 AGGGAAACTGAGGTCTGGGAAGG - Intronic
920961870 1:210670881-210670903 GGGGAAACTGAGGCCCTAGTAGG + Intronic
921978567 1:221229222-221229244 AGGGAAACTGAGGCACGGATAGG - Intergenic
922161536 1:223082027-223082049 AGGGAAACTGAGGCTCAGCAAGG + Intergenic
922476580 1:225910935-225910957 AGGGAAACTGAGGCCTGGAGAGG - Intronic
922741022 1:228014261-228014283 GGGGAAACTGAGGCCCAGGAGGG + Intronic
922800739 1:228363732-228363754 GGGGAAACTGAGGCCTGGGTTGG + Intronic
923361607 1:233217499-233217521 AGGGAAACTGAGGCATGAAAAGG + Intronic
923802582 1:237224907-237224929 GAGGAAACTGAGGCCCAGGAAGG + Intronic
924195077 1:241598174-241598196 GGGGAGACTGAGGCCCGGCAAGG - Intronic
1063526144 10:6788087-6788109 AATGAAACTGAGGCCCATGAAGG + Intergenic
1064109999 10:12530382-12530404 AAGGAAACTGAGGCCCAGAAAGG - Intronic
1065312914 10:24433600-24433622 AGGGAAACTAAGGCCCAAAAAGG + Intronic
1065553063 10:26888461-26888483 AGGGACAGTGAGGCCAGGGAAGG - Intergenic
1066581487 10:36887128-36887150 AGGGACAGTGAGGCCAGGGAAGG - Intergenic
1067801662 10:49363288-49363310 AAGGAAACTGAGGCACATTAAGG - Intergenic
1067841860 10:49687552-49687574 AAGGAAACTGAGGCTCATAAAGG - Intronic
1069627059 10:69874842-69874864 AGGGAAACTGAGGCCCAGGCTGG + Intronic
1069708956 10:70477214-70477236 AAGGAAACTGTGGCCCAGGATGG + Intergenic
1069718239 10:70534250-70534272 AGGGAAACTGAGGCCCAGAAAGG - Intronic
1069734823 10:70647123-70647145 AAGGAAACTGAGGCACTTAAAGG + Intergenic
1069788551 10:71005024-71005046 GGGGAAACTGAGGCCCCAGGAGG + Intergenic
1069800971 10:71081233-71081255 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1069852965 10:71422514-71422536 GGGGAAACTGAGGCCCAGAAAGG - Intronic
1069918826 10:71803583-71803605 GGGAAAACTGAGGCCGGAGAAGG + Intronic
1070660419 10:78301857-78301879 GGGGAAACTGAGGCTCAGGAAGG + Intergenic
1070732995 10:78844609-78844631 GGGAAAACTGAGGCCCAGGAAGG - Intergenic
1070751369 10:78965815-78965837 TGGGAAACTGAGGCCAGAGAGGG - Intergenic
1070838763 10:79468770-79468792 AGGGAAACTGAGGCTCTGAAAGG + Intergenic
1071133021 10:82417645-82417667 GGGGAAACTGAGGCACGGGGCGG + Intronic
1071481472 10:86068142-86068164 AAGGAAACTGAGGCTCGGAATGG + Intronic
1072449916 10:95531715-95531737 GGGGAAACTGAGACCTGGGAAGG - Intronic
1072735800 10:97878806-97878828 AGGGAAACTGAGGCACAGCATGG + Intronic
1073447548 10:103590497-103590519 TGGGAAACTGAAGCCCTTGAAGG + Exonic
1073606711 10:104902816-104902838 GGGGAAACTGAGGCCTGGAAAGG + Intronic
1073852088 10:107633251-107633273 AGGGCATGTGAGGCCCCTGATGG - Intergenic
1074296146 10:112191437-112191459 AGGGAAACTGGGGCCCTGCATGG + Intronic
1074596936 10:114876434-114876456 AAGGAAACTGAGGCTCGGGGAGG - Intronic
1074706133 10:116133531-116133553 AGGGAAACTGATGCCCATGGGGG - Intronic
1075078209 10:119365667-119365689 GGGGAAACTGAGGCCGGGTAGGG - Intronic
1075083204 10:119397444-119397466 AGGGAAACAGAGGCCCAGGGAGG - Intronic
1075722124 10:124593379-124593401 GTGGAAACTGAGGCCCGGGAGGG - Intronic
1075832342 10:125422103-125422125 AGGAAAACTGAGGCTCAGGAAGG + Intergenic
1076122535 10:127947872-127947894 GGGGAAACTGAGGCCTGTTGTGG + Intronic
1076142790 10:128093055-128093077 AGGGAAACTGAGGCTCAGAAAGG + Intergenic
1076162450 10:128255903-128255925 AGGGAAAGTGGGGCCTGGGAGGG + Intergenic
1076412778 10:130263869-130263891 TGGGAGACTGAGGCCCATGGTGG + Intergenic
1077076958 11:706317-706339 GGGTAAACTGAGGCCCGGGCGGG - Intronic
1077121430 11:910718-910740 AGGGAAACTGAGGCCGTGCAAGG + Intronic
1077143036 11:1033256-1033278 AAGGAAGCTGGGGCTCGTGAAGG - Intronic
1077230138 11:1455038-1455060 AGGGAAACTGAGACACCTGAGGG - Intronic
1077315753 11:1918703-1918725 AGGGAAACTGAGGCACCAGGTGG - Intergenic
1077350815 11:2092434-2092456 GGGGAAACTGAGGCTCATGTTGG + Intergenic
1077367670 11:2167679-2167701 GGGGAAACTGAGGCCCAGGGGGG - Intronic
1077464335 11:2726464-2726486 GGGGAAACTGAGGCCCCAGGCGG + Intronic
1077465785 11:2733065-2733087 GGGGAAACTGAGGCTCCAGAAGG - Intronic
1077580854 11:3416393-3416415 AGGGAAACTGAGGCTAAAGAAGG + Intergenic
1077606915 11:3618484-3618506 AGAGAAGCTGAGGCCTGGGAAGG + Intergenic
1077647125 11:3935261-3935283 GGGGAAACTGAGGCCCACCATGG + Intronic
1078190665 11:9091034-9091056 GGGGAAACTGAGGGCCGGGCCGG - Intronic
1078209885 11:9262556-9262578 GGGGAAAATGAGGCCCAGGAAGG - Intronic
1078604074 11:12759525-12759547 ATGGAAACTGAGGCACATGGGGG + Intronic
1078656228 11:13242961-13242983 AGGAAAACTGGGGCCCTGGAAGG + Intergenic
1078849864 11:15153809-15153831 GGGGAAACTGAGGCCCGGAGAGG + Intronic
1079088074 11:17461458-17461480 GGGGAAACTGAGGCTGGTGAGGG - Intronic
1079251431 11:18790832-18790854 GGGGAAACTGAGGCCCAGTAAGG - Intronic
1080532240 11:33188326-33188348 AGGGGAAGTCAGGCACGTGACGG - Intergenic
1080879291 11:36304040-36304062 AGGGACACTGTGGCCCAGGAGGG + Intronic
1081675096 11:44964001-44964023 GGGAAAACTGAGGCCTGGGAAGG + Intergenic
1081771643 11:45653908-45653930 AAGGAAGCTGAGGCCCTTCAAGG + Intronic
1081773099 11:45661789-45661811 AGGGAACCTGAGGGCCATGGAGG + Intronic
1081866519 11:46363381-46363403 AGGGAAACTGAGGCCCGTGAGGG + Intronic
1081874310 11:46398152-46398174 GGGGAAACTGAGGCCTAGGATGG + Intronic
1082001860 11:47397503-47397525 AAGGAAACTGAGGCTCGGGGAGG + Intergenic
1083171772 11:60927531-60927553 GGGGAAACTGAGGCCCATAAAGG + Intronic
1083266151 11:61547783-61547805 AGGGAAACTGAGGCCAGGAGAGG - Intronic
1083269482 11:61564501-61564523 AAGGAAACTGAGGCTCAGGAGGG + Intronic
1083276530 11:61600045-61600067 GGGGAAACTGAGGCCCAGAAAGG - Intergenic
1083288494 11:61676438-61676460 AAGGAAACTGAGGCCAGAGTGGG + Intergenic
1083293589 11:61703316-61703338 AGGAAAACTGAGTCCTATGATGG + Intronic
1083304911 11:61757113-61757135 AGAGAAACTGAGGCCCAGGAAGG - Intronic
1083618549 11:64037838-64037860 AGGGAAACTGAGGCACAGGGAGG - Intronic
1083642394 11:64152592-64152614 AGGGAAACTGAGGTCTGGGGAGG + Intronic
1083652169 11:64210083-64210105 AGGGAAACTGAGGCCCAGTGAGG + Intronic
1083822347 11:65180656-65180678 AGGAAAACTGAGGCCTGAGAGGG - Exonic
1083855656 11:65391913-65391935 AGGGAAACTGAAGCTGGGGAAGG - Intronic
1083903831 11:65657283-65657305 AGGGTAACTGAGGACAGTGGTGG + Intronic
1083904263 11:65659965-65659987 TGGGAAACTGAGTCCCAGGAGGG - Intronic
1084031083 11:66480808-66480830 AGGGAAACTGAGGCTTGGAAAGG - Intronic
1084118019 11:67053150-67053172 GGGGAAACTGAGGCCTGAGAAGG - Intergenic
1084237781 11:67799223-67799245 AGGGAAACTGAGGCTAAAGAAGG + Intergenic
1084385821 11:68842023-68842045 AGGGAAACTGAGGCTCGAGCGGG + Intronic
1084475328 11:69385573-69385595 GGGGAAACTGAGGCCCAAGCCGG + Intergenic
1084534748 11:69750148-69750170 AAGGAAACTGAGGCCCGGGGCGG + Intergenic
1084553343 11:69862173-69862195 AGGCAAACAGAGACCCGTGGAGG + Intergenic
1084674862 11:70628419-70628441 AGGGAAACCGAGGCCTGGGTAGG - Intronic
1084684786 11:70687200-70687222 GGGGAAACTAAGGCCCGTGCAGG + Intronic
1084834627 11:71793610-71793632 AGGGAAACTGAGGCTAAAGAAGG - Intronic
1085041841 11:73331338-73331360 GGGGAAACTGAGGCCATGGAGGG + Intronic
1085197871 11:74683313-74683335 AGGGAAGCTGAGGCCCTAGTGGG + Intergenic
1085393755 11:76195738-76195760 AAGGAAACTGAGGCTGGAGAAGG - Intronic
1085395077 11:76203097-76203119 GGGGAAACTGAGGCCCGGAAAGG + Intronic
1085399443 11:76226955-76226977 AGAGAAACTGAGGCCCAGGGAGG + Intergenic
1085406508 11:76266261-76266283 AGGGAAACTGAGGCCTAGAAAGG - Intergenic
1085411879 11:76296306-76296328 GGGGAAACTGAGGCCCAGGGAGG + Intergenic
1085415871 11:76318686-76318708 AGGTAAACTGAGGCCCCCAAGGG - Intergenic
1085475267 11:76784940-76784962 AGGGAAACTGAGGCCGGAGAGGG - Intronic
1085511697 11:77091464-77091486 AAGGAAACTGAGGCCCAGGGAGG - Intronic
1088183444 11:107137805-107137827 ATGGAAACAGAGGCCTGGGAAGG - Intergenic
1088251184 11:107862114-107862136 AGGGAAACAGAGGCCAGGCATGG + Intronic
1088744709 11:112795839-112795861 AGGTAAACTGAGGCCCAGGAGGG + Intergenic
1089077930 11:115753542-115753564 AGGGAGAGTGAGGCCAGGGAAGG + Intergenic
1089215083 11:116830244-116830266 AGGGAAACTGAGGCCTGGAGAGG + Intronic
1089288210 11:117421118-117421140 GCGGAAATTGAGGCCCATGAGGG + Intergenic
1089603814 11:119630187-119630209 GGGGAAACTGAGGCCCTGGGAGG - Intronic
1089665843 11:120018346-120018368 AGGGAAACTGAGGCACCACAAGG + Intergenic
1089709562 11:120305371-120305393 AGGGAAACTGAGGACGTTGCTGG + Intronic
1090651169 11:128807489-128807511 AAAGAAACTGAGGCCCGGGGAGG + Intronic
1091418232 12:310156-310178 AGAGAAACTGAGGCTCAGGAAGG + Intronic
1091629116 12:2145919-2145941 ATGGAAACTGAGGCTCAGGAGGG - Intronic
1091704140 12:2682235-2682257 AGGGAAACTGAGGCATGAGGTGG + Intronic
1091713684 12:2760883-2760905 AGGGAAACTGAGGCATGTGTTGG + Intergenic
1092408454 12:8236820-8236842 AGGGAAACTGAGGCTAAAGAAGG + Intergenic
1095375247 12:41519648-41519670 AGGAAAAATGAGGAACGTGAGGG + Intronic
1095375379 12:41521623-41521645 GAGGAAACTGAAGCCTGTGAAGG + Intronic
