ID: 1081869112

View in Genome Browser
Species Human (GRCh38)
Location 11:46375298-46375320
Sequence ACCCCTGGCCAGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 451
Summary {0: 1, 1: 0, 2: 6, 3: 42, 4: 402}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081869112_1081869120 21 Left 1081869112 11:46375298-46375320 CCCTCTGCCCTCTGGCCAGGGGT 0: 1
1: 0
2: 6
3: 42
4: 402
Right 1081869120 11:46375342-46375364 GCTAGAGTTTCTGCTTCGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 222
1081869112_1081869117 -1 Left 1081869112 11:46375298-46375320 CCCTCTGCCCTCTGGCCAGGGGT 0: 1
1: 0
2: 6
3: 42
4: 402
Right 1081869117 11:46375320-46375342 TCACTCTCACCTTTGTTCTCTGG 0: 1
1: 0
2: 3
3: 38
4: 309
1081869112_1081869119 17 Left 1081869112 11:46375298-46375320 CCCTCTGCCCTCTGGCCAGGGGT 0: 1
1: 0
2: 6
3: 42
4: 402
Right 1081869119 11:46375338-46375360 TCTGGCTAGAGTTTCTGCTTCGG 0: 1
1: 0
2: 0
3: 22
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081869112 Original CRISPR ACCCCTGGCCAGAGGGCAGA GGG (reversed) Intronic
900174243 1:1284828-1284850 ACCCCTGGTCAGAGAGGAGCCGG - Intronic
900202904 1:1419325-1419347 ACCCCTGTCCAGCAGGCAGCCGG + Exonic
900290147 1:1920289-1920311 GCCCCTGGCCTGGTGGCAGAGGG - Intergenic
900465774 1:2824823-2824845 ACACCTGGACATGGGGCAGAGGG - Intergenic
900638411 1:3676604-3676626 ACTCCTCCCCACAGGGCAGAGGG + Intronic
900645467 1:3706858-3706880 ACCCCGGGCCAGGGGGCAGCAGG + Intronic
900915205 1:5632677-5632699 CCGCCTGGCCACAGGGCAGCAGG - Intergenic
900989906 1:6093694-6093716 ACCCCTTGCCAGGGGACAGGCGG + Intronic
901022094 1:6260791-6260813 CGCCCTGGCCCGAGGGCGGACGG - Intronic
901236795 1:7671520-7671542 GGCCCTGGGCAGGGGGCAGAAGG + Intronic
901301291 1:8201617-8201639 GCCCCTGGCGAGGTGGCAGAGGG + Intergenic
901492291 1:9602689-9602711 ACCCCTGTGCAGAGGCCAGAAGG - Intronic
902230465 1:15024150-15024172 ACCAATGCCCAGAGGTCAGAAGG + Intronic
902288380 1:15421309-15421331 AGCCCAGGGCACAGGGCAGATGG + Intronic
902338185 1:15765796-15765818 ACCCGAGGCCACAGGGCAGGTGG - Intronic
902814894 1:18910631-18910653 ACCCATGTGCAGAGAGCAGAGGG - Intronic
903575479 1:24337178-24337200 ACACCTGGGCAGTGGGCAGGAGG + Intronic
903687194 1:25140451-25140473 CCCCATGGACAGAGGGCAGGAGG + Intergenic
903888396 1:26554500-26554522 CCCCGTGCCCAGAGGCCAGAAGG - Intronic
904011160 1:27391446-27391468 TCCCCTGGACTAAGGGCAGATGG + Intergenic
904585280 1:31576606-31576628 TCCCCTGCTCAGAGGGCGGAAGG + Intronic
905017139 1:34785568-34785590 ACCCCTGCCCTGTGGTCAGATGG - Exonic
905250429 1:36644722-36644744 TCCCCTGGCTTGAGGGCACATGG + Intergenic
905796106 1:40817542-40817564 ACCTCTGGGCTGAGGGCTGAAGG + Intronic
905891123 1:41519045-41519067 AGGCATGGCGAGAGGGCAGAAGG + Intronic
906209988 1:44007405-44007427 ACCCCTGGGCAGAGGGCTTTGGG - Intronic
906253079 1:44326318-44326340 CCTCCTGGCCACAGGGAAGAGGG + Intronic
906545851 1:46618860-46618882 AAACCTGGCCAGAGATCAGACGG - Intergenic
908268642 1:62402173-62402195 ACTCCTGGCCTCAGGTCAGAGGG - Intergenic
909392345 1:75132207-75132229 ACCCCTGACAAAAGGTCAGAAGG + Intronic
910045842 1:82914718-82914740 GCCCAAGGCCAGAGAGCAGAAGG + Intergenic
910104356 1:83615402-83615424 ACTCCTGGTCAGACTGCAGAGGG + Intergenic
910668126 1:89746013-89746035 ATCTATGGCCAGAGGGAAGAGGG - Intronic
911368953 1:96973721-96973743 AGCCCTGGGAAGAGGCCAGATGG - Intergenic
912304849 1:108557003-108557025 AACCAAGGCCAGAGGGTAGAGGG - Intergenic
913128669 1:115816919-115816941 ACCTGTGGCCAGAGGGAAGCAGG + Intergenic
913698240 1:121348337-121348359 CACCCTGGCCACAGTGCAGATGG - Intronic
914139309 1:144931715-144931737 CACCCTGGCCACAGTGCAGATGG + Intronic
915279587 1:154813523-154813545 AACCCTGGCAGGAGGACAGAGGG - Intronic
915595371 1:156893802-156893824 ACCCCAGGCCGCAGGGGAGACGG + Exonic
915917846 1:159951811-159951833 TCCCTTGGCCAGGAGGCAGAAGG + Exonic
916678814 1:167086281-167086303 ACCCAGGGCCACAGAGCAGATGG + Intronic
917709043 1:177665928-177665950 AACCCTGGCAAAAGAGCAGAGGG + Intergenic
919559719 1:199101627-199101649 AACTCTGCCCAGAGTGCAGAGGG + Intergenic
