ID: 1081869962

View in Genome Browser
Species Human (GRCh38)
Location 11:46378939-46378961
Sequence GAAGGAGGGGTGGCCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 519
Summary {0: 1, 1: 1, 2: 7, 3: 45, 4: 465}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081869951_1081869962 7 Left 1081869951 11:46378909-46378931 CCCGGCTGTGGGCCAGCGTGTGA 0: 1
1: 0
2: 1
3: 10
4: 271
Right 1081869962 11:46378939-46378961 GAAGGAGGGGTGGCCCCAGGAGG 0: 1
1: 1
2: 7
3: 45
4: 465
1081869948_1081869962 21 Left 1081869948 11:46378895-46378917 CCTGTGCTGGTGTACCCGGCTGT 0: 1
1: 0
2: 0
3: 12
4: 85
Right 1081869962 11:46378939-46378961 GAAGGAGGGGTGGCCCCAGGAGG 0: 1
1: 1
2: 7
3: 45
4: 465
1081869952_1081869962 6 Left 1081869952 11:46378910-46378932 CCGGCTGTGGGCCAGCGTGTGAG 0: 1
1: 0
2: 0
3: 11
4: 170
Right 1081869962 11:46378939-46378961 GAAGGAGGGGTGGCCCCAGGAGG 0: 1
1: 1
2: 7
3: 45
4: 465
1081869955_1081869962 -5 Left 1081869955 11:46378921-46378943 CCAGCGTGTGAGCTCAGGGAAGG 0: 1
1: 0
2: 1
3: 13
4: 203
Right 1081869962 11:46378939-46378961 GAAGGAGGGGTGGCCCCAGGAGG 0: 1
1: 1
2: 7
3: 45
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081869962 Original CRISPR GAAGGAGGGGTGGCCCCAGG AGG Intronic
900339368 1:2180815-2180837 GATGCAGGGCTGGGCCCAGGAGG - Intronic
900639648 1:3682522-3682544 GCAGGAGGGGTGGCCCCGGGAGG + Intronic
901130996 1:6962574-6962596 AAAGGAGGGGTGGGGCCAGGTGG - Intronic
901131014 1:6962621-6962643 GAAAGAGGGGTGGGTCCAGAGGG - Intronic
901131264 1:6963361-6963383 GAAAGAGGGGTGGCTCCAGAGGG - Intronic
901188048 1:7387578-7387600 GAAGCACGAGAGGCCCCAGGAGG - Intronic
901741189 1:11343040-11343062 GCAGGAGGGGAGGAGCCAGGAGG + Intergenic
901920339 1:12531687-12531709 CCAGGAGGGGTGGGTCCAGGAGG - Intergenic
902334320 1:15746473-15746495 GAAGGTGGTTTGGGCCCAGGTGG + Intronic
903239733 1:21974820-21974842 GAAGGAGGGAGGGGCCCAGGAGG - Intergenic
903243539 1:21999750-21999772 GAAGGAGGGAGGGGCCCAGGAGG - Intergenic
903648426 1:24908808-24908830 CAATGGGAGGTGGCCCCAGGAGG + Intronic
903796292 1:25931298-25931320 GAAGGAGTGGTTCCCCCAAGTGG - Intergenic
904042461 1:27592645-27592667 GAAGGAGGGGGCTCCCCAGCTGG + Intronic
904319808 1:29689491-29689513 GGGGGAGGGGAGGCCCCAGCAGG - Intergenic
904378339 1:30095512-30095534 GAAGCAGGGGTGGGCCAGGGAGG + Intergenic
904559275 1:31385888-31385910 GGAGAAAGTGTGGCCCCAGGAGG - Intergenic
905389993 1:37630216-37630238 GAAGCAGGGGTGGGACCAGCTGG - Intronic
905457797 1:38100502-38100524 AAGGAAGGGGTGGACCCAGGAGG - Intergenic
905687943 1:39922264-39922286 GAAGGAGGGGCGGGACTAGGAGG + Intergenic
906041706 1:42792947-42792969 GACGAAGGGGTGACCCCAGATGG - Intronic
906277369 1:44526575-44526597 GGAGGAGTGATGGGCCCAGGTGG - Intronic
906556498 1:46718621-46718643 GCAGGAGAGGTGGCGGCAGGAGG + Exonic
908482744 1:64558339-64558361 GAAGGAGGTGAGGGCCCATGGGG - Intronic
912438918 1:109683358-109683380 GAAGAAGGCCAGGCCCCAGGTGG - Intronic
912441440 1:109701803-109701825 GAAGAAGGCCAGGCCCCAGGTGG - Intronic
913585622 1:120272555-120272577 GAAGGAGAGGTGGCCAGAGAAGG - Intergenic
913622562 1:120625812-120625834 GAAGGAGAGGTGGCCAGAGAAGG + Intergenic
913682519 1:121199940-121199962 TATGGAGGGTAGGCCCCAGGTGG + Intronic
914034362 1:143987569-143987591 TATGGAGGGTAGGCCCCAGGTGG + Intergenic
914155088 1:145080401-145080423 TATGGAGGGTAGGCCCCAGGTGG - Intronic
914567628 1:148884414-148884436 GAAGGAGAGGTGGCCAGAGAAGG - Intronic
914605194 1:149245831-149245853 GAAGGAGAGGTGGCCAGAGAAGG + Intergenic
914987920 1:152475773-152475795 GAAGGAGGGGTTGCCCTAAGAGG + Intergenic
915117487 1:153609823-153609845 GAAGGAAGGGTGGGACCAGGAGG + Intronic
915166597 1:153951488-153951510 GAGTGAGGGGTGGCCCAGGGAGG + Exonic
915558089 1:156670964-156670986 GAAGATGATGTGGCCCCAGGGGG - Exonic
915604252 1:156940809-156940831 GAAGGAGGTGTGGCGTTAGGAGG + Intronic
916162257 1:161929412-161929434 GAAAGAAGGGTGGCCCTAGAAGG - Intronic
916166802 1:161972392-161972414 TGAGGAGCGGAGGCCCCAGGCGG - Intergenic
916745943 1:167684903-167684925 GAGGGAAGGGTGCCCCAAGGTGG + Intronic
916786722 1:168092044-168092066 GAAGGCGGGGTGGTCACAGCAGG + Intronic
917502578 1:175599235-175599257 GGAGGAGCGGTGACCCGAGGTGG - Intronic
919769031 1:201145369-201145391 GCAGGAGGGGCTGCCTCAGGTGG + Intronic