1096119853 12:49081321-49081343 AGGGAAACTGAGGCCGGGCATGG - Intergenic
1096695248 12:53344780-53344802 CGGGACACTGAGGCACGGGATGG - Intronic
1098870897 12:75815827-75815849 AAGGAAACTGAGGCCCAGAAAGG + Intergenic
1098947925 12:76608906-76608928 GGGGAAGCTGAGGCCTGCGAAGG + Intergenic
1099816407 12:87654360-87654382 AGAGAAAATGAGGCCAGGGATGG + Intergenic
1101334582 12:103784975-103784997 GGGGAAACTGAGGCCCAGAATGG + Intronic
1101354569 12:103965433-103965455 AAGGAAACTGAGGCCCAAGATGG + Intronic
1101752272 12:107591658-107591680 GGGGAAACTGAGGCATGTCATGG + Intronic
1101870302 12:108560575-108560597 GAGGAAACTGAGGCTCGTGGAGG - Intronic
1101877200 12:108603646-108603668 GGGGAAACTGAGGCCCAAGGAGG - Intergenic
1101952201 12:109185859-109185881 GGGGAAACTGAGGCATGGGAAGG + Intronic
1102036351 12:109772453-109772475 GGGGAAACTGAGGCCCAAGGAGG - Intergenic
1102042625 12:109810414-109810436 GGGGAAACTGAGGCCAGGGCAGG + Intronic
1102548786 12:113675632-113675654 GGGGAAAATGAGGCCCGAGGAGG - Intergenic
1102551332 12:113694321-113694343 AGGGAAAATGAGGCTCTTAAGGG - Intergenic
1102593913 12:113978115-113978137 AGGGAAACTGAGGCCCAGAAAGG + Intergenic
1102617770 12:114169528-114169550 GGGGAAACTGAGGCCTGTCTAGG - Intergenic
1102651633 12:114446633-114446655 AGGGAAACTGAGGCCCAGACAGG - Intergenic
1102907461 12:116687867-116687889 AAGGGAACTGAGGCCAGGGAGGG + Intergenic
1103299549 12:119917717-119917739 AGGAAAACTGAGGCTCCTCAGGG - Intergenic
1103371460 12:120422708-120422730 GGGGAAACTGAGTCCAGAGAGGG - Intergenic
1103566766 12:121819989-121820011 CGGGAAACTGAGGCTGGGGACGG - Intronic
1103938917 12:124491388-124491410 AGGGAAACTGAGGCACGGGACGG + Intronic
1103944843 12:124520234-124520256 AGGGAAACTGAGGCACAGGAAGG + Intronic
1104754048 12:131258028-131258050 GGGGAAACTGAGGCCTGGAAAGG - Intergenic
1104929485 12:132330081-132330103 GGGGAAGCTGAGTCCCGGGACGG + Intergenic
1106036602 13:26050458-26050480 GGAGAAACTGAGGCCCGTGAGGG + Intronic
1106038022 13:26062991-26063013 AGGAAATCTTAGGCCCGTTATGG - Intergenic
1106134407 13:26963188-26963210 GGGGAAACTGAGGCCTAGGAAGG - Intergenic
1106638713 13:31559860-31559882 AGGGACACTGGGGCCTGTCAGGG - Intergenic
1107865445 13:44698848-44698870 TGGGAAACTGAGGCCCCGAAAGG + Intergenic
1108699699 13:52933346-52933368 AGGGAGACTGATGCAAGTGAGGG - Intergenic
1110195233 13:72781525-72781547 AGGGAAACTGAGGCCCAGGGAGG - Intronic
1113968999 13:114174201-114174223 GGCGAACCTGAGGCCCGTGCAGG - Intergenic
1115428603 14:33289941-33289963 GGGGAAACTGAAGCCTGAGATGG - Intronic
1118399620 14:65367586-65367608 GGGGAAACTGAGCCTCCTGAGGG - Intergenic
1118773858 14:68961445-68961467 ATGGAAACAGAGGCCCATGTGGG + Intronic
1118871452 14:69746505-69746527 AGAGAAACTGAGACACGTAAAGG - Intronic
1118975984 14:70677048-70677070 AAGGAAACTGAGGCCAGGGAGGG - Intergenic
1119418811 14:74493904-74493926 TGGGAAACTAAGGCCTGTGGGGG + Intronic
1119480208 14:74954136-74954158 AGGAAAACTGAGGCCAGAGAGGG - Intronic
1119678195 14:76572157-76572179 AGGGAAATTGAGGCCCAGGAAGG - Intergenic
1120281370 14:82442898-82442920 AGGGAAACTCAGGACGGTGTTGG - Intergenic
1120410213 14:84144850-84144872 AGGGACACTGGGGCCTGTCAGGG - Intergenic
1121454063 14:94027216-94027238 GGGGAAACTGAGGCCAGACAGGG + Intronic
1121518597 14:94570345-94570367 GGGGAAACTGAGGCCCAAGAGGG - Intronic
1121965474 14:98299765-98299787 GGGGAAACTGAGGCACAGGAAGG + Intergenic
1122031418 14:98915314-98915336 GGGGAAACTGAGGCTTGAGAGGG - Intergenic
1122135207 14:99628799-99628821 AGGGAAACTGAGGCCCGAGAGGG - Intergenic
1122136436 14:99635503-99635525 AGGGAAACTGAGGCCCAGGGAGG - Intergenic
1122151820 14:99729945-99729967 GGGGAAACTGAGGCCCAGGCAGG - Intergenic
1122208765 14:100161310-100161332 GAGGAAACTGAGGCCAGAGAGGG + Intergenic
1122288603 14:100667567-100667589 AGGGAGACTGAGGCTGGAGAGGG + Intergenic
1122301007 14:100731116-100731138 AGGGAAACTGAGGCCCAGAATGG + Intronic
1122517703 14:102320075-102320097 GGGGAAACTGAGGCCCGAAGGGG + Intronic
1122646127 14:103195416-103195438 CGGGAAACTGAGGCCACTGGCGG + Intergenic
1122806847 14:104264179-104264201 GGGGAAACTGAGGCCCAGGGTGG + Intergenic
1122810100 14:104283499-104283521 AGAGAAACTGCTGCCCGGGAGGG + Intergenic
1122861683 14:104585302-104585324 CGGGAAACTGAGGCCAGAGGGGG - Intronic
1122870121 14:104634639-104634661 AGGGAAACTGAGGCTCAGCAAGG + Intergenic
1122904625 14:104795970-104795992 GGGGAAACTGAGGCCAGAGAGGG - Intergenic
1123419938 15:20123378-20123400 AAAGAAACTGAGGCCCAGGAAGG - Intergenic
1123445923 15:20330154-20330176 AAAGAAACTGAGGCCCAGGAAGG + Intergenic
1123467434 15:20527286-20527308 AGGGAAACTGAGGTCAGAGTGGG - Intergenic
1123529159 15:21129914-21129936 AAAGAAACTGAGGCCCAGGAAGG - Intergenic
1123650680 15:22473756-22473778 AGGGAAACTGAGGTCAGAGTGGG + Intergenic
1123741089 15:23282598-23282620 AGGGAAACTGAGGTCAGAGTGGG + Intergenic
1123745909 15:23319960-23319982 AGGGAAACTGAGGTCAGAGTGGG - Intergenic
1124278181 15:28343277-28343299 AGGGAAACTGAGGTCAGAGTGGG - Intergenic
1124304520 15:28568331-28568353 AGGGAAACTGAGGTCAGAGTGGG + Intergenic
1124424259 15:29549953-29549975 AGGGAAACTGAGGTGAATGAAGG + Intronic
1124533409 15:30524803-30524825 AGGGAAACTGAGGTCAGAGTGGG + Intergenic
1124616762 15:31247871-31247893 AGGGAAACCGAGGCTCTGGAGGG - Intergenic
1124765248 15:32482842-32482864 AGGGAAACTGAGGTCAGAGTGGG - Intergenic
1125475668 15:40046617-40046639 GGGGAAACTGAGGCCAGGAAAGG + Intergenic
1125607824 15:40952354-40952376 AGGGAAACAGAGGCAGCTGAAGG - Intergenic
1127160379 15:56177310-56177332 AGGGAAAGGGAGGCAAGTGATGG - Intronic
1127549852 15:60026139-60026161 AGGGAAACTGAGGCACAGGGTGG + Intronic
1127919405 15:63481480-63481502 AGGGAAACTGAGGCCCAGAAGGG + Intergenic
1128113715 15:65092640-65092662 AGGGAAACTGAGGCCCAACAAGG + Intergenic
1128159724 15:65415627-65415649 GGGGAAACTGAGGCCTGGGGAGG + Intronic
1128161213 15:65423621-65423643 GGGGAAACTGAGGCTGGAGAAGG + Intergenic
1128543410 15:68552083-68552105 AGGGAAACTGAGGACCAAGGAGG + Intergenic
1128647411 15:69387729-69387751 ACAGACAGTGAGGCCCGTGATGG - Intronic
1128709460 15:69860893-69860915 AGATAAACTGAGGCCCATGAAGG + Intergenic
1128763965 15:70239693-70239715 GGGGAAACTGAGTCCAGAGAGGG - Intergenic
1129150927 15:73687321-73687343 GGGGAAACTGAGGCCCAGAAAGG + Intronic
1129155481 15:73714665-73714687 AGGGAAACTGAAGCCAAGGAGGG - Intergenic
1129323480 15:74787459-74787481 GGGGAAACTGAGGCCCAGAAAGG + Intronic
1129324853 15:74794478-74794500 AGGGACACTGAGGCCCAAGGAGG - Intronic
1129329726 15:74820853-74820875 AGGGAAACTGAGGCCTGAGGAGG + Intronic
1129359056 15:75012987-75013009 AGGGAAACTGAGGCCCAGTCGGG - Intronic
1129465691 15:75723083-75723105 AAGAAAACTGAGGCCCGGAAAGG - Intergenic
1129600741 15:76996726-76996748 GGGGAAACTGAGGCCCAGAAAGG - Intronic
1129604046 15:77016184-77016206 CAGGAAACTGAGGCCAGAGAAGG - Intronic
1129656347 15:77527775-77527797 AGGGAAACTGAGGGAGGAGAGGG + Intergenic
1129661095 15:77553602-77553624 AGGGCAACTGTGGGCTGTGAAGG - Intergenic
1129741432 15:77991483-77991505 ACAGAAACTGAGGCCCCTGGGGG + Intronic
1129823315 15:78619076-78619098 TGGGAAACTGAGGCCCAAGAGGG + Intronic
1129844231 15:78760924-78760946 ACAGAAACTGAGGCCCCTGGGGG - Intronic
1129852806 15:78804202-78804224 GGGGAAACTGAGGCCCAGTAAGG - Intronic
1129876996 15:78982103-78982125 GGGGACACTGAGGCCCATAAAGG - Intronic
1130250164 15:82294842-82294864 GGGGAAACTGAGGCCCAGTAAGG + Intergenic
1130945239 15:88546264-88546286 AGGGAAACTGAGACCCAGCAAGG - Intronic
1131028269 15:89163832-89163854 GAGGAAACTGAGGCCCGACAAGG + Intronic
1131147405 15:90023096-90023118 AGGGAAACTGAGGCTTATGAAGG + Intronic
1131238502 15:90717626-90717648 GGGGAAACAGAGGCCCGGGGCGG + Intronic
1131843865 15:96468325-96468347 ATGGGAAATGAGACCCGTGATGG + Intergenic
1131917645 15:97287777-97287799 CAGGAAACTGAGACCCATGAGGG + Intergenic
1131949508 15:97665852-97665874 AGGGAAACAGAGGAAGGTGATGG - Intergenic
1132594175 16:740709-740731 AAGGAAACTGAGGCCAGGGAGGG - Intronic
1132664142 16:1073982-1074004 AGGGAAACTGAGGCAGGTGTGGG - Intergenic
1133026019 16:2989310-2989332 AGGGAAACTGAGACCTGGAAAGG + Intergenic
1133139279 16:3732390-3732412 AGGGACTCTGAGGCCCCTGCGGG + Intronic
1133210748 16:4262171-4262193 GGGGAAACTGAGGCCGGGGCAGG + Intronic
1133349416 16:5091643-5091665 AGGGAAACTGAGGCTAAAGAAGG + Intronic
1133454877 16:5933344-5933366 AGGCAAACTGAGGGCAGTGGGGG + Intergenic
1133760765 16:8796802-8796824 AGGGAAACTAAGCCCAGAGAGGG + Intronic
1133967015 16:10538779-10538801 GAGGAAACTGAGGCCCACGAAGG - Intronic
1133996336 16:10751407-10751429 AGGGCACCTGAGGCCAGTGCTGG + Intronic
1134009232 16:10838948-10838970 GGGAAAACTGAGGCCTGTGGGGG + Intergenic
1134068491 16:11245848-11245870 AGGGAAACTGAGGCCAGGAGAGG - Intergenic
1134231561 16:12434179-12434201 AAGGAAACTGAGGCCCAGAAAGG - Intronic
1134664397 16:16008217-16008239 AGGGAAACTGAGGCTTGGGGAGG - Intronic