919819860 1:201466054-201466076 AGCCCTGGGAGGAGGGCAGAAGG - Exonic
920171172 1:204073391-204073413 AGCCCAGGGCAGAGGGCAGAGGG + Intronic
920179157 1:204121992-204122014 GCCCCAGGCCAGTGGGTAGAGGG - Intronic
920373182 1:205492380-205492402 ACTCCTGGAAAGAGGGCAAAGGG - Intergenic
920485639 1:206366993-206367015 CACCCTGGCCACAGTGCAGATGG - Intronic
920965507 1:210697689-210697711 AGCCCTGGCCATGGGCCAGAAGG - Intronic
920991524 1:210944411-210944433 TCCCCAGGCCAGAAAGCAGACGG + Intronic
921177489 1:212607558-212607580 CACCCTGGCTTGAGGGCAGAGGG + Intronic
921670568 1:217919732-217919754 ACCACAGCCCACAGGGCAGACGG - Intergenic
922878532 1:228960825-228960847 GCCTCTGACCAGAGGGGAGAGGG + Intergenic
924605306 1:245529175-245529197 ACCTCTGGCCAGACGACAGCAGG - Intronic
1063171867 10:3516446-3516468 AGGCCGGGTCAGAGGGCAGAAGG - Intergenic
1065065627 10:21960655-21960677 ACTCCAGCCCAGAGGACAGAGGG + Intronic
1065968688 10:30788807-30788829 ACCCATGGGCAGAGGGTAGAGGG + Intergenic
1066358632 10:34709601-34709623 ACCCCTGGGCTGAGGGGATAAGG + Intronic
1066438461 10:35415270-35415292 AGCCCTGTCCTGAGGGCAGGAGG + Intronic
1068266570 10:54657164-54657186 ACTCCTGGCCATAGTGCAGCTGG - Intronic
1070189789 10:74101443-74101465 ACCCCAGGCTGGAGGGCAGTGGG - Intronic
1070801494 10:79246847-79246869 CCCACTGGCCGGAGGGCCGAAGG + Intronic
1070825443 10:79387869-79387891 ACCCCTGGGCCAGGGGCAGAAGG - Intronic
1071138085 10:82474936-82474958 ACTGCAGGCCAGAGGGCAGCGGG + Intronic
1072045519 10:91650931-91650953 GGCCCTGGCAAGAGAGCAGAGGG + Intergenic
1072318066 10:94222770-94222792 AAGCCAGGCCAGAGGGCAGTGGG - Intronic
1073487452 10:103828677-103828699 ACACTTGGCCATAGGGCTGATGG - Intronic
1074782494 10:116811967-116811989 AGGCCAGGCCAGAGTGCAGAGGG + Intergenic
1075918798 10:126192387-126192409 ACCCCTGTCCTGAGTGCAAAGGG + Intronic
1076537110 10:131186693-131186715 GCCTCTGGCGAGAAGGCAGAGGG + Intronic
1076740068 10:132478525-132478547 CCCCGGGCCCAGAGGGCAGAGGG - Intergenic
1077043974 11:536187-536209 ACGCCTGGCCCCAGGGCACACGG - Intronic
1077107400 11:848160-848182 AGCTCTGCCCAGAGAGCAGATGG - Intronic
1077137544 11:1008491-1008513 CCCCCAGGCCAGGGGGCCGAAGG - Intronic
1077445757 11:2589939-2589961 ATCCGTGGCCAGTGGGCAGGAGG - Intronic
1078050807 11:7963348-7963370 CCCACTGGCCAGAGGGGAGTTGG - Exonic
1078660042 11:13278549-13278571 AGCCCTGGCTACAGGGCCGAAGG - Intronic
1078820666 11:14877775-14877797 CCCCCAGGACAGAAGGCAGATGG + Exonic
1080246612 11:30186204-30186226 ACCCCTTACCACATGGCAGAAGG + Intergenic
1081650312 11:44819187-44819209 ATCCCTGGCCAAAGGCAAGATGG - Intronic
1081702704 11:45162038-45162060 GCCACTGCCCAGAGGGCAGGAGG - Intronic
1081869112 11:46375298-46375320 ACCCCTGGCCAGAGGGCAGAGGG - Intronic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1083202888 11:61131088-61131110 CCCTCTGGCCAGAGGGCCCAAGG + Exonic
1083619130 11:64040389-64040411 ACCCCCGGCAGGAGGGCAGAGGG + Intronic
1083855760 11:65392316-65392338 ACCCCTGGCCTCAGGCCAGCAGG + Intronic
1083993889 11:66262760-66262782 ATCCCAGTCCAGTGGGCAGATGG + Intronic
1084273349 11:68040281-68040303 AGGCCCGGCCACAGGGCAGAGGG - Intronic
1084420548 11:69058441-69058463 ACCCCCTCCCAGAGGACAGAGGG - Intronic
1084787005 11:71448358-71448380 ACCCCTGGCTAGAGGGTAGGCGG - Exonic
1085055844 11:73403326-73403348 ACCCCAGGCCAGTGAGGAGAGGG + Intronic
1086475716 11:87170979-87171001 TGCCCTGGCCAGAGAGCAAAGGG + Intronic
1087108114 11:94432472-94432494 ACCTCTGGACAGCGTGCAGATGG - Intronic
1088627669 11:111742969-111742991 AACCTTGGGCAGGGGGCAGAGGG - Intronic
1089214264 11:116826315-116826337 TCCCCAGGCCAGAGGGGAGGAGG + Intergenic
1089255765 11:117193134-117193156 AGCCCTGGCAAGAGGGATGAAGG - Exonic
1089548962 11:119255246-119255268 ACTCCTGGCCAGAGGGAGGGAGG + Intronic
1089676481 11:120093413-120093435 TTCCCTGGGCAGAGAGCAGAAGG - Intergenic
1089788104 11:120922514-120922536 AGGGATGGCCAGAGGGCAGAGGG - Intronic
1090398305 11:126433404-126433426 CCCTCTGGCCGGAGGGCAAATGG - Intronic
1091516815 12:1192579-1192601 AGCCATGGCCAAGGGGCAGAAGG - Intronic