919846628 1:201647084-201647106 CCAGGAGGGGTAGGCCCAGGTGG - Intronic
920469832 1:206218458-206218480 TATGGAGGGTAGGCCCCAGGTGG + Intronic
920849786 1:209620987-209621009 GAGAGAGGCCTGGCCCCAGGGGG - Intronic
921207090 1:212858354-212858376 GTTGGAGGTGGGGCCCCAGGAGG + Exonic
922477176 1:225914615-225914637 GCAGGATGCGTGGCCCCACGTGG - Intronic
922807263 1:228396924-228396946 GTAGGTGTGGAGGCCCCAGGTGG - Intronic
922819870 1:228476834-228476856 CAAGGAGGGATGGCCCTATGAGG + Intergenic
923247220 1:232144331-232144353 GAATGAGGGGTGGGCCCAAAGGG - Intergenic
923661003 1:235957202-235957224 GAAGGAGGGGTGGAAACAGGCGG + Intergenic
1063115005 10:3067147-3067169 GGAGGAGGGGAGACCGCAGGGGG - Intronic
1066489983 10:35884924-35884946 GAAGGAGGCGTGCATCCAGGTGG - Intergenic
1068121075 10:52782513-52782535 GAAGGAGGGCTGGACCCTGTGGG + Intergenic
1068783469 10:60944841-60944863 GCGGGAGGGGTCCCCCCAGGGGG + Intronic
1069848774 10:71391472-71391494 GAAGGGGTGGGGGCCCCACGAGG - Intergenic
1070140705 10:73735049-73735071 GCAGGAGGGGTGGCCCAGGCAGG + Intergenic
1070541597 10:77419133-77419155 TGAGGTGGGGTGGCACCAGGGGG + Intronic
1071288786 10:84173187-84173209 AAAGGAGGTGGGGCCACAGGTGG - Intergenic
1072935608 10:99710123-99710145 GAAGGAGGAGTGGCCACCAGAGG - Intronic
1073234964 10:102006548-102006570 GAAGGCGGTGTGGTCCCAAGTGG + Exonic
1073473783 10:103739880-103739902 GAAGGAGTGGGGGCCTCCGGTGG + Intronic
1075194836 10:120347476-120347498 GAAGGAGGGGCGGAGCAAGGTGG + Intergenic
1075241228 10:120780788-120780810 GAAGGAGGGGCAGGCACAGGTGG + Intergenic
1075715801 10:124554636-124554658 GCTGAAGGGGTGGGCCCAGGTGG + Intronic
1076606957 10:131695390-131695412 GGAGGGGGAGAGGCCCCAGGAGG + Intergenic
1077094885 11:795088-795110 GAGGGAGGGTGGGACCCAGGGGG + Exonic
1077217052 11:1399294-1399316 GATGGTGGGGTGGTGCCAGGGGG + Intronic
1077284804 11:1760889-1760911 GAAGGAGTAGTGGGCACAGGAGG + Intronic
1077290040 11:1784857-1784879 AGAGGATGGGTGGGCCCAGGTGG - Intergenic
1077921865 11:6647351-6647373 GAAGGAGGAGGGGGCTCAGGAGG + Intronic
1078059066 11:8031895-8031917 GAAGGCGAAGTGGCCCGAGGGGG - Intronic
1078462128 11:11522106-11522128 GAAGGAAGGAAGGCCCTAGGAGG + Intronic
1079130596 11:17744787-17744809 GATGGAGGGGTGGCTGCTGGAGG + Intronic
1081205930 11:40275681-40275703 GAAGGTTGGCTGGCCCCAAGTGG + Intronic
1081341497 11:41933492-41933514 GAAGGCGGGGTGTCCACATGCGG - Intergenic
1081620273 11:44615200-44615222 TAAGTAGGGGTGACCACAGGTGG + Intronic
1081633913 11:44708059-44708081 GAAGGAGGCAGGGCCCCAGCTGG - Intergenic
1081702308 11:45159501-45159523 GAAGGAGTTGAGGCCCCAGAGGG + Intronic
1081869962 11:46378939-46378961 GAAGGAGGGGTGGCCCCAGGAGG + Intronic
1082796504 11:57381634-57381656 GAAGTAGGGGTGGTACCTGGTGG - Intergenic
1083244535 11:61416207-61416229 GCAGGTGGGATGGCCCCAGGGGG + Exonic
1083431425 11:62615430-62615452 GAAGGACAGATGGACCCAGGAGG - Exonic
1083614327 11:64018875-64018897 GAAGGCGTGGTGGCTTCAGGCGG + Intronic
1083650758 11:64203245-64203267 GAGGCAGGGGGGGCCCCTGGAGG - Intronic
1083679044 11:64342906-64342928 GAAGGAGGGCTGTTCCCGGGGGG + Intronic
1083717530 11:64586417-64586439 GAAGAAGGGGTTCCCCCAGGAGG - Intergenic
1083751975 11:64765984-64766006 GGAGGGGGAGGGGCCCCAGGCGG + Intronic
1083823169 11:65183678-65183700 GAGGGAGGGCTGGCCCCACAGGG - Intronic
1083966163 11:66045267-66045289 TAAGGGGGCGGGGCCCCAGGGGG - Intronic
1084216378 11:67648928-67648950 CCAGGAGGAGTGGCCCCTGGAGG - Intronic
1084564097 11:69919897-69919919 GAAGGAGGACTCACCCCAGGAGG - Intergenic
1084564176 11:69920199-69920221 GAAGGAGGGGTCACCCTAGGAGG - Intergenic
1084709488 11:70835203-70835225 GGAGGAGGGGTGGAGCCAAGGGG + Intronic
1084733317 11:71088692-71088714 GGATGAGGGGAGGCCCCTGGTGG - Intronic
1084733333 11:71088746-71088768 GGATGAGGGGCGGCCCCTGGTGG - Intronic
1084733392 11:71088962-71088984 GGATGAGGGGAGGCCCCTGGTGG - Intronic
1084733408 11:71089016-71089038 GGACGAGGGGCGGCCCCTGGTGG - Intronic
1085404697 11:76254921-76254943 GAAGGGTGGGTGGCTCCAGATGG + Intergenic
1086455488 11:86955557-86955579 GAGGGAGGGGCGGCCGGAGGAGG - Intergenic
1087289312 11:96302409-96302431 GAAGGAGGGGTGGCTCCCTTGGG - Intronic
1088365983 11:109040498-109040520 GAGCTAGGGGTGGCCACAGGAGG + Intergenic
1089012771 11:115144207-115144229 AGAGCAGGGTTGGCCCCAGGTGG - Intergenic