1135544813 16:23358447-23358469 AGGGAAACTGAGGCACAGCAAGG - Intronic
1136086911 16:27891761-27891783 AGAGAATCTGAGGCCAGTCACGG - Intronic
1136098130 16:27973711-27973733 AGGGAAACTGAGGCACCAAAAGG - Intronic
1136500448 16:30667452-30667474 AGGGAACCTCAGGCCCGAGGGGG - Intronic
1137599779 16:49748794-49748816 AGGGAAACTGAGGCCCCGAGGGG + Intronic
1137668556 16:50266147-50266169 AGGGAAATTGAGTCCCAGGAAGG + Intronic
1137673498 16:50292508-50292530 AGGGAAACTGAGGCCCAGACAGG - Intronic
1137832233 16:51554944-51554966 AGAGAAACTGAAGTCCGAGAGGG + Intergenic
1138436107 16:57000951-57000973 GGGGAAACTGAGGCCCTGGGAGG - Intronic
1138501125 16:57445649-57445671 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1138515188 16:57532074-57532096 GGGGAAACTGAGGCCCAGAAAGG - Intronic
1138519747 16:57564125-57564147 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1138545680 16:57718142-57718164 AGGGAAACTGAGGCCCCGAGGGG - Intronic
1138575583 16:57905364-57905386 AGTGAAACTGAGGCCCCCAAAGG + Intronic
1138589723 16:57993249-57993271 TGGGGAACTGAGGCCTGAGAGGG + Intergenic
1139334246 16:66220002-66220024 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1139337380 16:66242299-66242321 AAGAAATCTGAGTCCCGTGAGGG + Intergenic
1139824352 16:69745355-69745377 GGGGAAACTGAGGCAAGTTAAGG + Intronic
1140121770 16:72089852-72089874 AGGGAAACTGAGGCACAGGAAGG + Intronic
1140609267 16:76578609-76578631 AGGGAAACTAAGGCCAAAGAGGG + Intronic
1140665251 16:77221657-77221679 AGGGAAAGGAATGCCCGTGAAGG - Intergenic
1140893849 16:79308021-79308043 AGGGAAACTGAGGCACAGGCAGG - Intergenic
1141192741 16:81836223-81836245 GGGGAAACTGAGGCCCAGGGAGG + Intronic
1141369478 16:83473845-83473867 AGGGAAGCTGAGGCCCAGGGAGG - Intronic
1141597703 16:85107439-85107461 GGGGAAACCGAGGCCCATGGAGG + Intronic
1141909104 16:87046452-87046474 GGGGAAACTGAGGCCTGGGGAGG - Intergenic
1142124297 16:88402539-88402561 AGGGAAACTGAGGCCCCTGCAGG - Intergenic
1142140213 16:88469394-88469416 GGGGAAACTGAGGCCCAGGCCGG - Intronic
1142154235 16:88525983-88526005 GAGGAAACTGAGGCCTGGGAAGG - Intronic
1142292622 16:89199942-89199964 GGGGAAACTGAGGCATGAGAGGG + Intronic
1142478352 17:202957-202979 AGGGAATCTGAGGCCCGCACTGG + Intergenic
1142583461 17:955992-956014 AGGGAAACTGAGGCTCAGGGAGG - Intronic
1142803637 17:2360366-2360388 AGGGAAATTGAGGTCTGTCAAGG - Intronic
1142980410 17:3668174-3668196 GGGGACACGGAGGCCCGGGAAGG + Intronic
1142982897 17:3681616-3681638 AGAGAAACCGAGGCCCGGGGAGG + Intronic
1143002837 17:3805841-3805863 AGGGAAGCTGAGGCCCAGGGAGG + Intergenic
1143020453 17:3914809-3914831 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1143241214 17:5444723-5444745 AGGGAAACTACCGCCTGTGAAGG + Intronic
1143619127 17:8071268-8071290 GGGGAAACTGAGGCCAAGGAAGG - Intergenic
1143845952 17:9772732-9772754 AGGGAAGCTGGGGCCCCTGGGGG - Intronic
1144539120 17:16121928-16121950 GAGGAAACTGAGGCCCATGGGGG - Intronic
1144585247 17:16483642-16483664 GGGGAAACTGAGGCCAAAGAAGG + Intronic
1144643513 17:16952774-16952796 GGGGAAACTGAGGCTGGAGAGGG - Intronic
1144770712 17:17757931-17757953 AGGGAAACCGAGGCCCAGAAGGG - Intronic
1144782250 17:17814043-17814065 GGGGAAACTGAGGCCAGATAGGG + Intronic
1144833456 17:18144348-18144370 GGGGAAACTGAGGCTGGTGAGGG - Intronic
1144843780 17:18205227-18205249 GGGGAAACTGAGGCCCGAGGAGG + Intronic
1144848270 17:18231221-18231243 TGGGAAACTGAGGCTGGAGAGGG + Intronic
1144958239 17:19030419-19030441 GGGCAAACTGAGGCCAGAGAGGG - Intronic
1144976919 17:19144105-19144127 GGGCAAACTGAGGCCAGAGAGGG + Intronic
1145010145 17:19363291-19363313 GGGGAAACTGAGGCCCGCAGCGG + Intronic
1145205238 17:20981302-20981324 AGGGAAACTGAGGCTGGAGAGGG + Intergenic
1145242369 17:21247523-21247545 GGGGAAACCGAGGCCCAGGAGGG + Intronic
1145251255 17:21298119-21298141 GGGGAAACTGAGGCCCAGGGAGG + Intronic
1145773531 17:27510323-27510345 AGGGAAACTGAGGCTCATTGAGG - Intronic
1146350158 17:32085758-32085780 AGGGAAACTGAGGCTCAGGGTGG - Intergenic
1146462092 17:33054363-33054385 GGGGAAACTGAGGCCCAGGGAGG - Intronic
1146554920 17:33815144-33815166 ATGGGAACTGAGGCCTGAGATGG - Intronic
1146555024 17:33815825-33815847 GGGGAAACTGAGGCCCAGAAAGG + Intronic
1146638197 17:34521411-34521433 ACAGAAACTGAGGCTCGGGAGGG - Intergenic
1146649239 17:34596550-34596572 AGGGAAACTGAGGCAGGGAATGG + Intronic
1146925788 17:36743880-36743902 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1147164571 17:38586478-38586500 AGGGAAACTGAGGCTCAGGGAGG + Intronic
1147482822 17:40783115-40783137 GTGGAAACTGAGGCCCGAGGAGG - Intergenic
1147899612 17:43775390-43775412 AGGGAAACTGAGGCACAGAAAGG - Intronic
1148333258 17:46824791-46824813 AGGGGCACTGAGGACCCTGAGGG - Intronic
1148347022 17:46910146-46910168 AGGGAAACTGAGGCCCAGAAAGG - Intergenic
1148652319 17:49259193-49259215 GGGGAAACTGAGGCCCAGAATGG + Intergenic
1148686713 17:49505206-49505228 GGGGAAACTGAGGCCTGTAGGGG - Intronic
1148721031 17:49753382-49753404 AAGGAAACTGAGGCCCAGAAAGG - Intronic
1148888444 17:50790301-50790323 TGGGAGAGTGAGGCCTGTGAAGG + Intergenic
1150296134 17:64008557-64008579 GGGAAAACTGAGGCACGTCAAGG + Intronic
1150429329 17:65102565-65102587 AAGGAAACTGAGGCTGGTAAGGG + Intergenic
1151434546 17:74086860-74086882 AAGGAAACTGAGGCCCAGTAGGG + Intergenic
1151461945 17:74259714-74259736 AGGGAAACTGAGGCTAGAAAAGG + Intronic
1151542640 17:74772531-74772553 GGGGAAACTGAGGACCATGAAGG + Intronic
1151811421 17:76444794-76444816 AGGGATTCTGAGGGCCCTGAAGG - Intronic
1151874282 17:76857636-76857658 AGGGAAACTGAGGCTCGGAGCGG - Intergenic
1151994263 17:77598560-77598582 AGGGAAATTGAGGACCCTGCTGG + Intergenic
1152437471 17:80285244-80285266 GGGGAAACTGAGGCCCACGGTGG + Intronic
1152733727 17:81986638-81986660 GAGGAAACTGAGGCCCGGGGAGG - Intronic
1152823684 17:82450349-82450371 GAGGCAACTGAGGCCCGGGAGGG - Intronic
1152987293 18:332445-332467 AGGAAAACTGAGGCCCGGCAAGG - Intronic
1153362591 18:4214213-4214235 AGGGAAACTGAGGAACAGGAAGG + Intronic
1153521911 18:5961880-5961902 AGGGCAACTGGGGCAGGTGATGG + Intronic
1154341886 18:13510348-13510370 AGAGAAACTGAGGCCCCAGGAGG - Intronic
1156502704 18:37569675-37569697 AGGGAAGCTGAGCCCAGTGAGGG - Intergenic
1157409311 18:47450456-47450478 GGGGAAACTGAGGCCTCAGAAGG - Intergenic
1157621005 18:49017493-49017515 GAGGAAACTGAGGCCCAGGAGGG + Intergenic
1157712828 18:49861744-49861766 AAGGAGACTGAGGCCCGGGGGGG - Intronic
1157799745 18:50609442-50609464 GGGGAAACTGAGGCTCATGTAGG + Intronic
1158457013 18:57617280-57617302 AGGGAATCTGAGGCCGGGCATGG + Intronic
1158516494 18:58134794-58134816 AGGGAACCTGAGGCGAATGAAGG + Intronic
1159611187 18:70527300-70527322 AGGGAAACTGTGGCCGGGCACGG + Intergenic
1159897248 18:74008894-74008916 AGAGAAACTGTGGCCTGTGGGGG - Intergenic
1160022065 18:75188828-75188850 GGGGAAACTGAGGCCCGAGGAGG - Intergenic
1160231684 18:77053870-77053892 ATGGAAAGTGAGCCCCATGAAGG - Intronic
1160691232 19:461381-461403 GGGGAAACTGAGGCCCCGGGAGG + Intergenic
1160691266 19:461502-461524 GGGGAAACTGAGGCGCGGGGAGG + Intergenic
1160698182 19:494568-494590 AGGGAAACTGAGGCCCGGGGTGG - Intronic
1160699719 19:500056-500078 GGGGAGACTGAGGCCCGTGAGGG - Intronic
1160730282 19:638962-638984 GGGGAAACCGAGGCCTGAGAGGG - Intergenic
1160730672 19:640410-640432 TGGGAAACTGAGGCTCCAGAGGG + Intronic
1160735804 19:661928-661950 GGGGAAACTGAGGCGCGTGGTGG - Intronic
1160736029 19:662823-662845 CGGGAGACTGAGGCCCGGGCGGG - Intronic
1160747732 19:719805-719827 GGGGAAACTGAGGCCGGGCAGGG - Intronic
1160775873 19:855483-855505 GGGGAAACTGAGGCCCGGAGAGG + Intronic
1160793755 19:934508-934530 GGGGAAACTGAGGCCAGTGCAGG + Intronic
1160799368 19:960667-960689 GGGGAAACTGAGGCCCTGGTGGG - Intronic
1160807654 19:999704-999726 AGGGAAGTTGAGGCCCAGGAAGG - Intergenic
1160820343 19:1054908-1054930 GGGAAAACTGAGGCCAGAGAGGG - Intronic
1160865401 19:1253865-1253887 GGGGAAACTGAGGCCAGAGGGGG - Intronic
1160875528 19:1294747-1294769 GGGGAAACTGAGGCCAGGGTGGG + Intronic
1160879031 19:1311209-1311231 GGGGAAACTGAGGCCGGGGAAGG + Intergenic
1160880072 19:1315742-1315764 GGGGAAACTGAGGCACGGGAGGG - Intergenic
1160892087 19:1384301-1384323 TGGGAAACTGAGGCCCATTGAGG + Intronic
1160896123 19:1402665-1402687 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1160904807 19:1447067-1447089 GGGGAAACTGAGGCCCATAGCGG + Intronic
1160917435 19:1503936-1503958 CGGGAAACTGAGGCTGGAGAGGG + Intergenic
1160918589 19:1509381-1509403 GGGGAAACTGAGGCCCAGGGAGG - Intronic
1160919725 19:1513784-1513806 GGGGAAACTGAGGCCGGAGAGGG - Intergenic
1160952576 19:1674693-1674715 AGGGAAACTGAGGCCCAGGGAGG - Intergenic
1160965362 19:1744916-1744938 GGGGAAACTGAGGCTCCAGAAGG + Intergenic
1161025224 19:2033700-2033722 GGGGAAACTGAGGCCCAGGTTGG + Intronic
1161028549 19:2047675-2047697 GGGGAAACTGAGGCCCAGGGAGG - Intronic