1092548021 12:9468459-9468481 AGCACTGGCTAAAGGGCAGAAGG + Intergenic
1094504980 12:31053989-31054011 AGCACTGGCTAAAGGGCAGAAGG - Intergenic
1095996332 12:48088894-48088916 ACCTTTGGCCAGAGTGCAAATGG - Exonic
1096869973 12:54587098-54587120 ACCCCAGGCCAGAGAGAGGACGG + Intronic
1096872806 12:54604721-54604743 ACCCCGGGCCAGAGAGAGGATGG + Intergenic
1098449984 12:70609464-70609486 TTCTCTGGCCAGAGGGCAAAAGG - Intronic
1099975881 12:89545011-89545033 ACTACTGGCAAGAGGCCAGAGGG - Intergenic
1100109501 12:91221823-91221845 ACCACTGAACAGAAGGCAGAAGG - Intergenic
1100243265 12:92730896-92730918 ACTCCTGAGAAGAGGGCAGAGGG - Intronic
1101910764 12:108858661-108858683 ACCACGGGGCAGAGGGCTGAGGG + Intergenic
1102090577 12:110183977-110183999 TCCCCTGGCTAAAGTGCAGAGGG - Intronic
1102255140 12:111410687-111410709 ACCCCAGGCCACGGGGCAGCTGG - Intronic
1103214893 12:119194407-119194429 ACATCTGGGCAGAGGGCAGAAGG - Exonic
1103516535 12:121512055-121512077 TCCCCAGGCCAGAAGGCCGAGGG - Intronic
1103723703 12:122987714-122987736 CACCCCGGCCAGAGGGCAGCAGG + Intronic
1103915719 12:124374635-124374657 GCCGCTGGCCAGAGCCCAGAGGG - Intronic
1104417327 12:128606305-128606327 ACCCCTGGCCACACGGGGGAGGG - Intronic
1104527566 12:129538822-129538844 ACCCCTGGCAATAGGTCAGAAGG + Intronic
1104527573 12:129538862-129538884 ACCCCTGGCGATAGGTCAGAAGG + Intronic
1104527582 12:129538902-129538924 ACCCCTGGCGATAGGTCAGAAGG + Intronic
1104527589 12:129538942-129538964 ACCCCTGGCGATAGGTCAGAAGG + Intronic
1104527596 12:129538982-129539004 ACCCCTGGCGATAGGTCAGAAGG + Intronic
1104570927 12:129924995-129925017 ACCGGTGGCCAGAGAGCAGTGGG + Intergenic
1104679468 12:130739605-130739627 ACTGCTGGCCTGAGGGCAGAGGG - Intergenic
1104990160 12:132620144-132620166 TCCCCTGACCAGAGGCCAAACGG + Intronic
1105284948 13:18996041-18996063 AGGCCAGGCCAGAAGGCAGAAGG + Intergenic
1106862227 13:33922020-33922042 ACACCTGCCCAGAGGGCTGCTGG + Intronic
1113074619 13:106455386-106455408 TCCCCTGGGCAGTGGGCAGTAGG - Intergenic
1113354502 13:109565712-109565734 ACCCCTGAGGAGAGGGCAGCAGG - Intergenic
1114664312 14:24369065-24369087 AACCGTGGCCAGAGGGGAGGGGG - Intronic
1116817872 14:49599826-49599848 TCCCCTCGCCGGAGGGGAGAGGG - Intronic
1118740969 14:68738850-68738872 TCCCCAGGCAAGAGGGCACAGGG - Intergenic
1119175354 14:72564540-72564562 ACCCCTAGGCATAGGGCAAAGGG + Intronic
1120097422 14:80404154-80404176 ACCCCAGGTCAGAGGACAAAAGG + Intergenic
1121005376 14:90487323-90487345 GACCCTGCCCAGTGGGCAGAGGG + Intergenic
1121050155 14:90815190-90815212 CACCGTGGCCAGAGGGCAGAGGG - Intronic
1121329375 14:93040464-93040486 GCCCCTGGCCAGAGCACACATGG + Intronic
1121901055 14:97693852-97693874 ACCCCTGGCCAAAGGGAAAGTGG - Intergenic
1121947315 14:98135906-98135928 ATGCCTGGCCAGGGGGCACAGGG - Intergenic
1122081187 14:99268984-99269006 AGCCCTGGCCAGAGGACTGGTGG - Intronic
1122152374 14:99731994-99732016 TCTCAGGGCCAGAGGGCAGAGGG + Intergenic
1122406782 14:101505506-101505528 AACCCTGGCCAGAGTGGAGCTGG - Intergenic
1122897818 14:104769099-104769121 AGGCCTGGCCTGAGGGGAGATGG - Intergenic
1122974514 14:105165601-105165623 AAGCCAGGCCAGGGGGCAGAGGG + Intronic
1124243002 15:28046614-28046636 ATCCCAGGGCAGAGGGCAGGGGG + Intronic
1124350016 15:28948340-28948362 ACCAGTGGCCAAAGGGAAGAAGG - Intronic
1124718112 15:32085897-32085919 ACGACTGGCCAGGGAGCAGATGG - Intronic
1126468230 15:48980044-48980066 ACCCCGGGCCAGAGCAGAGATGG - Intergenic
1126549286 15:49909074-49909096 ACCACTGGACAGCGGGGAGAAGG + Intronic
1127960256 15:63885264-63885286 AGCCCTGGGCAGTGGGAAGATGG - Intergenic
1128145589 15:65330837-65330859 GCCCTTGGCCAGAGGCCAGAGGG - Intronic
1128737397 15:70060923-70060945 CCCACAGGCCAGAAGGCAGACGG - Intronic
1128790714 15:70431810-70431832 TCCCCTGGCCTGAAGGCTGAGGG - Intergenic
1129154845 15:73711302-73711324 CCCCCTGGTGAGATGGCAGAGGG + Intronic
1129453105 15:75661687-75661709 AGACTTGGCCAGAGGGAAGATGG + Exonic
1129608783 15:77037525-77037547 ACACCTGGACAGAGGACACAGGG + Intergenic
1129937414 15:79462468-79462490 GCCCCTGGTCAGAGGGGATATGG - Intronic
1130304095 15:82701193-82701215 AACTCTGCCCAGAGGGAAGAGGG - Intronic