1091268620 11:134289997-134290019 GAAGGAGAGGGGTCCCCAGCTGG + Intronic
1091971307 12:4789329-4789351 GCAGGATGGGTGGTCCCTGGAGG + Intronic
1092125726 12:6073897-6073919 AAGGGAGGGGTGGCCTCAGGGGG - Intronic
1092128694 12:6093373-6093395 GAAGGTGGAGTGGCCCCTGTTGG - Intronic
1093436352 12:19139271-19139293 GTGGGAGGGGGAGCCCCAGGTGG + Intronic
1095998022 12:48105861-48105883 GGAGGGGAGGTGGTCCCAGGGGG + Intronic
1096181728 12:49554833-49554855 CAGGGAGGGGTGGCTCCTGGGGG + Intronic
1096237538 12:49939931-49939953 GCAGGAGGAGGAGCCCCAGGGGG - Intergenic
1097052099 12:56229917-56229939 GAAGGTGGGGTGTCCCTAGAAGG + Intergenic
1099969504 12:89486378-89486400 GAAGGAAGGGTGGAAGCAGGGGG + Intronic
1101143862 12:101822606-101822628 GAAGGGAGGGTGGCCACAGTGGG - Intronic
1101672545 12:106889497-106889519 GAACTAGGGGTGGCACCAGGAGG + Intergenic
1101679941 12:106955574-106955596 GAAGGCGGGGAGACCCCCGGAGG + Intergenic
1102515241 12:113441832-113441854 GATGGAGGTGAGGCCCCTGGAGG - Intergenic
1102531125 12:113547313-113547335 GAAGGAAGAAAGGCCCCAGGGGG + Intergenic
1103021707 12:117539775-117539797 GAAGGCGGCGTGGCACTAGGAGG + Exonic
1103028252 12:117591690-117591712 TAAGCAGGGGTGGGACCAGGTGG - Intronic
1104386804 12:128357838-128357860 GACGGAGGGGAGGCCTCGGGTGG - Intronic
1104611768 12:130234835-130234857 GAAGGAGGGGCTGACCCAGAAGG + Intergenic
1104781319 12:131422263-131422285 CAGGGAGGGGAGACCCCAGGAGG - Intergenic
1104832725 12:131765096-131765118 GAAGGTGGTGTGTCCCCAGCTGG + Intronic
1104980373 12:132570803-132570825 GGGGGAGGCCTGGCCCCAGGAGG - Intronic
1105770634 13:23608522-23608544 GAAGGAGTGGTGGAGCCACGTGG + Intronic
1105929008 13:25034384-25034406 GGTGGAGAGGAGGCCCCAGGAGG - Intergenic
1107836769 13:44417987-44418009 GAAGCAGAGGTGGCAGCAGGAGG - Intergenic
1107851312 13:44576175-44576197 GAAGGAGGAATCGCGCCAGGCGG - Exonic
1110146859 13:72202578-72202600 GAAGAAGGGATGGGGCCAGGAGG + Intergenic
1112276559 13:98026715-98026737 GCAGGAAGTGTGACCCCAGGGGG - Intergenic
1112441102 13:99425837-99425859 GGAGGAGGGGCGGCCGCGGGAGG + Intergenic
1113491927 13:110699034-110699056 CAAGGAGGGGTGGGGGCAGGGGG + Intronic
1113537114 13:111076626-111076648 GTAGGAGTGGTGGCCACAGATGG + Intergenic
1113637405 13:111929195-111929217 CAAGGAGGGGTGCTCCCTGGGGG + Intergenic
1114529899 14:23389060-23389082 GGAGGGGGGGGGGCACCAGGAGG + Intronic
1115768071 14:36644422-36644444 GTAGGAGGATTGGGCCCAGGAGG - Intergenic
1118339048 14:64879694-64879716 AAAGGAGCGCTGGGCCCAGGGGG - Intronic
1119248990 14:73136381-73136403 GGAGGAGGGGAGGAGCCAGGAGG - Intergenic
1119590643 14:75884352-75884374 GGTGGAGAGGTGGGCCCAGGCGG + Intronic
1121333288 14:93061367-93061389 GAAGGAGTGGTGGGCTCTGGAGG - Intronic
1121505636 14:94474616-94474638 AGAGAAGGGGTGGCCACAGGAGG - Intronic
1121550490 14:94795984-94796006 GAAGGAGGGTTGGAGGCAGGGGG + Intergenic
1121553759 14:94820890-94820912 GCAGGAAGGGTGGCCAAAGGGGG + Intergenic
1122202060 14:100128617-100128639 GGAGGTGGGGTAGCCCCAGTGGG - Exonic
1122369749 14:101222934-101222956 GCAGGAGGACTGTCCCCAGGAGG - Intergenic
1122423118 14:101589797-101589819 GAAATAGGGGAGGCCACAGGTGG + Intergenic
1122873364 14:104651409-104651431 GGAGGTGAGGTGGCTCCAGGAGG - Intergenic
1122895347 14:104753851-104753873 GCAGGAGGAGTCGCCACAGGTGG + Intronic
1202905561 14_GL000194v1_random:69687-69709 AAGGGAGGGGAGGTCCCAGGAGG + Intergenic
1123476838 15:20596801-20596823 GCAGGTGGAGAGGCCCCAGGTGG + Intergenic
1123641173 15:22403563-22403585 GCAGGTGGAGAGGCCCCAGGTGG - Intergenic
1124567314 15:30827855-30827877 GTACGGGGGCTGGCCCCAGGGGG + Intergenic
1125505324 15:40264723-40264745 GAAAGAGGGGTGGCTGCAGCAGG - Intronic
1125733845 15:41909991-41910013 GGAGGAGGGGAGGGTCCAGGGGG + Intronic
1126076753 15:44918876-44918898 GGAGAAGGCGTGACCCCAGGAGG - Intergenic
1127256319 15:57296731-57296753 AGAGGTGGGATGGCCCCAGGGGG - Intronic
1127291387 15:57574300-57574322 GTCGGAGGGGAGGCCCCAGTGGG + Intergenic
1127995136 15:64149565-64149587 CAAGGAAGGGTGCCCCCAGGTGG + Intergenic
1128330050 15:66749805-66749827 CAAGGAGGACTGACCCCAGGTGG + Intronic
1128471529 15:67957686-67957708 GAAGGTGTGTTGGCCCCATGGGG - Intergenic
1128608162 15:69053824-69053846 GAAGCAGGGGGTCCCCCAGGTGG + Intronic
1129171668 15:73811804-73811826 GAAGCAGGGGAGACCCCAAGAGG + Intergenic