1161118496 19:2512519-2512541 AGGTAAACTGAGGCTCGGGGAGG - Exonic
1161201037 19:3014882-3014904 GGGTAAACTGAGGCCTGAGAGGG - Intronic
1161248772 19:3269592-3269614 GGGGAAACTGAGGCCCCTTGGGG - Intronic
1161271639 19:3392849-3392871 GGGGAAACTGAGGCCCGGAGAGG + Intronic
1161283719 19:3458521-3458543 AGGGAAACTGAGGCAGGCAAGGG + Intronic
1161312928 19:3604660-3604682 GGGGAAACTGAGGCTCGGCAAGG - Intronic
1161315397 19:3615073-3615095 AGGGAAACTAAGGCCCAGAAAGG - Intronic
1161325640 19:3662473-3662495 AGGGAAACTGAGGCACATAGCGG - Intronic
1161333647 19:3699858-3699880 AGGTAAACTGAGGCCCAGGAAGG + Intronic
1161346864 19:3772449-3772471 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1161398283 19:4056268-4056290 AGGGAAACTGAGGCTGATGGGGG - Intronic
1161442907 19:4302530-4302552 GGGGAAACTGAGGCACGAGGTGG - Intergenic
1161492607 19:4570490-4570512 AGGGAAACTGAGGCCCAGCCAGG - Intergenic
1161620538 19:5294692-5294714 AGGGAAACTGAGGCATGGTAAGG - Intronic
1161627305 19:5334795-5334817 AGGGAAACTGAGGCACAGGGAGG - Intronic
1161651653 19:5489511-5489533 GGGGAAACTGAGGCCCCCAAAGG + Intergenic
1161662504 19:5555628-5555650 AGGGAAACTGAGGCCCAGCGAGG + Intergenic
1161665326 19:5572645-5572667 AGGGAAACTGAGGCCCGGAGAGG + Intergenic
1161681106 19:5680296-5680318 AGGGAAACTGAGGCTTCAGAGGG - Intronic
1161681356 19:5681250-5681272 GGGGAAACTGAGGCCTGAGCGGG + Exonic
1161702564 19:5803577-5803599 GGGGAAACTGAGGCACGGGGGGG + Intergenic
1161922494 19:7277019-7277041 AAGGAAACTGAGGCCAGGCACGG - Intronic
1161965143 19:7543586-7543608 GGGGAAACTGAGGCCCATCAAGG + Intronic
1162016860 19:7850884-7850906 GGGGAAACTGAGGCCGGAGAAGG - Intronic
1162046953 19:8006066-8006088 AAGGAAACTGAGGCCCGGCAAGG - Intronic
1162424598 19:10586991-10587013 AGAGAAACTGAGGCCCTAGGAGG + Intronic
1162446791 19:10728300-10728322 AGAGAAACTGAGGCCAGAGAGGG + Intronic
1162531526 19:11238810-11238832 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1162535907 19:11262618-11262640 GGGGAAACTGAGGCTGGGGACGG + Intergenic
1162857586 19:13481187-13481209 GAGGAAACTGAGGCACGGGAAGG + Intronic
1162871313 19:13588993-13589015 AGGGAAACTGAGGCACCGAAAGG + Intronic
1162894247 19:13755591-13755613 AGGGAAACAGAGGCTCGGGAAGG + Intronic
1163002447 19:14376477-14376499 CGGGAAACTGAGGCCCGGAAAGG + Intergenic
1163065157 19:14786893-14786915 GGGGAAACTGAGGCTCAGGAAGG + Intergenic
1163115025 19:15184147-15184169 ATGGAAACTGAGGCCCGAGGAGG - Intronic
1163287383 19:16357229-16357251 GGGGACACTGAGGCCAGGGAAGG + Intronic
1163429002 19:17255657-17255679 AGGGAAACTGAGGCCCCAAGAGG + Intronic
1163437479 19:17303838-17303860 GGGGAAACTGAGGCTCATAAAGG + Intronic
1163500375 19:17672658-17672680 GGGGAAACTGAGGCCAGTGGGGG + Intronic
1163548188 19:17951433-17951455 AGGGAAACTGAGGCTCAGAAAGG + Intronic
1163557320 19:18000127-18000149 GGGGAAACTAAGGCCTGAGAAGG + Intergenic
1163596708 19:18224987-18225009 AGGGAAACTGAGGCCAGGAGCGG + Intronic
1163629835 19:18412669-18412691 GGGGAAACTGAGGCTCATCACGG - Intergenic
1163630160 19:18414295-18414317 GGGGAAACTGAGGCTCGTAAAGG - Intergenic
1163664220 19:18595421-18595443 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1164051033 19:21586205-21586227 AGGGAAACTGAGGCCCAAAGAGG - Intergenic
1164534415 19:29074621-29074643 AGGAAAACTGAGGCTCGGGAAGG + Intergenic
1164675277 19:30096505-30096527 AGGGAAACTGAGGTCCAGGGAGG + Intergenic
1164770882 19:30808039-30808061 AGGAAAAGTGAGGCCAATGATGG - Intergenic
1165317218 19:35063853-35063875 AGGGAAACTGAGGCACGGTGAGG - Intronic
1165324716 19:35107784-35107806 GGGGAAACTGAGGCCCGGGAAGG + Intergenic
1165486852 19:36101574-36101596 GGGGAAACTGAGCCCAGGGAAGG + Intronic
1165750500 19:38256470-38256492 GGGGAAACTGAGGCCTGAGGCGG - Exonic
1165931304 19:39361037-39361059 GGGGATCCTGAGGCCCGAGAGGG - Intronic
1165946473 19:39445813-39445835 GGGGAAACTGAGGCTCGGGGTGG + Exonic
1166084905 19:40467827-40467849 AGGGAAACTGAGGCACAGAAAGG + Intronic
1166293120 19:41876042-41876064 GGGGAAACCGAGGCCAGAGAGGG - Intergenic
1166354633 19:42219637-42219659 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1166502089 19:43349212-43349234 AGGAAAACTGAGCCCTGGGAAGG - Intergenic
1166508023 19:43384240-43384262 AGGAAAACTGAGCCCTGGGAAGG + Intergenic
1166752421 19:45170664-45170686 GGGGAAACTGAGGCACGGGATGG - Intronic
1166802516 19:45467378-45467400 GGGGAAACTGAGTCCCGAGCGGG - Intronic
1166811388 19:45516485-45516507 AGGGAAACTGAGGTCAGGCAGGG + Intronic
1167040654 19:47020931-47020953 AGGGAAACTGAGATCCGTGCAGG - Intronic
1167086123 19:47310825-47310847 GGGGAAACTGAGGCCCAGGCAGG + Intronic
1167269985 19:48501183-48501205 GGGGAAAATGAGGCCCGGGTGGG - Intronic
1167449273 19:49557319-49557341 AGGTAAACTGAGGCCCACAAAGG + Intronic
1167467165 19:49656422-49656444 AGGTAAACTGAGTCCTGGGAAGG - Intronic
1167508601 19:49884011-49884033 GGGGAAACTGAGGCCCAGGGAGG - Intronic
1167585726 19:50374332-50374354 AAGGAAACTGAGGCACGGGGAGG + Intronic
1168181500 19:54665290-54665312 GGAGAAACTGAGGCCCATGCAGG - Intronic
1168243396 19:55098261-55098283 AAGGAAACTGAGGCCCGGAAAGG + Intronic
1168327198 19:55544511-55544533 GGGGAAACTGAGGCCCGGAGAGG - Intronic
1168435778 19:56315663-56315685 AGGGAAACTGAGGCCCAGAGAGG - Intronic
925041703 2:736031-736053 AGGGGAAGTGAGGCCCCTGGAGG - Intergenic
925858887 2:8156235-8156257 GGGGAAACTGAGGCACGGGAAGG - Intergenic
925893101 2:8451949-8451971 GGGGAAACTGAGGCCCGGAGAGG + Intergenic
926092167 2:10058171-10058193 AGGGAAACTGAGGCCCAGAGAGG + Exonic
926269879 2:11357381-11357403 GGGGAAACTGAGGCCCAAGAAGG - Intergenic
926291819 2:11537464-11537486 GGGGAAACTGAGGCACATAAAGG + Intronic
926906488 2:17810617-17810639 AAGGAAACTGAGGTCCGCAAAGG + Intergenic
927216347 2:20669767-20669789 AGGGGAACTGAGGCCCAGGTAGG - Intronic
927588069 2:24328076-24328098 AGGAAAACTCAGGACCATGATGG - Exonic
927855062 2:26522782-26522804 AGGGAAACTGAGGCCCAGAGAGG - Intronic
927872737 2:26633884-26633906 AGGGAAACTGAGGCCCGAGAGGG - Intronic
927890212 2:26743429-26743451 AGGGAAACTGAGGCCTGATAAGG + Intergenic
927954525 2:27199333-27199355 AGGGAAAGTGGGGCCGGAGAAGG + Intergenic
928436511 2:31257956-31257978 AGGGAAACTGAGGCTCAGGAAGG - Intronic
929590850 2:43145267-43145289 AAGGAAACTGAGGCCCAGGCAGG + Intergenic
930779114 2:55205534-55205556 AGGGATACTGAGGGGCATGAGGG + Intronic
931148408 2:59545316-59545338 AAGGAAACTGAGGCACGGAAAGG - Intergenic
931611531 2:64106664-64106686 AAGGAAACTAAGGCCCAGGATGG + Intronic
931668154 2:64624844-64624866 AGGGAAACTAAGGCCCTGAAAGG - Intergenic
932340864 2:70961834-70961856 AGGGAAACTGAGGCCTGGGAAGG + Intronic
932446723 2:71786145-71786167 GGGGAAACTGAGGCTCAGGAGGG + Intergenic
932734227 2:74243134-74243156 AGGGACACTGAGGCCAGGGTAGG - Intronic
934768109 2:96891929-96891951 GGGGAAACTGAGGCCAGAGTAGG - Intronic
935155360 2:100479585-100479607 GAGGAAACTGAGGCCCGGGGAGG - Intronic
935666845 2:105519580-105519602 AGGGAACCTGCGGTCTGTGAAGG - Intergenic
936024243 2:109019171-109019193 GGGGAAACTGAGGCACGGGTCGG - Intergenic
936025373 2:109027569-109027591 AGGGGAGCTGAGGCCCAGGAGGG - Intergenic
936029629 2:109060726-109060748 TGGGAAACTGAGGCCCAGGGTGG - Intergenic
936071790 2:109375967-109375989 GGGGAAACTGAGGCTCAGGAAGG - Intronic
937305270 2:120867080-120867102 GGGGAAATTGAGGCCCGGGAAGG - Intronic
938073706 2:128321044-128321066 GGGGAAACTGAGGCCCAGGCAGG + Intergenic
938172110 2:129088473-129088495 AGGGAAAGTGGGGCCTGTGGAGG - Intergenic
938344523 2:130557583-130557605 AGGTAAACTGAGGCTGCTGATGG - Intergenic
938345310 2:130563139-130563161 AGGTAAACTGAGGCTGCTGATGG + Intergenic
938577486 2:132618587-132618609 AGGGAAACCGAGGCCACTGCTGG + Intronic
940086941 2:149870906-149870928 AAGGAAACTGAGGCTCAGGAAGG + Intergenic
940326927 2:152435189-152435211 AGGGAAAATGAGGCCAGGCATGG + Intronic
940909335 2:159196402-159196424 AGGGAACCTGAGGCCTGGAATGG + Intronic
941591840 2:167429729-167429751 AGGGAAACTGAGGCCCTTGGGGG - Intergenic
942082083 2:172409860-172409882 AAGGAAACTGAGACCCATAAAGG - Intergenic
942321226 2:174737733-174737755 AGAGAAACTTAGACCTGTGAAGG + Intergenic
942432035 2:175921981-175922003 AGGGAAACTGAGCACATTGAGGG - Intergenic
943931032 2:193853704-193853726 TGGGAATCTGAGGCCTGTGGTGG + Intergenic
944078720 2:195760339-195760361 AGGGAAACTGACTGCTGTGAAGG + Intronic
946042123 2:216791630-216791652 AGGGAAACTGAGGCCTAGAAAGG + Intergenic
946190689 2:218006288-218006310 AAGGAAACTGAGGCCCAGGGAGG - Intergenic
946596646 2:221312665-221312687 AGGGAAACTGAGGCAAGAAAAGG - Intergenic
947077262 2:226358683-226358705 AGGGAAACTGAGCCCCAAAATGG - Intergenic
947391429 2:229643299-229643321 TGGGAAACTGAGGCCCATAAAGG - Intronic
947745756 2:232506552-232506574 TGGGAATCTGAAGCCCCTGATGG - Intergenic
947980378 2:234403632-234403654 AGGGAAACTGAGGCATGGAAGGG - Intergenic