1131632733 15:94196219-94196241 ACCCCTGGCTACAGGGGAGGAGG - Intergenic
1131784381 15:95896115-95896137 ACACCAGGCCTGAGGACAGAAGG + Intergenic
1132107273 15:99072043-99072065 AACCCTGTCCAGAGGGGAGTTGG - Intergenic
1132175510 15:99711073-99711095 ATCACTGGTCAGAGGGCAGAAGG - Intronic
1132373971 15:101316259-101316281 ACCCCAGGCCAGAGGGCATGGGG + Intronic
1132464220 16:70342-70364 ACGTCTGGCCAGAGGACAGATGG + Intronic
1132659514 16:1055147-1055169 AGCCCTCGCCACAGGGCAGGAGG + Intergenic
1132764040 16:1525475-1525497 ACACGTGGCCAGGGGGCAGTGGG + Intronic
1133025827 16:2988597-2988619 TCCCCAGGCCAGGAGGCAGAAGG - Intergenic
1133097033 16:3454342-3454364 ACCCATGGCCAGAGGGTGAAAGG + Intronic
1134063439 16:11212381-11212403 CGCACTGCCCAGAGGGCAGAAGG + Intergenic
1134649713 16:15898833-15898855 ACCCCTGGCTCGAGGGGAGGCGG + Intergenic
1135137770 16:19897531-19897553 ACCCCCATACAGAGGGCAGAGGG - Intergenic
1136081119 16:27853219-27853241 CCCCCAGGGCAGAGGGCACAGGG - Intronic
1136611790 16:31371065-31371087 TCCGCTGGCCAGAGGAGAGAAGG - Exonic
1137031770 16:35531403-35531425 GCCCGTGGGCAGAGGGCAGGAGG - Intergenic
1137718157 16:50611479-50611501 ACGCCAGGCCAGTGGGGAGAGGG - Intronic
1138024476 16:53511888-53511910 ACACATGGACAGAGGGCAGCAGG + Intergenic
1139446557 16:67001777-67001799 AGCCTTGCCCAGGGGGCAGATGG - Intronic
1139551414 16:67675120-67675142 GCTCCTTGCCACAGGGCAGAGGG - Exonic
1140330327 16:74050073-74050095 AGCCCTGTCCTGAGAGCAGAAGG - Intergenic
1141723170 16:85768113-85768135 ACACCTGGGCAGAGGGAAGCAGG - Intergenic
1142120451 16:88383996-88384018 CACCCTGGGCCGAGGGCAGAGGG + Intergenic
1142754787 17:2009771-2009793 ACCCCTGGCCAAGTGGCTGATGG + Intronic
1143003934 17:3814573-3814595 ACCCCTGCCCCGAGGACACAGGG + Intronic
1143367033 17:6415143-6415165 CTCCCTGGCCAGAGGGCACTAGG + Intronic
1143863673 17:9908875-9908897 GCTCCAGGCCAGAGGGCAGGAGG - Intergenic
1143904937 17:10200379-10200401 GCCCATGGCCAGAGAACAGATGG - Intergenic
1144018715 17:11221383-11221405 AGCCTGGGCCAGGGGGCAGATGG - Intergenic
1144460377 17:15453919-15453941 AGCACTGGGCAGAGGGCACAGGG + Intronic
1144642501 17:16945281-16945303 CCCCCTTGCCAGAGGGCACTGGG - Intronic
1145245219 17:21264689-21264711 AGCTCTGGGCAGAAGGCAGATGG - Intergenic
1146918983 17:36697183-36697205 ACCCCTTGCCAGAGTGGAGCTGG - Intergenic
1147421277 17:40323283-40323305 AACCCCGGCCAGAGGGGACAAGG - Intronic
1147741839 17:42674468-42674490 AGCCCTGTCCTGAGGGCAGAAGG - Intronic
1148243089 17:46012781-46012803 CACCCAGGCCAGAGGGAAGAGGG + Intronic
1148589463 17:48804988-48805010 GCCCCTAGAGAGAGGGCAGAGGG + Exonic
1149392065 17:56202084-56202106 ACCCTTTTCCAGAGGCCAGAAGG + Intronic
1149546655 17:57508870-57508892 ACCCATGGTCAGAGGCCACAAGG + Intronic
1149568086 17:57653451-57653473 GACACTGGCCAGAGGGCAGGTGG - Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150584519 17:66505317-66505339 ACCTCTGGCCACAGGGAAGAGGG + Intronic
1151570776 17:74924340-74924362 GCCCCGGGCCGGAGGGCAGTCGG + Intronic
1151659257 17:75509999-75510021 GACCCTGGCAGGAGGGCAGAGGG + Intronic
1151683105 17:75631956-75631978 TCCCATTGCCAGAGGACAGAGGG - Intronic
1151842359 17:76627354-76627376 AGGCCGGGGCAGAGGGCAGAGGG - Intronic
1152228715 17:79104278-79104300 ACCCCTGGCCATGGAGCAGCTGG + Intronic
1152685057 17:81689864-81689886 AGCCCTGGCCAGAGAGCAGAGGG + Intronic
1153276617 18:3374011-3374033 ACCCCTGGACAGCAGGCAGCAGG - Intergenic
1153311400 18:3680352-3680374 GCCACAGGCCTGAGGGCAGAAGG + Intronic
1153580538 18:6569183-6569205 ACCCCTGGTCATAGGTCACAGGG - Intronic
1153944784 18:10009140-10009162 AGTCCAGACCAGAGGGCAGAGGG - Intergenic
1154356817 18:13627837-13627859 AGCGGTGGCCAGAGGGCAGACGG + Intronic
1154468596 18:14674654-14674676 ACCCCTGACCAGATATCAGAAGG + Intergenic
1155921471 18:31607584-31607606 AACCCAGGTCAGAGAGCAGAGGG + Intergenic
1156466042 18:37348387-37348409 ATCCCTGGCCGGAGGGAGGAAGG - Intronic
1157424364 18:47572103-47572125 GGCCCTGGCCAGGGAGCAGAAGG - Intergenic
1159057624 18:63481878-63481900 GCCCCTGCCCTGAGGGGAGAAGG + Intronic