1131067100 15:89441533-89441555 TAGGGAGGGGTGGAGCCAGGAGG + Intergenic
1132341236 15:101079604-101079626 GTGGGAGGGAGGGCCCCAGGAGG + Intergenic
1132654574 16:1036505-1036527 GAAGGAGGGGTTCCCCGGGGAGG + Intergenic
1132654598 16:1036565-1036587 GAAGGAGGGGTTCCCCGGGGAGG + Intergenic
1132654619 16:1036625-1036647 GAAGGAGGGGTTCCCCGGGGAGG + Intergenic
1132794495 16:1712750-1712772 GAGGGAGGGGTGGGGGCAGGTGG - Intronic
1132847134 16:2005811-2005833 GGAGCATGGGTGCCCCCAGGCGG - Intronic
1132875259 16:2134309-2134331 TAAGGAAGGGTGGCCACAGGCGG + Intronic
1133339915 16:5029403-5029425 GAAGGAGCTGAGGCCCCAGATGG + Intronic
1133771442 16:8869023-8869045 GGAGGGGGCGTGGCCCGAGGGGG + Intergenic
1134519728 16:14913081-14913103 TAAGGAAGGGTGGCCACAGGCGG - Intronic
1134554203 16:15153154-15153176 TAAGGAAGGGTGGCCACAGGCGG + Intergenic
1134707400 16:16311737-16311759 TAAGGAAGGGTGGCCACAGGCGG - Intergenic
1134960143 16:18400388-18400410 TAAGGAAGGGTGGCCACAGGCGG + Intergenic
1136068269 16:27773123-27773145 GTAGTAGGGGTCGCCCCAGCTGG - Exonic
1136269252 16:29138877-29138899 GGAGGAGGCGTGGGCCCAGGAGG - Intergenic
1136350432 16:29703440-29703462 GAAGGAGGGAAGGCCGGAGGTGG + Intergenic
1137731122 16:50691327-50691349 GATGGAGATGTGGACCCAGGTGG + Intergenic
1138119388 16:54386940-54386962 GAAGGAGGGTTGGAAACAGGAGG - Intergenic
1138349820 16:56340560-56340582 CAAAGAGAGCTGGCCCCAGGTGG - Intronic
1138462005 16:57154677-57154699 GGAGGAAGGGAGGCTCCAGGAGG + Intronic
1138497022 16:57415205-57415227 GGAGCAGGGGTGGAGCCAGGGGG - Intronic
1138550338 16:57744267-57744289 GCAGGAGGGGGAGCCCCATGGGG - Intronic
1138599423 16:58046087-58046109 GAAGGAGGTGTGGGCCCAAGGGG - Exonic
1139423808 16:66866466-66866488 GAAGGAGGCGGAGGCCCAGGTGG + Intronic
1139550207 16:67668610-67668632 GAAGGAGGGGAGCCACCAGTGGG - Exonic
1142051945 16:87964788-87964810 GAAGGAGAGGAGAACCCAGGAGG + Intronic
1142072735 16:88100149-88100171 GGAGGAGGCGTGGGCCCAGGAGG - Intronic
1142128356 16:88421174-88421196 AAAGGAGGGGTGCCCCCACCTGG - Intergenic
1142211734 16:88811692-88811714 GAAGGAGGGCAGGGCCCCGGGGG + Intronic
1142280168 16:89143809-89143831 GACGGATGGGTGTGCCCAGGTGG - Intronic
1142471961 17:169740-169762 GAAGGAGGGCTGGCCTCTGGAGG - Intronic
1143475786 17:7203333-7203355 GATGGAGGGGAGGCCAGAGGTGG + Intronic
1143601053 17:7946267-7946289 GCAGGAGAGGTGGACCCAGGAGG - Intronic
1143628080 17:8122292-8122314 GAGGGAGGGGGGACGCCAGGAGG - Intronic
1144739130 17:17571481-17571503 GAGGGAGGGGTGGGAGCAGGTGG + Intronic
1145941637 17:28745926-28745948 GAAAGAGGGGTGGGCCCAGGGGG - Intronic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1147579975 17:41622721-41622743 GAAGGAGGGGAGGCGGGAGGCGG - Intronic
1148340090 17:46868118-46868140 GATAGAGTGGTGGCCCCAGGAGG + Intronic
1148438942 17:47701900-47701922 GAAGGAGGGGAGGAGCCAGGAGG - Intronic
1148648151 17:49230869-49230891 GAGGGAGGCGTGGCCTCGGGCGG - Intergenic
1148756628 17:49976525-49976547 GAAGGAGAGGGGGCCAGAGGGGG - Intergenic
1148765865 17:50037863-50037885 CAGGGAGGGGTGGCCAGAGGAGG - Intergenic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150002873 17:61452336-61452358 GGAGGGGGGGCGGCCCCAGAGGG + Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1151292598 17:73161385-73161407 GAAGAAGAGGTAGCCCCATGTGG + Intergenic
1151703949 17:75757139-75757161 GAAGGAGGCACGGCCCGAGGAGG - Intronic
1151786588 17:76278211-76278233 GAGGGAGGGTTGGCCCATGGCGG + Intronic
1151819134 17:76487917-76487939 AAAGGAGGGCCGGCTCCAGGGGG + Intronic
1151957164 17:77386223-77386245 GCAGGAGGGGTGGGGGCAGGAGG - Intronic
1151959622 17:77398791-77398813 GATGGTGGGGTGGCCCCTGCGGG + Intronic
1152281693 17:79388737-79388759 GCAGGAGGGGTGGCTGGAGGCGG - Intronic
1152383016 17:79951970-79951992 GAAGGAGGTCTGTTCCCAGGAGG - Intronic
1152466069 17:80466760-80466782 GGAAGAGGGGTGGCTGCAGGGGG + Intergenic
1152595542 17:81236062-81236084 GAGGGAGGCCTGGCTCCAGGTGG - Intronic
1152612736 17:81323542-81323564 GAGGATGGGGAGGCCCCAGGAGG + Intronic
1152632791 17:81418043-81418065 GGAGGTTTGGTGGCCCCAGGGGG + Intronic
1152741006 17:82018297-82018319 GCAGGGGGCGTGGCCCGAGGGGG + Intergenic
1152867953 17:82735514-82735536 GCGGGAGGGGCGGCCTCAGGCGG - Intergenic
1152894473 17:82902881-82902903 GAAGGAGGGGTGGGCTCAGGAGG + Intronic