948160935 2:235823532-235823554 AGGGAAACTGAGTCCCAGGAAGG + Intronic
948209029 2:236178781-236178803 AGGGAAACTTGGGCCGGGGAGGG + Intergenic
948704044 2:239778427-239778449 CAGGAATCTGAGGCCCGGGAGGG - Intronic
948825560 2:240572056-240572078 AGGGAAACTGAGGCACAGTAGGG - Intronic
948887991 2:240893364-240893386 ATGGGAACTGAGGCCCCTGTGGG - Intronic
948894098 2:240920299-240920321 AGGGAAACTGAGGCAACAGATGG + Intronic
948900806 2:240956081-240956103 GGGGAAACTGAGGCTCAGGAAGG - Intronic
949039728 2:241842658-241842680 GGGGAAACTGAGGCCCAGGGAGG - Intergenic
1168767504 20:391638-391660 AGAGAAACCGAGGCCCAGGAAGG + Intronic
1168790250 20:571686-571708 GGGGAAACTGAGGCCCAGGCTGG + Intergenic
1168837095 20:884702-884724 AGGAAAACTGAGGCCCAGGGAGG + Intronic
1168847883 20:957997-958019 GGGAAAACTGAGGCCCCGGAAGG + Intergenic
1168861119 20:1046650-1046672 TGGGAAACTGAGGCCCATACAGG + Intergenic
1170028268 20:11914973-11914995 AGGAAAACTGAGGCCCTTAAAGG + Intronic
1170681837 20:18532936-18532958 AAGGAAACTGAGGCCCAGAAAGG + Intronic
1171200317 20:23235470-23235492 AGGGAGACTGACGCCCTTGTGGG - Intergenic
1171390221 20:24796575-24796597 AGGGAAGCTGAGGGCAGTGGGGG + Intergenic
1171977684 20:31605855-31605877 GGGGAAACGGAGGCCAGAGAGGG + Intronic
1172053019 20:32133731-32133753 GGGGAAACCGAGGCCTGGGAAGG + Intronic
1172094049 20:32452128-32452150 AGGGAAGCAGAGGCCAGTGATGG - Intronic
1172109277 20:32536035-32536057 GGGGAAACTGAGGCCCAGGCAGG - Intronic
1172120483 20:32595821-32595843 GGGGAAACTGAGGCCCAGAAAGG + Intronic
1172121760 20:32602914-32602936 AAGGAAACTGAGGCTCATGGAGG + Intronic
1172201055 20:33126218-33126240 AGGGGAATTGAGGCCAGAGAGGG + Intergenic
1172277600 20:33688403-33688425 AGGAAAACTGAGGCCCTTTCAGG + Intergenic
1172569242 20:35956053-35956075 GGGGAAACTGAGGCCCTCAAAGG + Intronic
1172589818 20:36109735-36109757 GAGGAAGCTGAGGCCTGTGAAGG + Intronic
1172603507 20:36199637-36199659 AGGCAAACAGAGGCCCTTCATGG - Intronic
1172608608 20:36232384-36232406 CGGGAAACTGAGGCCCAAGAGGG - Exonic
1172624852 20:36341068-36341090 AGGGAAACTGAGGCCAGAGAGGG + Intronic
1172625192 20:36342716-36342738 GGGGAAACTGAGGCCCATGGAGG + Intronic
1172773182 20:37393206-37393228 GGGGAAACTGAGGCCAGAGGGGG - Intronic
1172837571 20:37882932-37882954 GGGCAAACTGAGGCCCCAGAAGG + Intergenic
1172859259 20:38034252-38034274 AAGGAAACTGAGGCCCGGGAAGG + Intronic
1172889186 20:38252086-38252108 GGGGAAACTGAGGCACATCAGGG - Intronic
1173758283 20:45537723-45537745 AGGGAAACTGAGGCCCAGAAAGG + Intronic
1173853535 20:46234134-46234156 ATGGAAACTGAGGCTCAAGAGGG - Intronic
1173874893 20:46364222-46364244 GGCGAAACTGAGGCCCGGGGAGG + Intronic
1174076416 20:47940639-47940661 AGGAAAACTGAGGCCTGGAATGG + Intergenic
1174164762 20:48576789-48576811 GGGGAGACTGAGGCCCAGGAAGG - Intergenic
1174166434 20:48586828-48586850 AGGAAAACTTGGGCCCGTCACGG - Intergenic
1174328850 20:49801754-49801776 AGGGAAACTGAGGCACAAGGGGG + Intergenic
1174349774 20:49958608-49958630 AGGGTAACTGAAGCCACTGAAGG - Intergenic
1174365407 20:50053475-50053497 AGGGAAACTGAGGCCCGGAAGGG + Intergenic
1174385534 20:50186697-50186719 GGGGAAACTGAGGCCCGAAGAGG - Intergenic
1174595585 20:51680819-51680841 GGGGAAACTGAGGCCAATTAAGG + Intronic
1174772135 20:53310280-53310302 AGGGAAACTGAGGCCCACAGAGG - Intronic
1175067679 20:56303784-56303806 AGGAAAACTGAGGCCAGGTATGG + Intergenic
1175074184 20:56359384-56359406 AGAGAAACTGAGGCTCGGGAAGG + Intronic
1175160216 20:57002736-57002758 AGGGAAACTGAGGCTCACGCTGG - Intergenic
1175240500 20:57544588-57544610 AAGGAAACTGAGGCCCTAGGAGG - Intergenic
1175726038 20:61319254-61319276 GGGGAAACTGAGGCTCAGGAAGG + Intronic
1175726457 20:61321994-61322016 GGGGAAACTGAGGCTCAGGAAGG + Intronic
1175916394 20:62427987-62428009 AGGGAAACCGAGGCCAGAAAGGG - Intergenic
1175924878 20:62466739-62466761 GGGGAAACTGAGGCCCAGGAAGG - Intronic
1175934021 20:62506853-62506875 GGGGAAACTGAGGCCTGGGGAGG - Intergenic
1175985362 20:62761727-62761749 GGGGAAACTGAGTCCAGAGAAGG - Exonic
1175993030 20:62798860-62798882 ACGGAAGCTGAGGCCTGTGTGGG + Intronic
1176195380 20:63834489-63834511 AGGGACCCTGAGGCCTATGAGGG + Intergenic
1176221257 20:63970165-63970187 GGGTAAACTGAGGCCCGATAGGG + Intronic
1176302457 21:5105041-5105063 AGGGAAACTGAGGCACGAAATGG - Intergenic
1177782102 21:25632686-25632708 AAGGAAAATGAGGCCCATAATGG - Intergenic
1178582528 21:33848566-33848588 AGGGAAACTGAGGCACAGGGCGG - Intronic
1178843316 21:36155918-36155940 CGGAAACCTGAGGCCCGTGCGGG + Intergenic
1179510627 21:41870913-41870935 AAGGAAACTGAGGCCCTTGGAGG - Intronic
1179586547 21:42377044-42377066 AGGGAAACTGAGGCTCAGGAGGG + Intronic
1179624628 21:42641876-42641898 AAGAAAACTGAGGCACGGGAAGG + Intergenic
1179632628 21:42688252-42688274 GGGGAAACTGAGGCCCAGGAGGG + Intronic
1179854570 21:44156882-44156904 AGGGAAACTGAGGCACGAAATGG + Intergenic
1179988098 21:44932296-44932318 GGGGAAACTGAGGCTCAGGAAGG + Intergenic
1180842393 22:18965410-18965432 GGGGAAACTGAGCCCCGGGGAGG - Intergenic
1180876913 22:19178855-19178877 CGGGAAACTGAGGCCTGGGCGGG + Intergenic
1181000016 22:19983636-19983658 GGGGAAACTGAGGCCTGGCAGGG + Intronic
1181763802 22:25076919-25076941 AGGGAAACTGAGGCCTTGAAAGG + Intronic
1181790935 22:25265813-25265835 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1181811451 22:25405689-25405711 GGGGAAACTGAGGCACGGGGCGG + Intergenic
1181826742 22:25522852-25522874 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1181910868 22:26237131-26237153 AGGGAAACTGAGGCTCAGGGAGG - Intronic
1181922047 22:26328157-26328179 GGGGAAACTGAGACCCGGGTTGG + Intronic
1182062187 22:27406198-27406220 GGGGAAACTGAGGCCCAGAAAGG + Intergenic
1182066527 22:27435254-27435276 AGGGAGACTGAGGCCGGGGTAGG + Intergenic
1182114998 22:27751311-27751333 GGGGAAACTGAGGCCCAACAGGG - Intronic
1182285742 22:29245806-29245828 AGGGAAACTGAGGCCCGACTCGG + Intronic
1182353753 22:29712972-29712994 GAGGAAACTGAGGCCCAGGAGGG - Intergenic
1182418615 22:30237676-30237698 AAGGAAACTGAGGCCCAGGGAGG - Intergenic
1182421101 22:30248972-30248994 GGGGAAACTGAGGCACTGGAGGG - Intergenic
1182424418 22:30264583-30264605 CCGGAAACTGAGGCCCGAGAGGG + Intronic
1182534811 22:30992969-30992991 AAGGAAACTGAGGCCAGAGAGGG + Intergenic
1183173328 22:36204071-36204093 GGGGAAACTGAGGCCCTGGGAGG - Intronic
1183178069 22:36238881-36238903 GGGGAAACTGAGGCCCTGGGAGG - Intronic
1183281622 22:36935537-36935559 GGGGAAACTGAGGCCCAGGAAGG - Intronic
1183307257 22:37089360-37089382 GGGGAAACTGAGGCTCGCGGAGG + Intronic
1183314990 22:37132126-37132148 GGGGAAACTGAGGCCCAGGGAGG + Intronic
1183365044 22:37402547-37402569 AAGGAAACCGAGGCTCATGAGGG + Intronic
1183479682 22:38056734-38056756 GGGGAAACTGAGGCACATAAAGG + Intronic
1183483354 22:38076625-38076647 AGGGAAATTGAGGCCCAGGGAGG - Intergenic
1183598012 22:38823720-38823742 AAGGAAACTGAGGCCCAGGGAGG - Intronic
1183601038 22:38840783-38840805 AGGGAAAGTGAGGGCCAAGACGG + Intronic
1183648634 22:39141124-39141146 AGAGAGACTGAGGCCCGGGTGGG + Intronic
1183650749 22:39152216-39152238 AGGGAAACTGAGGCACGGGCTGG + Intronic
1183706504 22:39477921-39477943 GGGGAAACTGAGGCACGGGGAGG + Intronic
1183724189 22:39579286-39579308 GGGGAGACTGAGGCCCGGGAAGG + Intronic
1183981573 22:41543716-41543738 ATGGAAACTGAGGCCCAGAAGGG + Intronic
1184058854 22:42069971-42069993 AAGGAAACTGAGGCCCGAGGGGG - Intronic
1184059615 22:42074133-42074155 CGGGAAACTGAGGCCCGAGAGGG - Intergenic
1184066709 22:42125604-42125626 AGGGAAACAGAAGCCCGGGGTGG + Intergenic
1184069177 22:42137756-42137778 AGGGAAACAGAAGCCCGGGGTGG + Intergenic
1184162206 22:42703670-42703692 AGGGAATCTGAGGCCCAAAAAGG - Intronic
1184224454 22:43121231-43121253 GGGGAAACTGAGGCTGGTGCAGG + Intronic
1184245040 22:43231554-43231576 TGGGACACTGAGGCTCGAGAGGG - Intronic
1184279718 22:43430051-43430073 GGGGAAACTGAGGCCTGGGGAGG - Intronic
1184284915 22:43465102-43465124 GGGGAAACTGAGGCACGAGGAGG + Intronic
1184383841 22:44163142-44163164 AGGGAAACTGAGGCCCAGAAAGG - Intronic
1184493527 22:44824203-44824225 TGGGAAACTGAGGCTTGTCAAGG - Intronic
1184512146 22:44940059-44940081 GGGGAAACTGAGGCCCAGGGTGG - Intronic
1184521708 22:44998473-44998495 AGGGAAACTGAGGCCCCGGTCGG - Intronic
1184593103 22:45498918-45498940 AGGGAAACTGAGGCCCAGAAAGG + Intergenic
1184606850 22:45579288-45579310 GGGGAAACTGAGGCCCGGAAGGG + Intronic
1184692197 22:46122509-46122531 GGGGAAACTGAGGCCAGGGAGGG - Intergenic
1184715432 22:46279276-46279298 GTGGAAACTGAGGCCCATGGAGG + Intronic
1184729470 22:46364869-46364891 GGGGAAACTGAGGCCCAGGAGGG + Intronic
1185005259 22:48272293-48272315 AAGGAAAATGAGGCCCTTGCAGG + Intergenic
1185021353 22:48378362-48378384 AAGGAAACTGAAGCACGAGATGG - Intergenic
1185025252 22:48405202-48405224 AGGGAAGTTGAGGCCTGAGAGGG - Intergenic
1185105481 22:48867187-48867209 GGGGAAACTGAGGCCTGCAACGG + Intergenic
