ID: 1081867164

View in Genome Browser
Species Human (GRCh38)
Location 11:46366354-46366376
Sequence CCCAGCGGGGGAGCGACGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 116}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081867164_1081867174 4 Left 1081867164 11:46366354-46366376 CCCGGCGTCGCTCCCCCGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1081867174 11:46366381-46366403 CCTCCTCCTCACTGGCACAGCGG 0: 1
1: 0
2: 2
3: 39
4: 326
1081867164_1081867179 30 Left 1081867164 11:46366354-46366376 CCCGGCGTCGCTCCCCCGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1081867179 11:46366407-46366429 CGCTCCAGCGCCCAGCTCCAGGG 0: 1
1: 0
2: 3
3: 27
4: 237
1081867164_1081867178 29 Left 1081867164 11:46366354-46366376 CCCGGCGTCGCTCCCCCGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1081867178 11:46366406-46366428 CCGCTCCAGCGCCCAGCTCCAGG 0: 1
1: 1
2: 21
3: 47
4: 374
1081867164_1081867172 -4 Left 1081867164 11:46366354-46366376 CCCGGCGTCGCTCCCCCGCTGGG 0: 1
1: 0
2: 0
3: 11
4: 116
Right 1081867172 11:46366373-46366395 TGGGCAGGCCTCCTCCTCACTGG 0: 1
1: 0
2: 2
3: 20
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081867164 Original CRISPR CCCAGCGGGGGAGCGACGCC GGG (reversed) Exonic