1155300775 18:24426876-24426898 GAACCCGGGGCGGCCCCAGGCGG - Intronic
1157414312 18:47489389-47489411 GCAGGAGGGGAGCCCCCAAGGGG - Intergenic
1157617959 18:48998514-48998536 GATGGAAGGGTGTCCCCACGGGG - Intergenic
1158404262 18:57147200-57147222 GAAGGAGGAGGGCCCCAAGGAGG - Exonic
1159083600 18:63761912-63761934 GACAGAGAGGTGGCCCCAGCAGG - Intronic
1160519639 18:79497313-79497335 CAAGGAAGAGCGGCCCCAGGGGG + Intronic
1160541928 18:79628591-79628613 GAAGGGGAGGTGGCCCCAGGAGG - Intergenic
1160699411 19:498668-498690 GGAGGAGGAGGAGCCCCAGGGGG + Exonic
1160829832 19:1098585-1098607 GAAGGAGGGGAGGCAGCAGCAGG + Intergenic
1160906179 19:1452759-1452781 GAGTGAGAGGTGGCCCCAAGGGG - Exonic
1160968193 19:1755780-1755802 GAGGGAGGAGGGTCCCCAGGGGG - Intronic
1161018854 19:1998445-1998467 GCAGCAGGGGTGGCCCCAGCTGG + Intronic
1161318661 19:3631178-3631200 GCAGCAGGTGTGGCCCCGGGCGG - Exonic
1161381709 19:3968912-3968934 GGAGGGGGTGGGGCCCCAGGGGG + Intronic
1162043407 19:7983920-7983942 GGAGGAGGGGTGTCCCAAGAGGG - Intronic
1162541694 19:11300396-11300418 GATGGAGGGCTGCTCCCAGGGGG + Intronic
1162766847 19:12924885-12924907 GAAGGTGCGGTTGGCCCAGGCGG - Exonic
1162958900 19:14114665-14114687 GAGGGAGCAGCGGCCCCAGGGGG - Intronic
1163497139 19:17653124-17653146 GGGGGAGGGGTGGCCCTATGAGG + Intronic
1163698436 19:18775457-18775479 GGTGGCGGGGAGGCCCCAGGTGG + Intronic
1163715337 19:18869620-18869642 GGAGGAGGGGTGGCCGAAGTGGG + Intronic
1163844529 19:19630734-19630756 CAAAGAGGAGTGGGCCCAGGTGG + Intronic
1163844849 19:19632762-19632784 CAAAGAGGAGTGGGCCCAGGTGG - Intronic
1164787019 19:30941577-30941599 GCAGGAGGCGTGGCCTCAAGTGG + Intergenic
1165229656 19:34378975-34378997 GAAGGAGTGGTTTCTCCAGGCGG + Exonic
1166379032 19:42344838-42344860 GTAGGAGGCGTGGCCCTGGGTGG + Intronic
1166750080 19:45160372-45160394 TAAGGAGGGATGGCCAGAGGAGG + Intronic
1166851318 19:45762895-45762917 GCAGGTGGGGTCACCCCAGGAGG + Intronic
1166942303 19:46374325-46374347 GGAGCAGGGGTGGCCTCTGGTGG - Intronic
1167058652 19:47129724-47129746 AAACCAGGGATGGCCCCAGGTGG - Intronic
1167436527 19:49481581-49481603 GAAGGAGGGGAGGCCCCAGCGGG + Intronic
1167503794 19:49861161-49861183 GAAGGAGGGTGGTCCCCACGGGG - Intergenic
1167513122 19:49907293-49907315 GGAGGAGGTGAGGCCCAAGGTGG + Intronic
1167667517 19:50831431-50831453 ACAGGTGAGGTGGCCCCAGGAGG - Exonic
1167693847 19:51002723-51002745 GAAGGAGGCGGGGCCACAAGGGG + Exonic
1168597936 19:57694172-57694194 GAAGGACTTGAGGCCCCAGGTGG + Intronic
925342663 2:3147891-3147913 GAAGGACGGGTGTTCGCAGGTGG + Intergenic
925975673 2:9140251-9140273 GAGGGAGGGGAGGCTCCAGGGGG + Intergenic
927472521 2:23386203-23386225 GACGGAGGGCTGGCCCCCAGGGG + Intronic
927869499 2:26614606-26614628 GATGGAGGGGTTGCCTGAGGTGG - Intronic
927971011 2:27306470-27306492 GAAGAGGAGGTGGCCCCAGACGG + Exonic
929090905 2:38216613-38216635 GAAGGAGGGGTGGATACTGGAGG - Intergenic
929251103 2:39756537-39756559 GAAGGAGGGATGAGCACAGGTGG + Intronic
929259715 2:39851929-39851951 GCAGAGGGGCTGGCCCCAGGGGG + Intergenic
931803337 2:65779729-65779751 GAAGGTGGGCTAGCCCAAGGGGG - Intergenic
932412799 2:71557286-71557308 GGAGAAGGGGATGCCCCAGGTGG + Intronic
932611419 2:73202878-73202900 GAAGGCCGGGTGGACGCAGGCGG - Exonic
933775115 2:85767013-85767035 GAAGGACAAGGGGCCCCAGGAGG - Intronic
934553790 2:95277107-95277129 GCAGGTGGGATCGCCCCAGGAGG - Intronic
935380985 2:102450997-102451019 GAAAGAGATGTGGCTCCAGGAGG + Exonic
937209753 2:120260680-120260702 CCAGGAGGGATGGCCTCAGGAGG + Intronic
937453614 2:122022848-122022870 CAGGGAGGGGTGGCCCAAGATGG + Intergenic
938973147 2:136450341-136450363 GAAGGAGAGGTGGGCACAGGAGG + Intergenic
941001722 2:160209152-160209174 GAAGGAGGGGTGGGTTCGGGGGG + Intronic
942273509 2:174300807-174300829 AAAGGAGGAGTGGCCCCTTGAGG - Intergenic
945320012 2:208410371-208410393 GTAGGAGGGGTGGGCCCCAGAGG - Intronic
946149302 2:217753399-217753421 CAAAGAGGGCTGACCCCAGGTGG + Intronic
947794713 2:232887005-232887027 ACAGGAGGAGTGGCCCGAGGTGG + Intronic
948169569 2:235890107-235890129 GAAGGAGGTATGGGCACAGGAGG + Intronic
948770676 2:240250023-240250045 GGAGGGAGGGAGGCCCCAGGAGG - Intergenic
948886469 2:240887543-240887565 GCATGAGGGGAGGCCCCAGGAGG + Intronic
948900786 2:240956024-240956046 GCAGGAGGGGTGGCCCCCTGGGG - Intronic