1185165846 22:49261708-49261730 GGGGAAGCTGAAGCCCGTGGGGG - Intergenic
1185186118 22:49401458-49401480 GGGGAAACTGAGGCCCACCATGG + Intergenic
949805762 3:7953717-7953739 AGAGAAACTGAGGCCTAAGATGG - Intergenic
949871072 3:8589643-8589665 AGGGAAACTGAGGCTGGGGAAGG - Intergenic
949998902 3:9641368-9641390 AGACAAACTGAGACCCCTGAGGG + Intergenic
950026888 3:9826243-9826265 TGGGAAACGGAGGCACGTGTAGG + Intronic
950072589 3:10164742-10164764 GGGGAAACTGAGGCCCTGGTGGG - Intergenic
950101464 3:10359421-10359443 GGGGAAACTGAGGCCAGAGAGGG + Intronic
950184906 3:10939001-10939023 GGGGAAACTGAGGCCCAGGGAGG - Exonic
950272035 3:11624577-11624599 GGGGAAACTGAGGCATGGGAGGG - Intronic
950361623 3:12453397-12453419 GAGGAAACTGAGGCCAGAGAGGG + Intergenic
950399371 3:12758869-12758891 AGGGAAACTGAGGCTCAGAAAGG + Intronic
950404811 3:12797601-12797623 GGGGAAACTGAGGCCCAGGGAGG + Intronic
950548799 3:13654429-13654451 GGGGAAACTGAGGCCCAGAAGGG - Intergenic
950550925 3:13665521-13665543 AGGGAAACTGAGGCTCAAGGAGG + Intergenic
950552844 3:13677083-13677105 GGGGAAACTGAGGCCCAGGTAGG + Intergenic
950568477 3:13785873-13785895 AGGGAAGCTGAGGCCCAGGGAGG + Intergenic
950667861 3:14508156-14508178 GGGAAAACTGAGGCCCAGGAAGG - Intronic
950668996 3:14513981-14514003 AGGGAAACTGAGGTCCAGCAAGG - Intronic
950716477 3:14851057-14851079 GGGGAAACTAAGGCCCTTGGAGG + Intronic
953024455 3:39136846-39136868 AGGGAAACTGAGGCCCAGACAGG - Intronic
953387036 3:42512606-42512628 AGAGAAACTGAGGCCCAGGGAGG + Intronic
953469692 3:43156057-43156079 AAAGAAACTGAGGCCCAGGAAGG + Intergenic
954433476 3:50483702-50483724 AGGGAAACTGAGACCCGCAGAGG - Intronic
954435765 3:50495138-50495160 ACGGAAACTGAGGCCCAAGATGG - Intronic
954632358 3:52054568-52054590 AAGGAAACTGAGGCCCCAGAAGG + Intronic
954634180 3:52062678-52062700 AGGAAAGCTGAGGCCCAGGAAGG + Intergenic
954802339 3:53194470-53194492 GAGGAAACTGAGGCCCATGAAGG - Intergenic
955410074 3:58649826-58649848 AAGGAAACTGAGGCCCAGGGAGG - Intronic
956458678 3:69449991-69450013 AGGGAAACTGAGGCTGAGGAAGG - Intronic
956894933 3:73649890-73649912 GAGGAAACTGAGGCCCTAGACGG + Intergenic
956928986 3:74021158-74021180 AAGGAAACTGAGGCTCGGAAAGG - Intergenic
957053728 3:75428985-75429007 AGGGAAACTGAGGCTAAAGAAGG + Intergenic
957305074 3:78447295-78447317 AGGCGAACTGAGACCCCTGAAGG + Intergenic
959566263 3:107835511-107835533 AGGGAACTTGAGGCAGGTGAAGG + Intergenic
961014287 3:123455504-123455526 AGGGTAACTGAGGCACGAGGGGG - Intergenic
961301121 3:125922694-125922716 AGGGAAACTGAGGCTAAAGAAGG - Intergenic
961364183 3:126389139-126389161 AGGGACACTGGGGCCTGTGGAGG + Intergenic
961469394 3:127101753-127101775 GGGGAAACTGAGGGCCGGGAAGG + Intergenic
961556396 3:127699090-127699112 GGGGAAACTGAGGCCCAGGAAGG - Intronic
961650806 3:128415863-128415885 GGGGAAACTGAGGCAGGGGAGGG + Intergenic
961654715 3:128434990-128435012 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
961825548 3:129597331-129597353 GGGGAAACTGAGGCCCATCAAGG + Intronic
961887404 3:130105379-130105401 AGGGAAACTGAGGCTAAAGAAGG + Intronic
962405228 3:135094603-135094625 GGGGAAACTGAGGCTGGAGAAGG - Intronic
962441482 3:135422427-135422449 AGGCACACTGAGGCCTGTTATGG - Intergenic
963056663 3:141191703-141191725 AGGGAAACTGAGGCCCAGAAAGG - Intergenic
963302692 3:143616692-143616714 AGGGAAAGTGAGGTCTGTGCTGG - Intronic
964341035 3:155708436-155708458 AAGGAAACTGAGGCCCAGAAAGG + Intronic
964663930 3:159151569-159151591 AAGGAAACTGAGACCAGTGCAGG - Intronic
964704989 3:159608741-159608763 GGGGAAACTGAGGCCCAGAAAGG - Intronic
965661732 3:171049333-171049355 GAGGAAACTCAGGCCTGTGATGG + Intergenic
965757840 3:172042445-172042467 TTGGAAAATGAGGCCCGGGAAGG + Intronic
965818345 3:172659725-172659747 AGGGAAACTAAGGCCCAGAAAGG + Intronic
966739785 3:183221921-183221943 AGGAAAACTAAGGCCCAAGAGGG + Intronic
966913512 3:184572295-184572317 GGGGAAACTGAGGCACATGGCGG + Intronic
967305672 3:188056760-188056782 AAGGAAACTGAGGCCAGACAGGG - Intergenic
967348685 3:188488043-188488065 GGGGAAACTGAGACCCAAGAAGG + Intronic
967370994 3:188745879-188745901 GAGGGAACTGAGGCCCGTGGTGG + Intronic
967414425 3:189200778-189200800 AAGGAAACTGAGGCCCAGAATGG - Intronic
967877436 3:194276834-194276856 TGGGAAACTGAGGCCTGGCAAGG - Intergenic
967931865 3:194695752-194695774 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
968521363 4:1036115-1036137 AGGGAAAGGGAGGGCCGGGAGGG - Intergenic
968609596 4:1551032-1551054 AGGGAAACTGAGGCTGGGGTAGG + Intergenic
968661681 4:1801258-1801280 CGGGAAACTGAGGCTGGGGATGG + Intronic
968815111 4:2818067-2818089 GGGGAAACTGAGGCCCGCAGGGG + Intronic
968872691 4:3249747-3249769 GGGGAAACTGAGGCCCAGCAAGG + Intronic
968873817 4:3254884-3254906 GGGGAAACTGAGGTCCCAGAAGG - Intronic
968996528 4:3949301-3949323 AGGGAAACTGAGGCTAAAGAAGG + Intergenic
969184491 4:5465308-5465330 ATGGAAACTGAGGCCCATAGAGG + Intronic
969227740 4:5810161-5810183 GAGGAAACTGAGGCCTGGGAAGG - Intronic
969238796 4:5886710-5886732 AAGGGAACTGAGGCAGGTGATGG - Intronic
969295783 4:6270095-6270117 GGGGAAACTGAGGCCCGAAGAGG - Intronic
969463088 4:7339106-7339128 ATGTGAACTGTGGCCCGTGAGGG + Intronic
969528062 4:7714102-7714124 GGGGAAACTGAGGCCCATAATGG - Intronic
969533343 4:7741287-7741309 GGGGAAACTGAGGCCCAGGGAGG + Exonic
969662985 4:8541133-8541155 AGGGAAGCTGAGGCACGGGGTGG + Intergenic
969671460 4:8592551-8592573 GGGGAAACTGAGGCCCAAGGAGG + Intronic
969711711 4:8848518-8848540 AGGAAACCTGAGGCCAGAGAAGG + Intronic
969717256 4:8873705-8873727 AAGGAAACTGAGGCCAGAGAGGG + Intergenic
969719830 4:8887517-8887539 GGGGAAACTGGGGTCCATGAAGG + Intergenic
969757472 4:9159385-9159407 AGGGAAACTGAGGCTAAAGAAGG - Intergenic
969817432 4:9696921-9696943 AGGGAAACTGAGGCCAAAGAAGG - Intergenic
969839758 4:9872164-9872186 GGTGAAACTGAGGCCAGAGAGGG + Intronic
970616515 4:17773156-17773178 GGGGAATCTGAGACCCGGGAGGG - Intronic
971245188 4:24920982-24921004 AGGGAAACTGAGGCACTTTCAGG - Intronic
971293231 4:25364241-25364263 AAGGAAATTGAGGCCCATCAAGG + Intronic
971777908 4:30992061-30992083 AAGGAAACTGAGGCCTCAGAAGG - Intronic
973978441 4:56285829-56285851 AAGGAAACTGAGGCACCTGGAGG + Intronic
975643145 4:76520488-76520510 AAGGAAACTGAGGCCCAGAAAGG + Intronic
976529029 4:86129189-86129211 AAGGAAACTGAGTCCCATGGTGG + Intronic
976943703 4:90738711-90738733 AGAGAAACTCAGTGCCGTGAAGG - Intronic
978579091 4:110214711-110214733 AGGGAAACTGAGGCCCAGAAAGG - Intergenic
979779431 4:124632125-124632147 AGGGAAACTGAGGGCAGAGGAGG - Intergenic
981246576 4:142547611-142547633 AGGAAAACTGAAGACCATGAAGG + Intronic
981432420 4:144676987-144677009 ATGTAAACTGAGGCCAGAGAGGG + Intronic
981688925 4:147484504-147484526 AGGGAAACAGAGGCCCAGGAGGG - Intronic
982025918 4:151254070-151254092 GAGGAAACTGAGGCCCTTGGAGG - Intronic
982227448 4:153179083-153179105 TGGGAGACTGAGGCTGGTGAAGG + Intronic
984901477 4:184590517-184590539 GGGGAAACTGAGGCCCAGAACGG - Intergenic
985251057 4:188024840-188024862 TGGGAAACTGAGGCACATGATGG + Intergenic
985871854 5:2563450-2563472 AGGGAGACTGAGGCTGCTGATGG + Intergenic
987137279 5:14912078-14912100 AGGGAAACTGGAGCCCCTGAGGG - Intergenic
991145381 5:63296991-63297013 AGTGAAACTAAGGGCCATGAAGG + Intergenic
991660343 5:68944828-68944850 AGGGAATCTGAGCCCAGAGATGG - Intergenic
993360956 5:86975794-86975816 ATAGAAACTGAAGCCAGTGAGGG - Intergenic
994738144 5:103583489-103583511 GGAGAAACTGAGGCCCAGGAAGG + Intergenic
994858288 5:105154502-105154524 AGGGAAATTGAAGGCCGTGTGGG - Intergenic
995324145 5:110872501-110872523 GAGGAAACTGAGGCCCGGCAAGG - Intergenic
997738085 5:136229098-136229120 GGGGAAACTGAGGCCCAGAAGGG + Intronic
997860568 5:137411659-137411681 AGATAAAGTGAGGCCCATGAGGG - Intronic
997885838 5:137629307-137629329 AGGGAAACTGAGGCCCAGAAAGG - Intronic
999154850 5:149450772-149450794 GGGGAAACTGAGGCCCAGAAGGG + Intergenic
999169584 5:149581844-149581866 TGGGAAACTGAGGCCCAGGGAGG + Intronic
999188384 5:149729910-149729932 GGGGAAACTGAGGCTCGAGAAGG - Intergenic
999197776 5:149794377-149794399 GAGGAAACTGAGGCCCATGTAGG + Intronic
999239365 5:150118615-150118637 AGGGAAACTGAGGCCCAGAGAGG + Intronic
999245340 5:150151296-150151318 GGGAAAACTGAGGCCCCAGAAGG + Intronic
999249069 5:150171102-150171124 GGGGAAACTGAGGCCCATGAAGG + Intronic
999260079 5:150232878-150232900 AGGGAAACTGAGGCCCAGTGAGG + Intronic
999265667 5:150265236-150265258 ATGGAAACGGAGGCCAGAGAGGG - Intronic
999275584 5:150327800-150327822 AAGGAAACTGAGGCACGGTAAGG + Intronic
999308391 5:150535542-150535564 TGGGAAGCTGAGGCCTGGGAGGG - Intronic
999443004 5:151616976-151616998 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
999586745 5:153097727-153097749 AGAGAAACTGAGGCCTATGGTGG + Intergenic
999640531 5:153668098-153668120 AGGGAAACTGAGGCCCAAAGAGG - Intronic
999645273 5:153711573-153711595 GAGGAAACTGAGGCCAGAGAGGG + Intronic