1159799720 18:72883183-72883205 ACCCCTGGACAGAGAGGAAATGG - Intergenic
1160492942 18:79353156-79353178 ACTGCTGGCGAGAGTGCAGATGG + Intronic
1160754770 19:751489-751511 CCCCATGGTCAGAGGCCAGAGGG + Intronic
1160807458 19:998696-998718 ACACCTGGCCAGGGGGCTGGAGG + Intergenic
1161136791 19:2624782-2624804 ACCCCCAGGCAGAGGGCAGGCGG + Intronic
1161197979 19:2997718-2997740 GCCGTTGGCCAGAGAGCAGATGG + Exonic
1161398907 19:4059074-4059096 GCCCAGGGCCAGACGGCAGATGG - Intronic
1162069573 19:8145750-8145772 AACCCTGGGCAGTGGGCAGGTGG + Intronic
1162306520 19:9877744-9877766 TCCCATGGCCAAAGGGCTGAAGG - Intronic
1162459842 19:10808210-10808232 ACCCCTGCCCAATGGGGAGAAGG - Intronic
1162680101 19:12334020-12334042 TCCCCTGGCCTCAGAGCAGAGGG + Intergenic
1162809553 19:13155733-13155755 CCCCGTGGCCACAGGGTAGAAGG + Intergenic
1162958353 19:14112299-14112321 CTCCCTGGCCAGGGGGCAGAAGG - Intronic
1163831615 19:19549782-19549804 ACCCCTGGGCCGAGGGTGGAGGG + Intergenic
1164462080 19:28457531-28457553 ACCAGAAGCCAGAGGGCAGAGGG + Intergenic
1164907233 19:31977414-31977436 GACCAGGGCCAGAGGGCAGAGGG - Intergenic
1165818422 19:38658136-38658158 ACTCCTGCCCCGAGGACAGAGGG - Intronic
1166316374 19:41992096-41992118 ACTCCTGGTCTGAGGGAAGAGGG + Intronic
1166568894 19:43781002-43781024 ACCACTCCCCAGAGGGCACAGGG - Exonic
1167575916 19:50317302-50317324 ACCCCAGGCCACAGAGCACAAGG - Intronic
1168253348 19:55153947-55153969 ACCCTAGGCCTGAGGGCAGATGG - Intronic
1168345600 19:55648881-55648903 ACCCCTGGTCTGAGGGAGGAGGG - Exonic
925012407 2:495917-495939 TCCCCAGGCTGGAGGGCAGAAGG + Intergenic
925071703 2:974316-974338 ACCCCAAGCCTGGGGGCAGAAGG + Intronic
925449596 2:3957230-3957252 AGCCCTGCCCTGAGGGCAGGTGG - Intergenic
926317247 2:11719659-11719681 ACCCCAGGGCAGATGCCAGACGG - Intronic
926777257 2:16434862-16434884 AGCCCAGGTCACAGGGCAGAGGG + Intergenic
927150591 2:20193158-20193180 GCCCAGGGCCAGAGGGCAGGAGG - Intergenic
927776372 2:25906990-25907012 ACCCCATGGCAGAAGGCAGAAGG - Intergenic
927841874 2:26449977-26449999 ACCCCTGGGGAGAAGGAAGAAGG - Exonic
927948193 2:27149916-27149938 AGGCCTGGCCAGGGGTCAGATGG - Intronic
928347717 2:30516617-30516639 ACCCCAGGTCAGAGAGCAAAAGG + Intronic
928440153 2:31285387-31285409 ACCCCAGGTCAGAGAGCAAAAGG + Intergenic
928944631 2:36761342-36761364 ATCCCAGGCCAGTGGACAGAAGG - Intronic
929452114 2:42044979-42045001 ATCCTTGGGAAGAGGGCAGATGG - Intergenic
931563332 2:63588171-63588193 AGCCCTGGCCCGAGGGCAAGGGG - Intronic
931760311 2:65410931-65410953 ACCCCTGTCCCGATGGCAGTTGG - Intronic
931828490 2:66026193-66026215 ACCCCTCCCAAGAGGGCAAACGG - Intergenic
932206980 2:69892004-69892026 ACCCCAGCCCTGAGGGGAGAAGG + Intergenic
932572961 2:72947548-72947570 AACCCTGGGAAGTGGGCAGAAGG + Intronic
932721718 2:74143531-74143553 AGTCCTGGACAGAGTGCAGAAGG - Intronic
935398675 2:102637729-102637751 ACCCCTGGCCCGTGAGGAGATGG + Intronic
936140068 2:109931867-109931889 TCCCCATGCCAGAGGGAAGAGGG + Intergenic
936176757 2:110229812-110229834 TCCCCATGCCAGAGGGAAGAGGG + Intergenic
936204628 2:110439619-110439641 TCCCCATGCCAGAGGGAAGAGGG - Intronic
936632445 2:114218178-114218200 ACCCAAGGACAGAGGTCAGAAGG - Intergenic
936922094 2:117699435-117699457 ACCCCTGACCAGATTCCAGAGGG + Intergenic
937111153 2:119367758-119367780 AGCCCTGGCCTGAGGACAGACGG - Intronic
937631425 2:124106412-124106434 ACCTCTGGGCAGAGGAAAGAGGG + Intronic
937912643 2:127082876-127082898 AGCCCTGACGAGAGAGCAGAGGG + Intronic
938236497 2:129710389-129710411 AGACATGGCCAGAGGGCAGAGGG + Intergenic
938746879 2:134287625-134287647 GCCCCTGGGCAGAAGGCTGAAGG - Intronic
941501572 2:166284901-166284923 CCCACTGGCCTGAGGGCAGGTGG + Intronic
942432406 2:175926389-175926411 ATCCCATGCCAGAAGGCAGAAGG - Exonic
942555833 2:177171469-177171491 ACCCCTGGCAAGATACCAGAAGG - Intergenic
943658732 2:190535001-190535023 ACCCCTGCGCCGAGGGCAGCGGG - Intergenic
945969080 2:216218778-216218800 TCCCTTTGCCAGTGGGCAGAAGG - Intergenic
947166258 2:227264865-227264887 ACCCCTGGACAGAGTGTAGCAGG - Intronic
947390578 2:229635259-229635281 GACCCTGGCCAGAGGGCTGGAGG - Intronic