948942085 2:241201690-241201712 GGAGGAAGGGTGGCCCCAGGCGG + Intronic
1168753115 20:297694-297716 GAAGATGGGCTGGGCCCAGGTGG + Exonic
1169052911 20:2595708-2595730 GAAGGGAGAGTGGGCCCAGGTGG - Intronic
1169074292 20:2751874-2751896 GACGGAGGGGCAGCCCCTGGGGG - Intronic
1169493247 20:6089286-6089308 GAGCCAGGTGTGGCCCCAGGTGG - Intronic
1169781170 20:9312220-9312242 GAAGAAGGGGTAGCCCGAGCTGG - Intronic
1169817676 20:9674972-9674994 GCAGCTGGGGTGGCCCAAGGAGG + Intronic
1170682803 20:18541570-18541592 GAAATAGGGGAGGCCCAAGGAGG + Intronic
1170991230 20:21303470-21303492 GAAGGTGAGGAGGCGCCAGGCGG + Exonic
1171233611 20:23507524-23507546 GCAGGAGCGCTGGCCCCTGGCGG - Intergenic
1171326924 20:24302803-24302825 CCACGAGGGGTGTCCCCAGGCGG + Intergenic
1171481367 20:25458133-25458155 GAAGGAGCGGTGGCGCCATGTGG - Intronic
1172006782 20:31823402-31823424 GCAGGAGGGGTGGTGCCAAGGGG + Intronic
1172013641 20:31860877-31860899 GAAGGAGGTGGGGTCCCAGGAGG + Intronic
1172048944 20:32101585-32101607 GAAGGGGGTGTGGGCCCTGGCGG - Exonic
1172532718 20:35644251-35644273 CAAGGAGGAGTGGATCCAGGAGG + Intronic
1172580864 20:36046832-36046854 GAAGGGGGGGTGGGCAGAGGAGG - Intergenic
1172634513 20:36401043-36401065 GGAGGAGGGGTGGTGGCAGGAGG - Intronic
1173201964 20:40960989-40961011 GGGGGAGGGGTGGGGCCAGGCGG + Intergenic
1173561155 20:44006609-44006631 GCAGGAGGGATGGCTCCGGGAGG - Exonic
1173643875 20:44621792-44621814 GGAGAAGCAGTGGCCCCAGGAGG - Intronic
1174056214 20:47800238-47800260 GGAGTGGGGGTGGCCCCAGCAGG - Intergenic
1174559672 20:51421652-51421674 GCAGGAGGTGGGGCCCAAGGTGG + Intronic
1176043631 20:63081257-63081279 CAAGGAGGGGGTCCCCCAGGAGG - Intergenic
1176163644 20:63661559-63661581 GAGGGTGGGGTGGGCCCATGGGG + Intronic
1176177449 20:63735398-63735420 GAAGCCGGGGCGGCCCCAGCGGG + Exonic
1179354493 21:40646319-40646341 GCAGGAGGCTTGACCCCAGGAGG + Intronic
1179644746 21:42768601-42768623 GAAGCAGGAGGGGGCCCAGGAGG + Intronic
1179878757 21:44284868-44284890 GGAGGGGGGGTGGCCTCAGTGGG - Intergenic
1180038701 21:45264709-45264731 GAGGGAGGGGTGGCCAGTGGGGG + Exonic
1180918967 22:19508715-19508737 GAACCAGTGGTGGCCCCATGAGG - Intronic
1180956793 22:19744847-19744869 GCAGGTGGGCTGGCCCCGGGGGG - Intergenic
1181048311 22:20227004-20227026 CAAGGAAGGGTGGCCCCCTGAGG + Intergenic
1181309031 22:21933784-21933806 AAATGAGGGGCTGCCCCAGGTGG + Intronic
1181688299 22:24543939-24543961 GAAGCAGTGGTGGCCACTGGGGG + Exonic
1182322948 22:29490115-29490137 GGAGGAGGAGAAGCCCCAGGAGG + Exonic
1182396886 22:30042668-30042690 GAAGGAGGGGTGGCACAGAGCGG - Intergenic
1182725556 22:32442442-32442464 ACAAGAGGGGTGGCTCCAGGGGG - Intronic
1182990049 22:34759026-34759048 GAATGATGGGTGGTCCCAGGTGG + Intergenic
1182991519 22:34772225-34772247 GGAGCAGGGGTGGGCCCAGGGGG - Intergenic
1183301628 22:37061651-37061673 GAGGGAGGGGTGGAGCGAGGAGG + Intronic
1183378417 22:37478586-37478608 GAGGGAGAGGGTGCCCCAGGAGG + Intronic
1183400281 22:37599673-37599695 GGAGGATGGCTGGACCCAGGAGG - Intergenic
1183475294 22:38032846-38032868 GCAGGAGGGGTGGCCACGGTGGG + Intronic
1183644246 22:39114004-39114026 GAAGGATTGGTGGACCTAGGAGG + Intergenic
1183739595 22:39662484-39662506 GAAGTGGGTGCGGCCCCAGGAGG + Intronic
1184095825 22:42315751-42315773 GAACCAGAGGTAGCCCCAGGTGG + Intronic
1184528479 22:45039698-45039720 GATGGAGGGATGGAACCAGGAGG - Intergenic
1184561214 22:45263934-45263956 GAGGCAGGGGTGGCCGCAGGAGG - Intergenic
1184889516 22:47371198-47371220 AATGGAGGTGTGGCCACAGGGGG + Intergenic
1184899026 22:47432692-47432714 GGAGGAGGGAGGGGCCCAGGGGG + Intergenic
949924115 3:9027450-9027472 GAAGCAAGGCTGGCCCCTGGTGG + Intronic
950106104 3:10389836-10389858 GAAGCAAAGGTGACCCCAGGAGG + Intronic
950455053 3:13087936-13087958 GAAGAAGGGGTTGGGCCAGGAGG - Intergenic
952334626 3:32393107-32393129 TAAGGTGGCCTGGCCCCAGGGGG + Intronic
953546915 3:43870354-43870376 GGAGGAGGAGTGGCACAAGGTGG + Intergenic
954371283 3:50170781-50170803 GGGGGAGGGGGAGCCCCAGGAGG - Intronic
954570495 3:51637075-51637097 GAAGTAGGGGTGCACCCTGGAGG - Intronic
954844830 3:53546262-53546284 GAGGGAGGTGTGGGCCCTGGGGG + Intronic
954870555 3:53764536-53764558 GAAAGCTGGGTGTCCCCAGGTGG - Intronic
955093645 3:55775864-55775886 GCAGCAGGGGTGGACCCAGTTGG + Intronic
955352330 3:58203082-58203104 GAATGAGGGGAAGTCCCAGGAGG - Intronic