999701534 5:154233036-154233058 AAGGAAACTGAGGCCCAGAAAGG - Intronic
999710856 5:154317073-154317095 AAGGAAACTGAGGCTCATCATGG + Intronic
999790765 5:154937854-154937876 AGGGAAACTGAGGCCCAGGCTGG - Intronic
1000026949 5:157367420-157367442 AGGAAAACTGAGGCCCAAGAGGG + Intronic
1001303290 5:170553406-170553428 AGGAAAACTGAGGCCCAGAAAGG + Intronic
1001383637 5:171320067-171320089 AAGGAAACTGAAGCCCCAGAAGG - Intergenic
1001583880 5:172819726-172819748 GTGGAAACTGAGGCCAGTGTGGG + Intergenic
1001810538 5:174624402-174624424 AGGAAAACTGAAGCTCGGGAAGG + Intergenic
1001904061 5:175456273-175456295 AGGGGAGTTGAGGCCCATGATGG - Intergenic
1001918331 5:175580641-175580663 AGGGAAACTGAGGCACAGAAAGG + Intergenic
1001926312 5:175639727-175639749 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1001932869 5:175685651-175685673 GAGGAAACTGAGGCCTGAGATGG - Exonic
1002054495 5:176590843-176590865 AAGGAAACTGAGGCCCGTGGAGG - Intronic
1002101586 5:176860606-176860628 GGGGAACCTGAGGCCCGAGGGGG - Intronic
1002277906 5:178115065-178115087 CGGGAAACTGAGGCCTCGGAAGG - Intronic
1002330021 5:178434741-178434763 GAGGAAACTGAGGCCTGGGATGG + Intronic
1003095544 6:3140280-3140302 AGGGAAACTGAGGGCCAAGGAGG + Intronic
1003152234 6:3562761-3562783 AGGGAATCTGAGGCCTGGGAAGG + Intergenic
1004114260 6:12750405-12750427 AGGGTAACTGAGGTACATGAAGG + Intronic
1004690091 6:17986711-17986733 AGGAAAACTGAGGCCCGAGGCGG - Intronic
1004858922 6:19781312-19781334 AGGGAAAATGAGGCCGGGCAAGG - Intergenic
1005949976 6:30624734-30624756 GGGGAAACTGAGGTCCATGGAGG + Intronic
1006083911 6:31582673-31582695 AGAGAAACTGAGGCCCAGGGAGG + Intergenic
1006376237 6:33673159-33673181 GGGGAAACTGAGGCCTGTGAGGG - Intronic
1006438921 6:34041268-34041290 AGGGAAACTGAGGCCCAGAGAGG + Intronic
1006439963 6:34047767-34047789 AAGGAAACTGAGGCCTGAGGAGG + Intronic
1006459576 6:34150613-34150635 GGGGAAACTGAGGCTGGGGAAGG - Intronic
1006459592 6:34150678-34150700 GGGGAAACTGAGGCTGGGGAAGG - Intronic
1006642158 6:35495090-35495112 AGGGAAACTGAGGCCCAAAGGGG + Intronic
1006840965 6:37027677-37027699 AGGGAAACTGAGGCCCAATGAGG + Intronic
1006927765 6:37667362-37667384 AGGGAAACTGAGGCCCAAGGTGG - Intronic
1007267414 6:40607531-40607553 GTGGAAACTGAGGCCCAAGAAGG + Intergenic
1007336390 6:41157999-41158021 AGGGAAACTGAGGCTCAACAAGG - Intergenic
1007413416 6:41678234-41678256 AGGGAAACTGAGGCACAGGGAGG + Intergenic
1007476952 6:42125309-42125331 AGGGAAACTGAGGCACAGGGTGG - Intronic
1007515911 6:42411293-42411315 AAAGAAACTGAGGTCCGGGAGGG + Intronic
1007746043 6:44043555-44043577 AGGGAAACTGAGGCCCAAGGAGG + Intergenic
1007753106 6:44081871-44081893 AGGAGAACTGAGGCCCATGCGGG - Intergenic
1007769291 6:44180274-44180296 AGGGAAACTGAGGCATGAGAAGG + Intronic
1007953618 6:45896408-45896430 CGGGAAACTGAGGCCCAGAAAGG + Intergenic
1008979736 6:57469190-57469212 AGGGAAACTCAGGCTCAGGATGG - Intronic
1009167860 6:60362105-60362127 AGGGAAACTCAGGCTCAAGATGG - Intergenic
1013317841 6:108958860-108958882 AAGGAAACTGAGGCCCAAGGAGG + Intronic
1015842555 6:137489859-137489881 AGGGAAAATGAGGCCGGCGTCGG - Intergenic
1016024430 6:139271811-139271833 ACAGAAACTGAGGCCAGTGGAGG - Intronic
1017524913 6:155234121-155234143 ATGAAAGCTGAGGCCTGTGATGG + Intronic
1017819808 6:158041144-158041166 AGGGAAACTGAGGCTGAAGATGG + Intronic
1018046176 6:159968829-159968851 GGGGAAACTGAGGCCCGGCTAGG + Intergenic
1018443712 6:163835821-163835843 GGGGAAACTGAGGCCTAGGAAGG - Intergenic
1018970772 6:168527300-168527322 GGGGAAACTGAGGCCCGGGAAGG - Intronic
1019231595 6:170569948-170569970 AGGGAAGCAGAGGCTGGTGAGGG - Intronic
1019275747 7:174632-174654 GGGTAAACTGAGGCCAGAGAGGG - Intergenic
1019283461 7:211755-211777 GGGGAAACTGAGGCCCGGAAAGG + Intronic
1019300458 7:300533-300555 GGGGAAACTGAGGCTTGAGAGGG + Intergenic
1019316083 7:387571-387593 AGGGAAACTGAGGCGCAGGAAGG + Intergenic
1019323240 7:425037-425059 TGGGAAACTGAGGCCCTGCAAGG + Intergenic
1019350889 7:553471-553493 GGGGAAGCTGAGGCCCAGGAAGG + Intronic
1019359342 7:596678-596700 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1019494518 7:1331559-1331581 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1019518064 7:1448279-1448301 GGGCAAACTGAGGCCCATGAGGG + Intronic
1019558689 7:1645269-1645291 AGGGAAACTGAGGCCGGGTGAGG - Intergenic
1019613363 7:1947955-1947977 AGAGAAACTGAGGCCCAAGGAGG + Intronic
1019647712 7:2139941-2139963 AGGGAAACTGAGGCCTGTGGGGG - Intronic
1019700235 7:2471336-2471358 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1019737427 7:2657628-2657650 AGGGAAATTGAGGCCCAGGGTGG - Intronic
1019823107 7:3260732-3260754 TGGGAAACTGAGGGCCAGGAGGG - Intergenic
1020098342 7:5380723-5380745 GGGGAAACTGAGGCCCAGAAGGG + Intronic
1020138503 7:5599425-5599447 AGGGAGACTAAGGCCGGTGGTGG - Intronic
1020320809 7:6937712-6937734 AGGGAAACTGAGGCTAAAGAAGG + Intergenic
1021153388 7:17179450-17179472 AGGGAAACTGAGGCCTGGAATGG + Intergenic
1021914388 7:25416895-25416917 AGAGAAACTGAGGCCCAGGGAGG - Intergenic
1022494970 7:30847103-30847125 AGGGAAACAAAGGCCAGGGAGGG + Intronic
1022503974 7:30899256-30899278 AGGGAAACTGAGGCTCAGAAAGG - Intergenic
1022523700 7:31023834-31023856 AGGCAAACATAGGCCCCTGAAGG - Intergenic
1022526364 7:31040167-31040189 AGGGAAACTGAGGTCCACAAAGG + Intergenic
1022529599 7:31058569-31058591 AGGGAAACTGAGGCCAGAGAAGG - Intronic
1022636624 7:32142361-32142383 AGGGAAATTGACACCCTTGAGGG - Intronic
1022963641 7:35453788-35453810 AAGGAAACTGAGGCACAGGAAGG + Intergenic
1023042162 7:36181258-36181280 AAGGGAACAGAGGCACGTGAGGG - Intronic
1023168991 7:37372352-37372374 GGGGAAACTGAGGCCTGTCAAGG - Intronic
1023187048 7:37542933-37542955 AAGGAAACTGGGGCCCATGGAGG + Intergenic
1023336996 7:39180776-39180798 AGGGAAACTGAAGCCAGTAATGG - Intronic
1023623918 7:42097787-42097809 AGCAGAACTGAGGCCCTTGAAGG - Intronic
1024248595 7:47489382-47489404 GGGGAAACTGAGGCCCCTAGAGG - Intronic
1025603533 7:63022733-63022755 GGGGAAACTGAGGCCCAGAAAGG - Intergenic
1025996708 7:66531786-66531808 AGGGAAACTGAAGCCCAGGTAGG - Intergenic
1026307344 7:69153502-69153524 AGGGAAACTGAGGCTCCTATGGG + Intergenic
1026551516 7:71372933-71372955 AAGGAAACTGAGGCCCAAAAAGG + Intronic
1026836245 7:73641342-73641364 AGGGCAACTGAGGCCCAGGGAGG - Intergenic
1026840832 7:73669202-73669224 GAGGAAACTGAGGCCAGAGAGGG + Intronic
1026877569 7:73888222-73888244 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1026988764 7:74571189-74571211 AGGGAAACTGAGGCCCAGGTAGG - Intronic
1027044911 7:74984749-74984771 AAGGAAACCGAGGCCCCAGAGGG + Intronic
1028201829 7:87971426-87971448 AGGGACACTGAGGCCAGTGTGGG - Intronic
1029170861 7:98628183-98628205 GGGGAAACTGAGGCTGGTAAGGG - Intronic
1029177771 7:98677072-98677094 GGGGAAACTGAGGCACAGGAAGG - Intergenic
1029183292 7:98720128-98720150 AGGGAAACTGAGGCTCAGGAAGG - Intergenic
1029272500 7:99385489-99385511 AGGGAAACTGAGGCCCCAGGAGG + Intronic
1029387945 7:100256172-100256194 AAGGAAACCGAGGCCCCAGAGGG - Intronic
1029482986 7:100824148-100824170 AGGGAAACTGAGGGAGGAGAGGG - Intronic
1029576844 7:101409030-101409052 AAGGAAACTGAGGCACAGGAAGG - Intronic
1029597098 7:101543736-101543758 GGGGAAACTGAGGCTCAGGAAGG - Intronic
1029619835 7:101683333-101683355 AGGGAAACTGAGGCATGGGGAGG - Intergenic
1029630733 7:101748468-101748490 GGGGAAACTGAGGCTCGGGTGGG + Intergenic
1029656856 7:101931508-101931530 AGGGAAACTGAGGCCCAGAGAGG + Intronic
1032431421 7:131864990-131865012 AGGGAAACTGAGGCATGGGGAGG + Intergenic
1033662433 7:143411450-143411472 AAGGAAACTGAGGCACATTATGG - Intergenic
1034369913 7:150585859-150585881 AGGGATACTGAGGGCAGTGACGG + Intergenic
1034473477 7:151269182-151269204 AGGGAAACTGAGGCAGGAAAAGG + Intronic
1035203820 7:157282018-157282040 GGGGAAACTGAGGCACAGGAAGG - Intergenic
1036133668 8:6139472-6139494 GGGGAAACTGAGACCAGAGAGGG - Intergenic
1036561229 8:9901999-9902021 GGGGAAACTGAGGCCGGGGAGGG + Intergenic
1036693253 8:10958076-10958098 AGGGAAACTGAGGCCCAGAGAGG - Intronic
1036848859 8:12187921-12187943 AGGGAAACTGAGGCTAAAGAAGG + Intronic
1036870220 8:12430199-12430221 AGGGAAACTGAGGCTAAAGAAGG + Intronic
1037484425 8:19334050-19334072 AGGGAAACTGAGGCAGGTGATGG + Intronic
1038021964 8:23558395-23558417 TGGGAAACTGAGGCCCAAGAAGG - Intronic
1038351395 8:26779406-26779428 GAGGAAACTGAGGCCCAAGAAGG - Intronic
1038358000 8:26848161-26848183 AAGGAAACTGAGGCACGCAAGGG - Intronic
1038450361 8:27635324-27635346 AGGGAAACTGAGGCCCAAGCAGG + Intronic
1039434260 8:37548783-37548805 AGGGAAACCGAGGCTCGGCAAGG + Intergenic
1041886112 8:62809772-62809794 GAGGAAACTGAAGCCCGTGGTGG + Intronic
1042873238 8:73416993-73417015 GTGGAAACTGAGGCCCAGGAAGG + Intergenic
1044664807 8:94624060-94624082 GAGGAAACTGAGGCTCATGAAGG + Intergenic
1045034965 8:98169809-98169831 AGGGAGACTGAGGCCCGGCGAGG + Intergenic