947740083 2:232480974-232480996 ACCCCAGGCCAGAGCTCAGCAGG + Intronic
948156708 2:235788952-235788974 ACCCTGGGCTAGAGGGCAGCAGG - Intronic
948421865 2:237864840-237864862 AGCACAGTCCAGAGGGCAGAGGG + Intronic
948592243 2:239058553-239058575 AAACCTGGCCAAAGGGCAGCTGG + Intronic
948596516 2:239082861-239082883 GCCCCGGGCCACAGGGCAGGTGG + Intronic
948764062 2:240210546-240210568 ATCCCAGGGCTGAGGGCAGAAGG + Intergenic
948860599 2:240750948-240750970 ACCCCTGGGAAGTGGGCAGGAGG - Intronic
1169150821 20:3288013-3288035 ACCCCTTGCCATAGGGAAAATGG + Intronic
1169793138 20:9432788-9432810 ACCAGTGACCACAGGGCAGAAGG + Intronic
1169912622 20:10659663-10659685 TCCTCTGCCCAGAAGGCAGATGG + Intronic
1171012729 20:21517318-21517340 TCCCCTGGCCTGGGGGCAGCTGG + Intergenic
1172500898 20:35426389-35426411 TCCCATGGGCAAAGGGCAGAAGG - Intergenic
1172620250 20:36313825-36313847 ACCCCAGGCAAGAGGCCAGCTGG + Intronic
1172621823 20:36322352-36322374 AACCCTGACCACAGTGCAGAAGG - Intronic
1173098462 20:40061023-40061045 AGCCATGGCCAGAGGGAATAAGG + Intergenic
1173750260 20:45470512-45470534 ACCATTGGGCAGAGAGCAGAAGG - Exonic
1174360800 20:50027915-50027937 ACCCCTGGCCGGAGCCCAGCTGG + Intergenic
1175367846 20:58467713-58467735 AGCCCAGCCCAGAGGGGAGAGGG - Intronic
1179899672 21:44382941-44382963 AACCCTGGCCAGAGGGCAGCTGG + Intronic
1181491313 22:23262489-23262511 CCCCATGGCCAGAGAGCAGGAGG + Intronic
1181914581 22:26269376-26269398 ACCCCCTGCCAGAGAGCAGTGGG - Intronic
1182080667 22:27526596-27526618 ACTCATGGCCAGCGGGCAGAAGG + Intergenic
1182241867 22:28922672-28922694 ACCCAAGGCCAGAACGCAGAGGG - Intronic
1182294153 22:29303365-29303387 CCCTCTGGCCAAAGGCCAGAAGG + Intergenic
1182549363 22:31092671-31092693 ATCCCTTGTCAGAGGGCAGCTGG - Intronic
1182560429 22:31154917-31154939 GACCCTCTCCAGAGGGCAGAGGG - Intergenic
1183508925 22:38223800-38223822 GCCTCTGGCCACTGGGCAGAAGG - Intronic
1183784564 22:40021969-40021991 GCACCAGGCCAGAGGGAAGAGGG - Intronic
1184231982 22:43163267-43163289 ACCCCTGGCCACAGGGAAGAGGG + Intergenic
1184467414 22:44677013-44677035 TCACATGGCCAAAGGGCAGAGGG - Intronic
1184743047 22:46440148-46440170 ACTCCTGGTCTGAGGGCGGATGG - Intronic
1184769558 22:46589417-46589439 TCACGTGGCCCGAGGGCAGATGG + Intronic
949965883 3:9355867-9355889 ACCCCACGGCAGAAGGCAGAAGG + Intronic
950421993 3:12904746-12904768 AACCAGGGCCAGAGGGGAGATGG + Intronic
951909172 3:27731262-27731284 ACCCCCCGGCAGAGCGCAGAGGG + Intergenic
953406000 3:42660087-42660109 ACCCTTGGCCAGAGGGACAAAGG + Intronic
953571689 3:44076443-44076465 ACTCCTGGCAAGAGGGGAGCGGG - Intergenic
953912511 3:46900087-46900109 ACAACTGGCCAGACTGCAGAGGG + Intronic
955032118 3:55231859-55231881 AACCCGGTCCAGAGGACAGAAGG - Intergenic
955181055 3:56670387-56670409 ACTCCAGCCTAGAGGGCAGAGGG - Intronic
955531052 3:59873518-59873540 ACCCTTGGCTAGAGGACAGATGG - Intronic
958716404 3:97787766-97787788 GCTCCTAACCAGAGGGCAGATGG + Intronic
960619506 3:119625080-119625102 GAGACTGGCCAGAGGGCAGAAGG - Intronic
960969366 3:123128545-123128567 CACCCAGGCCAGAGTGCAGAGGG + Intronic
961509262 3:127391113-127391135 CCCCCTGGCCAGTGGGGAGGAGG + Intergenic
962342939 3:134600612-134600634 CCCCCAGGCCACAGGGCAGAAGG - Intronic
964642000 3:158918348-158918370 ACACTTAGCCACAGGGCAGAGGG - Intergenic
966971668 3:185050530-185050552 ACCCTTTGCCAGAGGTCGGAGGG + Intronic
968626798 4:1629458-1629480 AGGCCTGGCCAGGGGGCAGTAGG + Intronic
969231423 4:5834448-5834470 ATCCCATGGCAGAGGGCAGAAGG - Intronic
969479062 4:7437480-7437502 ACCCCTTCCCAGAGGCCAGGGGG + Intronic
969661962 4:8535595-8535617 AACCCAGGCCCCAGGGCAGAGGG - Intergenic
970222016 4:13821288-13821310 ACCCCTGGGCAGAGGGGAGAAGG - Intergenic
973872686 4:55182072-55182094 ACCCCTGACCAGAAAGGAGATGG - Intergenic
974474828 4:62365343-62365365 AACCTTGGCCAGAAGGAAGATGG + Intergenic
975170527 4:71227448-71227470 ACCACTGGTGAGAAGGCAGATGG + Intronic
975418772 4:74138385-74138407 ACCCCAGGTCAGAGGACAAAAGG - Intronic
975965078 4:79963567-79963589 AGCAATGGCCAAAGGGCAGATGG - Intronic