960138182 3:114126430-114126452 GACTGATGGGTGGCACCAGGCGG - Intergenic
960620249 3:119630284-119630306 GAAGGAGGGGAAGCACCAGAAGG + Intergenic
960623808 3:119660947-119660969 GAAGAAAGGGTGACCCCAGATGG + Intronic
960944388 3:122956356-122956378 CAAGGTGGGGAGGCCTCAGGGGG - Intronic
960948704 3:122984364-122984386 GCAGCAGGGGTGGCCTCAGAAGG + Intronic
964170936 3:153768629-153768651 GGAAGAGGGGAGGCCCCAGCAGG - Intergenic
965802703 3:172511111-172511133 GAGGGTGGTGTGGCCACAGGTGG + Intronic
967025574 3:185561168-185561190 GCTGGAGGGGTGCCTCCAGGAGG + Intergenic
967236930 3:187393980-187394002 GCAGGAGAGGAAGCCCCAGGGGG - Intergenic
967904335 3:194487779-194487801 GCAGGCCAGGTGGCCCCAGGCGG - Intronic
968068914 3:195773963-195773985 GAAGCAGCGGTGGGCCCAGCAGG + Intronic
968562755 4:1293617-1293639 AGAGGAGAGGTGGGCCCAGGTGG - Intronic
968653185 4:1767921-1767943 GAAGGCGGGGTGGGCCGGGGTGG - Intergenic
968842479 4:3017610-3017632 GGAGGAGAGGAGGCCCCAGCCGG - Intronic
968874422 4:3257850-3257872 GAAGGAAGGGTGGCCCCAGGAGG + Intronic
969602300 4:8183428-8183450 GAGGGAGGCGTGGCCCAGGGAGG + Intronic
969617939 4:8264751-8264773 GGAGGAGGGTTCGCCCCAGCAGG + Intergenic
972773364 4:42218999-42219021 GCAGCGGGGGTGGCCTCAGGAGG - Intergenic
973931408 4:55796328-55796350 GAAGGAGGGATGGCAGGAGGTGG - Intergenic
976257378 4:83112454-83112476 GCAGAATGGGGGGCCCCAGGAGG + Intronic
981244787 4:142522672-142522694 AAAGAAGTGGTGGCCTCAGGTGG + Intronic
982219232 4:153110797-153110819 GAAGGAAGGGAGGGCCCAGTGGG + Intergenic
983872731 4:172840957-172840979 GAAGGACTGCTGGCCCCAGAGGG - Intronic
985720949 5:1488793-1488815 GAATGAGTGCTGCCCCCAGGAGG - Intronic
985898071 5:2762235-2762257 GATGGAGGGGAGGCAGCAGGAGG + Intergenic
986206379 5:5628733-5628755 GAGGGAGGGGTGGTCCAAGGAGG + Intergenic
987379846 5:17275327-17275349 GAAGGAGAGTGAGCCCCAGGCGG + Exonic
991351329 5:65722582-65722604 GCGGGAAAGGTGGCCCCAGGTGG - Intronic
997209837 5:132070750-132070772 GTAGGAAGGGGGGCCCCAGAGGG + Intergenic
997397888 5:133579172-133579194 GAAGGAGACGTGGACCCTGGGGG - Intronic
997411852 5:133696733-133696755 GGAGGAGGGGAAGCCCCAGTGGG + Intergenic
997468961 5:134105969-134105991 GAAGGAGGGGTGGGCCAAGAAGG - Intergenic
997517509 5:134501497-134501519 GTAGGATGAGTGTCCCCAGGAGG + Intergenic
997704100 5:135930615-135930637 GCGGGAGGGGTCGCTCCAGGGGG - Intronic
997716381 5:136046294-136046316 GAAGGAGGGATGGCCTCTGGGGG - Intronic
998012620 5:138707605-138707627 GAGGGAAGGATGACCCCAGGAGG - Intronic
998208504 5:140175977-140175999 GAAGGAGGGGAGGACCCCTGGGG + Intronic
998422795 5:142003063-142003085 GAGGGAGGTGTGGGTCCAGGAGG - Intronic
999084824 5:148878281-148878303 GGAAGAGGGGAGGGCCCAGGGGG + Intergenic
999125347 5:149242136-149242158 GAATGAGGTGTGGCCACTGGTGG + Intronic
999242757 5:150137141-150137163 GAAGGCTGGGTGGCCCAAGCTGG - Intronic
999258329 5:150222326-150222348 GAAGGAGGGGTGGCATGATGAGG - Intronic
1000329744 5:160197190-160197212 GGAAGAGGGGTGGGCCCAGGGGG + Intronic
1000337339 5:160251610-160251632 GAAGGAGGGGCCGGCCCAAGAGG + Intergenic
1001688778 5:173616528-173616550 GAAGGAGGAGGGCCCCAAGGCGG + Exonic
1002830358 6:814885-814907 GAAGGAGTGAGGGCCGCAGGTGG + Intergenic
1003107691 6:3228257-3228279 GGAGGACAGGTGGCCCCAGAAGG + Intronic
1003418024 6:5930366-5930388 GGAGGAGAAGTGGCCCCTGGGGG - Intergenic
1003513797 6:6802439-6802461 GAGGGAGGGCTGGTCCCAGCAGG - Intergenic
1004044493 6:12011890-12011912 GGAGGAGGGGAGGCCGCGGGCGG - Intronic
1004709574 6:18156230-18156252 GGAGGAGGGGTGGCCCGATTAGG + Intronic
1005471555 6:26166395-26166417 GAAGGAGGAGGGGGTCCAGGAGG - Intronic
1006163738 6:32052799-32052821 CAGGGACGGGCGGCCCCAGGTGG - Intronic
1006164856 6:32058187-32058209 CAGGGACGGGCGGCCCCAGGCGG - Intronic
1006165349 6:32061526-32061548 CAGGGACGGGCGGCCCCAGGTGG - Intronic
1006166307 6:32067790-32067812 CAGGGACGGGCGGCCCCAGGTGG - Intronic
1006167524 6:32073776-32073798 CAAGGACGGGCAGCCCCAGGTGG - Intronic
1006500023 6:34452403-34452425 GGAGGAGGGGAGGCCTCGGGAGG + Intergenic
1006652392 6:35562443-35562465 GGAGGCCGGGTGGCCCCTGGGGG + Intergenic
1006823256 6:36915179-36915201 GAAGGAGGGGTGCCACCATGGGG + Intronic
1007736852 6:43987297-43987319 GAAGGAAGGGGGAGCCCAGGAGG + Intergenic
1007962199 6:45970051-45970073 GAAGGAGGAATGGGCCCAGAGGG - Intronic