1045102918 8:98863408-98863430 GGGGAAACTGAGGTACATGAAGG - Intronic
1045332323 8:101166158-101166180 AGGGAAACTGAGGCACAGAAAGG + Intergenic
1047204184 8:122790237-122790259 GAGGAAACTGAGGCCCGGAAAGG + Intronic
1047205741 8:122802007-122802029 GGGGAAACTGAGGCCAGAGAGGG - Intronic
1047529628 8:125663301-125663323 GGGGACACTGAGGCTCATGAGGG + Intergenic
1047645396 8:126864660-126864682 GAGGAAACTGAGGCACATGAGGG - Intergenic
1047743764 8:127828270-127828292 AGGGAAACTGAGGCCCAGAGTGG + Intergenic
1047895315 8:129360138-129360160 AGGAAAACTGAGGCCCAGAAAGG + Intergenic
1047929118 8:129708920-129708942 GAGGAAACTGAGGCCCATAAAGG - Intergenic
1048238030 8:132711653-132711675 AGGGACACTCAGGCCAGTGGTGG + Intronic
1048974072 8:139661542-139661564 TGGGAAGCTGAGGCCCCAGAGGG - Intronic
1049207727 8:141371210-141371232 AGGGAAACTGAGGCCCAGAAAGG + Intergenic
1049269384 8:141686232-141686254 GAGGAAACGGAGGCCCGGGAAGG + Intergenic
1049443654 8:142620265-142620287 GAGGAAACTGAGGCCAGAGAGGG - Intergenic
1049462489 8:142736553-142736575 GGGGAAACTGAGGCCTGGAATGG + Exonic
1050014182 9:1216326-1216348 AGGGAAACCAAGGCATGTGATGG - Intergenic
1050073155 9:1837670-1837692 AGGGAAAGTGAAGCCCATGTGGG - Intergenic
1051187004 9:14470851-14470873 GAGGAAACTGAGGCCTATGAGGG - Intergenic
1052964589 9:34329927-34329949 AGTGAAACTGAGGCCCAGGGAGG - Intronic
1053279171 9:36806205-36806227 TGAGAAACTGAGGCCAGAGAAGG - Intergenic
1054911701 9:70460927-70460949 TGGGAAACTGAGGCAGGAGAGGG + Intergenic
1055028892 9:71752087-71752109 AGAGAAACTGAGGCCCAGGGAGG + Intronic
1055603890 9:77948427-77948449 AGGGAGACTGAGGCCTGACACGG + Intronic
1056331364 9:85523659-85523681 AAGGAAACTGAGACCCAGGAAGG + Intergenic
1056467750 9:86875050-86875072 AGGGAATCAGAGGTCCTTGAAGG + Intergenic
1056512339 9:87317800-87317822 AATGAAACTGAGGCCCAGGAAGG + Intergenic
1056633050 9:88309178-88309200 AAGGAAACTGAGGTCCATGAGGG + Intergenic
1056676658 9:88682055-88682077 GGGGAAACTGAGGCCAGGGCTGG + Intergenic
1056942026 9:90964266-90964288 AAGGAAACTGAGGCTCAGGAAGG + Intergenic
1057280581 9:93708457-93708479 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1057298665 9:93863878-93863900 AGGGAAGCTGAGGCGCATGGAGG + Intergenic
1057743818 9:97735588-97735610 TAGGAAACTGAGGCCAGAGAGGG - Intergenic
1057757474 9:97849421-97849443 AGAGAAACTGAGGCCTAAGAAGG + Intergenic
1057785234 9:98082380-98082402 GGGGAAACTGAGGCCCATACAGG - Intronic
1058250788 9:102693573-102693595 AGTGAAGATGAGGCCAGTGAAGG - Intergenic
1058479322 9:105374970-105374992 AGGGAAACTGAGGCATGGAAAGG + Intronic
1058747797 9:108008676-108008698 AGAGAAACTGAGGCCCTGGGAGG + Intergenic
1058774967 9:108273931-108273953 ATGGAAACTGAGGCCCAGCAAGG - Intergenic
1058789025 9:108422976-108422998 AGGGTAACTGAGACCAGGGAAGG + Intergenic
1058798407 9:108520503-108520525 GTGGAAACTGAGGCTCGGGAAGG - Intergenic
1059356023 9:113700083-113700105 AGGGAGACTGAGGCCTGGCAGGG - Intergenic
1059366060 9:113787323-113787345 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1059412338 9:114140276-114140298 AGGGAAACTGAGGCCCAAAGAGG + Intergenic
1059422443 9:114200692-114200714 GGGGAAACTGAGGCCCGGAGAGG + Intronic
1059438327 9:114289318-114289340 AGGGAGACTGAGTCCCAGGAAGG + Intronic
1059657452 9:116369387-116369409 AGGGAAACTGAGGCCTATAGAGG + Intronic
1059994541 9:119896066-119896088 TGGGAAACTGAGGCCCAGAAAGG - Intergenic
1059998872 9:119940154-119940176 AAGGAAACTGAGGCTCAGGAAGG - Intergenic
1060030934 9:120214183-120214205 AGGTAAACTGAGGCAAGAGATGG - Intergenic
1060050464 9:120374975-120374997 GGGGAGACTGAGGCCCAGGAGGG - Intergenic
1060205850 9:121682437-121682459 ATGGAAACTGAGGCCTGGGAAGG + Intronic
1060508490 9:124215676-124215698 GAGGACACTGAGGCCCGGGAAGG + Intergenic
1060523865 9:124309493-124309515 GGGGAAACTGAGGCCCAAGAGGG + Intronic
1060886993 9:127161380-127161402 AAGGAAACTGAGGCCCTGGGAGG + Intronic
1060917302 9:127398705-127398727 AAGGAAACTGAGGCCCAGGGAGG - Intronic
1060965071 9:127707622-127707644 GGGGAAACTGAGGCCCAGCATGG - Intronic
1060993435 9:127862005-127862027 AGAGAAACTGAGGCCCAAGAGGG + Intergenic
1060995763 9:127874253-127874275 AGGGAAACTGAGTCCCGGAGAGG + Intronic
1061036184 9:128115562-128115584 GGGTAAACTGAGGCCAGGGAGGG + Intergenic
1061039029 9:128128915-128128937 AGGGAAACTGAGGCAGCTGCTGG + Intergenic
1061045362 9:128162123-128162145 AGGGAAACCGAGGCCTCAGAAGG - Intronic
1061087656 9:128408774-128408796 AGGGAAACTGAGGCCCACAGTGG + Intergenic
1061121829 9:128647980-128648002 AAGGAAACTGAGGCCCAGAAAGG + Intronic
1061178385 9:129010519-129010541 GGGGAAACTGAGGCCCAGGGAGG + Intronic
1061211381 9:129195404-129195426 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1061215442 9:129219070-129219092 AGAGAAACTGAGGCTCGTGGTGG + Intergenic
1061253667 9:129441038-129441060 AGAGAAACTGAGGCCCAGGGAGG - Intergenic
1061272872 9:129553525-129553547 AGGGAAACTGAGGCCCAGGGAGG - Intergenic
1061296546 9:129679851-129679873 TGGGAAACGGAGGCCCTGGAGGG - Intronic
1061316464 9:129799383-129799405 AGGGAAACTGAGTCCCAGAAAGG + Intergenic
1061416781 9:130451391-130451413 AGAGAAACTGAGGCCCAGGGAGG - Intronic
1061419068 9:130463530-130463552 AGGGAAACTGAGGCCCAGGAAGG - Intronic
1061493022 9:130956758-130956780 CGGGAAACTGAGGCCCCCGGGGG + Intergenic
1061493324 9:130958067-130958089 AGGGAAACTAAGGCTGGAGAGGG - Intergenic
1061664539 9:132152833-132152855 AGGGAAACTGAGGCTCTGAAAGG - Intergenic
1061807178 9:133142974-133142996 GGGGAAACTGAGGCACTGGAAGG - Intronic
1061881009 9:133568818-133568840 ATGGAAACTGAGGCACATCAAGG - Intronic
1061894278 9:133639018-133639040 AGGTAAACTGAGGCCCAGGGAGG - Intronic
1061904970 9:133692087-133692109 AGGGAAACTGAGGCTCAGGGAGG + Intronic
1061905003 9:133692203-133692225 GGGGAAACTGAGGCTCGGGGGGG + Intronic
1061908267 9:133709804-133709826 GGGGAAACTGAGGCTCGGAAGGG + Intronic
1061985050 9:134125806-134125828 GGAGAGACTGAGGCCCTTGAGGG + Intergenic
1062068207 9:134540205-134540227 AGGGAAACTGAGGACTGGGTGGG + Intergenic
1062087317 9:134655473-134655495 GGGGAAACTGAGGCACAGGAAGG - Intronic
1062237833 9:135521188-135521210 AGGGAAACTGAAGGGAGTGAAGG - Intergenic
1062287118 9:135778224-135778246 GGGGAAACCAAGGCCCGGGAGGG - Intronic
1062406663 9:136399981-136400003 GGGGAAACTGAGGCCCGGCGTGG - Intergenic
1062434012 9:136538414-136538436 GGGGAAACTGAGGCCCAGGGAGG + Intronic
1062439417 9:136563077-136563099 TGGGAAACTGAGGCCTGAGAGGG + Intergenic
1062460190 9:136659726-136659748 GGGGAAACTGAGGCCTGTGTGGG + Intronic
1062641245 9:137519688-137519710 AGGGGACCTGAGGCACGTGAGGG + Intronic
1185597117 X:1314073-1314095 AGGATGACTGAGGCCCCTGAAGG + Intergenic
1185892727 X:3835362-3835384 GGGGAAACTGAGGCCCGGAGGGG - Intronic
1185897835 X:3873782-3873804 GGGGAAACTGAGGCCCGGAGGGG - Intergenic
1185902954 X:3912213-3912235 GGGGAAACTGAGGCCCGGAGGGG - Intergenic
1186523977 X:10230760-10230782 GGGGAAACTGAGGGGAGTGAAGG - Intronic
1189004033 X:36976978-36977000 AGGGAAACTGAGGCACGGAGAGG - Intergenic
1189269087 X:39737840-39737862 AGGGAAACTAAGGCTCAGGAAGG + Intergenic
1189366767 X:40394894-40394916 GAGGAAACTGAGGTCCATGAGGG - Intergenic
1190244463 X:48682020-48682042 GGGGAAACTGAGGCCTGGGGAGG + Intronic
1190278720 X:48915525-48915547 AGGGAAAGTGAGGCCCAGGAAGG - Intronic
1190292524 X:49002038-49002060 AGGGAAACTGAGGCTCGGAGTGG - Intronic
1190309510 X:49106810-49106832 GGGGAAACTGAGGCCTGGGGAGG + Intergenic
1190478363 X:50850340-50850362 AGACAAACTGAGACCCCTGAAGG + Intergenic
1190752917 X:53377638-53377660 AAGGAAACTGAGGCCCAAAAAGG - Exonic
1190935568 X:54996347-54996369 AGGGAAACTGAGGTCTGGGGAGG + Intronic
1191974142 X:66851658-66851680 AGGGAAACTGAACACCTTGAAGG - Intergenic
1192012824 X:67293567-67293589 AGGCAAACTGAGGCCCTAGGAGG - Intergenic
1192151701 X:68716773-68716795 GGGGAAACTGAGGCCCAGAAGGG - Intronic
1192155724 X:68745078-68745100 GGGGAAACTGAGGCCCTGAAAGG - Intergenic
1192173693 X:68873053-68873075 GGGGAGACTGAGGCCCCAGAGGG - Intergenic
1192205133 X:69090622-69090644 AAGGAAACTGAGGCTCGAAATGG + Intergenic
1192212138 X:69134400-69134422 AGGGAAACTGAGGCCCAGAGAGG - Intergenic
1193076389 X:77360253-77360275 TGGGAAACTGAGTCCAGTGGGGG - Intergenic
1193195064 X:78621774-78621796 AGGTAAACTGAGGCCCAAGGAGG - Intergenic
1195675345 X:107503398-107503420 GGGGAAACTGAGGCCTAGGAAGG + Intergenic
1195904119 X:109827279-109827301 GGGGAAACTGAAGCCCAAGAGGG - Intergenic
1197705493 X:129631714-129631736 AGGGAAACTGAGGCCCAGAGAGG + Intergenic
1198028931 X:132736187-132736209 AGGGAAACTGAGGCCCTATGTGG - Intronic
1198101093 X:133422373-133422395 AGGCCAGCAGAGGCCCGTGAAGG + Intergenic
1199501234 X:148508920-148508942 AAGGAGACTGAGGCCCAGGATGG + Intronic
1199807275 X:151312757-151312779 GGGGAAACTGAGGCCCAGAAAGG - Intergenic
1200284905 X:154811158-154811180 AAGGAAACAAAGTCCCGTGAGGG + Intronic