976515180 4:85956497-85956519 ACCCCAGGTCAGAGAGCACAAGG - Intronic
976913865 4:90344726-90344748 ATACCTGGCATGAGGGCAGATGG - Intronic
978835584 4:113145806-113145828 AGCCCTGGACAGAGTGCAGAGGG + Intronic
982395330 4:154909797-154909819 AACCCTGGGCAGAAGGCAAAGGG + Intergenic
983646173 4:169993671-169993693 CCCCCTGGCCAGTGGGCAGGAGG - Intronic
985791026 5:1926807-1926829 ACCCCTGGCCATGGGGGAGGAGG - Intergenic
986351518 5:6884734-6884756 ACACCTTGTCAGAGGGCAGATGG + Intergenic
986773625 5:10994812-10994834 TCCCCTGGACAGAGGAGAGATGG + Intronic
987340610 5:16936147-16936169 GCCCCCGGCCGGAGCGCAGAGGG - Exonic
988257251 5:28836541-28836563 ACCCCATGGCAGAAGGCAGAAGG + Intergenic
989277393 5:39605335-39605357 ATCCCAGGGCAGAAGGCAGAAGG + Intergenic
990113985 5:52366196-52366218 ACCTGTGGTCAGAGGGCACAGGG + Intergenic
990297098 5:54413162-54413184 AGCCCTGGCAAGAGATCAGAGGG - Intergenic
990891858 5:60659164-60659186 ACCCCTGGTCAGAGAACAAAAGG + Intronic
992907330 5:81359155-81359177 ACCACTGCCAAGAGGGCAGAAGG - Intronic
993605637 5:89987557-89987579 CACCTTGGGCAGAGGGCAGAGGG + Intergenic
995632644 5:114150565-114150587 ACCCCTGGCCAGTGGACCAAAGG - Intergenic
995704802 5:114977186-114977208 ATTCCAGGGCAGAGGGCAGAGGG + Intergenic
999343286 5:150792287-150792309 TTCCCTGCCCAGAGGGCACAAGG - Intronic
1001399739 5:171439382-171439404 ACAGCTGGCCAGAGGGCTGGAGG + Intronic
1002133672 5:177095883-177095905 ACCCTTCCCCAGAGGGGAGAGGG + Intronic
1002311897 5:178319982-178320004 AGCCCTGGACAGAGGGAAGCTGG - Intronic
1002313382 5:178328138-178328160 ACCCTTGGCCAAAGGGCAGAGGG - Intronic
1002334733 5:178469859-178469881 TCCCCTGTGCAGAGGCCAGAAGG + Intronic
1002427892 5:179186556-179186578 AGCCCTGGCCAGAGGCCTGCAGG + Intronic
1002647807 5:180669817-180669839 TGCCCTGACCACAGGGCAGATGG - Intergenic
1002810443 6:623072-623094 GCCCCTGGCCAGAAAGCAGTGGG + Intronic
1003154984 6:3585707-3585729 TCCCCTGACCAGAGTGCTGATGG + Intergenic
1003258164 6:4491878-4491900 ACCCCTGGGCTGAGGGCAAGTGG + Intergenic
1004545430 6:16593577-16593599 ACCCCTGGAGAGAAGGCAGGAGG - Intronic
1006406501 6:33848757-33848779 ACAAATGGCCAGATGGCAGAGGG - Intergenic
1006945308 6:37780491-37780513 CCCCCAGGCCAGAGGCCAAATGG + Intergenic
1007177195 6:39905090-39905112 ACACCTTGGCATAGGGCAGAGGG + Exonic
1007382544 6:41500005-41500027 AGCCCAGGCAAGAGGACAGATGG + Intergenic
1011617375 6:89209572-89209594 TCCCCAGGCGAGAGGGCAGGAGG - Intronic
1011653209 6:89526067-89526089 ACCCATGGGCAGAGGGTAGAGGG - Intronic
1013389265 6:109666776-109666798 CAGCCTGGCCAGAGGTCAGATGG - Intronic
1013479652 6:110543016-110543038 ACCCCTGGCCTGAGGGTGAAGGG + Intergenic
1013529421 6:111005237-111005259 ACCTCTGGTCCTAGGGCAGAGGG + Intronic
1014747110 6:125213545-125213567 AGCCCTGGCCAGAGGACAAATGG - Intronic
1016369568 6:143358341-143358363 ACCACTAGCCAGAGTGAAGAGGG + Intergenic
1016510012 6:144831783-144831805 ACCCAAGGGCAGATGGCAGATGG - Intronic
1017005752 6:150027216-150027238 ACCTGTGGGCAGAAGGCAGAGGG + Intergenic
1017805433 6:157941634-157941656 TCCCATGGCCAGAGGGGAGCTGG - Intronic
1018893226 6:167996861-167996883 CGGCCTGGCCGGAGGGCAGAGGG + Intronic
1019074316 6:169375385-169375407 ACCCAAGGGCAGAAGGCAGAGGG + Intergenic
1019699249 7:2465698-2465720 TCCACTGACCAGAGGGTAGATGG - Intergenic
1020052203 7:5089101-5089123 CTCCCAGGCCTGAGGGCAGAAGG - Intergenic
1022547393 7:31201688-31201710 AGGCCAGGGCAGAGGGCAGAGGG + Intergenic
1023995359 7:45156252-45156274 ACCCCTGGCCTGTGGGCAGAAGG + Intergenic
1026450705 7:70526722-70526744 ATCACAGGCCAGGGGGCAGAGGG - Intronic
1026518778 7:71096796-71096818 ACCACAGTCCAGAGGCCAGAAGG - Intergenic
1029035237 7:97513064-97513086 GCCCCTGACAAGGGGGCAGAAGG + Intergenic
1029503074 7:100945844-100945866 ACGCCTGCCCAGAAGGGAGAGGG - Intergenic
1030089862 7:105849159-105849181 ACCACTGGCCTGAGAGGAGATGG + Intronic
1030287046 7:107837472-107837494 AGCCCTGGACATGGGGCAGAGGG - Intergenic
1031537705 7:122955812-122955834 TCCCCTGGCCAAAAGGCAGGAGG - Intergenic
1032293529 7:130613114-130613136 TCCCATGGACAGAGGGCAGAGGG + Intronic
1032536222 7:132666904-132666926 AGGCCTGGCCAGAGGGCTGAGGG - Intronic
1033278285 7:139988807-139988829 AGTCCAGGCCAGAGGGCAAAAGG + Intronic
1033410630 7:141114577-141114599 TCACCTGCCCAAAGGGCAGAAGG - Intronic
1034285351 7:149880207-149880229 GCCCAGGGCCAGGGGGCAGAGGG - Exonic
1034401382 7:150863921-150863943 ACCCCTAACAAGATGGCAGAAGG + Intergenic
1034492979 7:151404273-151404295 GCCACAGGGCAGAGGGCAGAGGG - Intronic
1035171865 7:157021554-157021576 CCGCCTGGCCCGAGGGAAGAGGG + Intergenic
1035287697 7:157816753-157816775 ACGCCAGGGCAGAGGGCAGAGGG - Intronic
1035354728 7:158270270-158270292 AGTCATGGCCAGAAGGCAGAAGG + Intronic
1035428270 7:158796968-158796990 ACCACAGGCGAGAGGGCAGCAGG + Intronic
1037599474 8:20381781-20381803 ACAGCTGGCCAGAGGGGACAGGG - Intergenic
1037924873 8:22836330-22836352 CCCCCTGCTCAGAGGGTAGAGGG + Intronic
1037934729 8:22907855-22907877 GACCCTGGCCAGAGTGCTGATGG + Intronic
1038444884 8:27596405-27596427 ACCCCAGGCCACTGTGCAGAGGG + Intergenic
1038563585 8:28601088-28601110 ACCCCTGGCTACTAGGCAGAGGG + Intronic
1041252279 8:55946077-55946099 AGCCCCGGGCAGAGGGCAGAGGG - Intronic
1042062558 8:64836926-64836948 ACCCCTGACCAGAGGTAACAAGG - Intergenic
1042680823 8:71381149-71381171 ACCCCAGGCCAGAGTGAAAAAGG - Intergenic
1045399153 8:101794145-101794167 ACACCTTGCCACAGGGTAGATGG + Intronic
1045980519 8:108181713-108181735 CACCCTGGCCAGAGTGCAGTGGG + Intergenic
1046212641 8:111098207-111098229 TCCCCAGGCTAGAGGGGAGATGG - Intergenic
1048389152 8:133944772-133944794 ACCTCTGGAGAGAGGGCTGAGGG + Intergenic
1049213672 8:141398110-141398132 AGCCCTGGGCAGAAGGCACAGGG - Intronic
1049220904 8:141428375-141428397 CCCCCTGGGCAGTGGGCAGATGG - Intronic
1049425005 8:142534046-142534068 CCCCCTGGAGAGACGGCAGAGGG + Intronic
1049599261 8:143499403-143499425 ACCCAGGGCCAGAGCACAGAGGG - Intronic
1049928538 9:433276-433298 AGCCCTGGCAAGCTGGCAGAGGG + Intronic
1052634872 9:31089724-31089746 ACCACTGTCCTGAGTGCAGAGGG - Intergenic
1052862088 9:33443455-33443477 GCCCCTGGGCAGAGGGGACAAGG + Exonic
1053142037 9:35688551-35688573 ATGCCAGGCCACAGGGCAGAGGG - Intronic
1057204872 9:93165277-93165299 CCCCCTGGCCAGAGGGATCATGG - Intergenic
1057259094 9:93574366-93574388 CTCCCTGGTGAGAGGGCAGAGGG - Intergenic
1058766250 9:108185298-108185320 AGCCCAGGCCACAGGGCAGGAGG + Intergenic
1059283315 9:113152534-113152556 TGCCCTGGCCAGAGAGCAGTTGG - Intronic
1059404964 9:114093835-114093857 GCCTCTGGACAGAGGGCAGCTGG - Intronic
1060398236 9:123331460-123331482 AACCCTGCTCAGAGGTCAGACGG + Intergenic
1060488137 9:124062556-124062578 ACCCTTTCCCAGAGGGCAGTGGG - Intergenic
1061040380 9:128138242-128138264 AGCACAGCCCAGAGGGCAGAGGG + Intergenic
1061798354 9:133101338-133101360 AAGGCTGGCCTGAGGGCAGAGGG - Intronic
1061798451 9:133101809-133101831 ACCCCAGGCCAGCTGCCAGATGG + Intronic
1061882872 9:133576794-133576816 ACCCCTGGACAGAGGGTTGTGGG - Intergenic
1062364917 9:136203924-136203946 ACCCCTGCCCAGAGGGCCCTGGG + Intronic
1062469073 9:136694425-136694447 GCGCCAGGCCACAGGGCAGAGGG + Intergenic
1062725683 9:138072159-138072181 ATCCATGGCCAGTGGGCACAAGG - Intronic
1185779140 X:2829870-2829892 GCCCCTGGCCAGAGGGCACGAGG + Intronic
1186517499 X:10176832-10176854 ACTGCTGGGCAGAGGACAGAGGG + Intronic
1188019853 X:25145165-25145187 ACCCCTGTGCAGCGGGTAGAGGG - Intergenic
1189244610 X:39553872-39553894 ATCCCATGGCAGAGGGCAGAAGG - Intergenic
1189268647 X:39735439-39735461 ACCACTGGCCAGAAAGAAGAAGG + Intergenic
1189630512 X:42947735-42947757 ACCCCTGACCAGATACCAGAGGG + Intergenic
1192093095 X:68181947-68181969 AACTCTGGCCAGAGGCTAGATGG + Intronic
1194585787 X:95732515-95732537 ACACCTGCGGAGAGGGCAGATGG - Intergenic
1195243715 X:102978103-102978125 ACCCCAGGCCAGAGAACAAAAGG + Intergenic
1195394616 X:104397595-104397617 CACCCTGACCATAGGGCAGAAGG - Intergenic
1196407244 X:115377417-115377439 ACCCATAGCCTGAAGGCAGATGG - Intergenic
1200237099 X:154472925-154472947 ACACCTGGGCACAGGGCAGGAGG - Exonic
1201290906 Y:12420623-12420645 GCCCCTGGCCAGAGGGCACGAGG - Intergenic
1201724303 Y:17136442-17136464 ACCCCAGGCCAGAGGACAAAAGG - Intergenic