1008160339 6:48068700-48068722 GAGGGGGGACTGGCCCCAGGGGG - Intergenic
1011626217 6:89285805-89285827 GAAGGAGGGGGCGCGCCAGTGGG - Intronic
1013284557 6:108670031-108670053 GAAGCACAGGTGGCCCCTGGGGG - Intronic
1013456776 6:110336647-110336669 GAAGAATGGGTGAACCCAGGAGG + Intronic
1014219613 6:118786893-118786915 GATGCAGAGGTGGGCCCAGGTGG - Intergenic
1014473446 6:121844169-121844191 GAAGCTGGGGTGGGCGCAGGGGG + Intergenic
1015058209 6:128929940-128929962 GAGGGAGTGGTGGGTCCAGGTGG - Intronic
1015239097 6:131004243-131004265 GAAGAAGGGGTGGGCACAGTGGG + Intronic
1015786566 6:136924484-136924506 GAAGGTGGGGAGGCAGCAGGTGG + Exonic
1017684197 6:156895531-156895553 GCAGGAGGGGACACCCCAGGAGG - Intronic
1017700326 6:157063253-157063275 GAAGAAGGGGTGGCAGCTGGGGG + Intronic
1018471427 6:164101346-164101368 GGAGGAGGGGGGCCTCCAGGTGG - Intergenic
1018626699 6:165786269-165786291 AAAGGAGGGGTGACCCCAGGTGG + Intronic
1018656732 6:166044032-166044054 GAAGGAAGTGGGGCCCAAGGTGG + Intergenic
1019080753 6:169427965-169427987 GGAGGAGGCGAGGCCCCAGAGGG + Intergenic
1019162189 6:170076085-170076107 GACTGATGGGTGGCCACAGGGGG + Intergenic
1019275014 7:171620-171642 GAGGCCGGGGTGGCCACAGGTGG - Intergenic
1019649912 7:2151321-2151343 GCAGGTGGGGTGGTCACAGGCGG + Intronic
1020023756 7:4884016-4884038 TAAGGAGGGGGGGTCCCCGGAGG + Intergenic
1020115934 7:5476359-5476381 GAATGAGGGTTGGTCCCGGGAGG - Intronic
1020343204 7:7134842-7134864 GAAGAAAGGGTGGCCCCAGAAGG + Intergenic
1022436073 7:30386970-30386992 AAAGATGGGGTGGCCACAGGCGG - Intronic
1024003009 7:45203296-45203318 GAAGGAGGGGAGGCCAGAAGAGG + Intergenic
1024020115 7:45360956-45360978 CCTGGAGGGATGGCCCCAGGTGG - Intergenic
1024511937 7:50211650-50211672 GAAAGAGGGATGGCCTCAGGAGG + Intergenic
1024705236 7:51950340-51950362 GAGGGTGGTGTGGCCACAGGGGG + Intergenic
1025236784 7:57239917-57239939 GGAGTGGGGGTGGCCCCAGCAGG + Intergenic
1026543232 7:71299110-71299132 GAATGAGGGGCGGGCCCAGGTGG - Intronic
1026863311 7:73807892-73807914 GAAGGAGGGGTGGGGGCAGCTGG + Intronic
1026900323 7:74033505-74033527 CTCGGAGTGGTGGCCCCAGGGGG - Intronic
1026907142 7:74069040-74069062 GAGGGAAGGGTGGCCCCTCGGGG + Intronic
1026986901 7:74560338-74560360 GAAGGAGGGGTGTCTGCATGGGG + Intronic
1028659541 7:93253639-93253661 GAATGAGGGGTGGAACCAGAGGG + Intronic
1028850730 7:95534517-95534539 GAAGGAGGGGTGGCTGAAGCTGG - Intronic
1030197698 7:106868518-106868540 GAAGGAAGAGTGGCCACTGGTGG + Exonic
1030865595 7:114698561-114698583 GATGGAGGGGTGGCATCAGCAGG - Intergenic
1031886773 7:127252476-127252498 GAAGGAGAGTGGGCACCAGGGGG - Intronic
1032280408 7:130495371-130495393 GAGGGAGTGGTGGGTCCAGGTGG + Exonic
1032639028 7:133744309-133744331 GAAGGAGGGGAGGTTCAAGGGGG - Intronic
1033343347 7:140508738-140508760 GAAGTGGGGTTGGGCCCAGGAGG + Intergenic
1034418350 7:150976779-150976801 GAGGTGGGGGTGGGCCCAGGGGG - Intronic
1034830599 7:154304846-154304868 GGGGCAGAGGTGGCCCCAGGAGG - Intronic
1034970496 7:155416304-155416326 CACAGAGGGGTGGCCACAGGAGG - Intergenic
1035588704 8:796837-796859 GAAAGGAAGGTGGCCCCAGGAGG - Intergenic
1036504226 8:9340814-9340836 GAGGAAGGGATGGCCCCAAGTGG + Intergenic
1037503487 8:19507408-19507430 ACAGGAAGGGTGACCCCAGGGGG - Intronic
1037776238 8:21837795-21837817 GAAGGAGGGAGGACCTCAGGTGG - Intergenic
1037909544 8:22735715-22735737 GGAGGAGGGTGGGCCCCAGCTGG + Intronic
1038227499 8:25670542-25670564 GCACGGGGGCTGGCCCCAGGTGG + Intergenic
1039399901 8:37260802-37260824 GAATGAGGGGAGCCCACAGGGGG + Intergenic
1039608269 8:38900608-38900630 GAAGGATCGCTGGACCCAGGAGG + Intergenic
1041662733 8:60414899-60414921 TAAGCAGGGTTGGCCCCATGTGG + Intergenic
1042963743 8:74329381-74329403 GAAGGGAAAGTGGCCCCAGGTGG + Intronic
1045503228 8:102759043-102759065 CAAGGAGGGGAGGCCAAAGGGGG + Intergenic
1045679165 8:104640455-104640477 GGAGGAGAGGTGGACCTAGGAGG + Intronic
1045679171 8:104640476-104640498 GGAGGAGAGGCGGACCCAGGAGG + Intronic
1046547329 8:115668521-115668543 TAAGGAGGGGAGGCCCGAGCGGG - Intronic
1049237026 8:141517568-141517590 GAGGGAGGTGCGGCCCCAGGAGG - Intronic
1049427557 8:142544178-142544200 GCAGGAGGGGTGGGGCCCGGAGG - Intronic
1049478969 8:142811009-142811031 GGAGGAGGAGTGGCCCGAGTGGG - Intergenic
1049583433 8:143422729-143422751 GCAGGAGGGGTAGGCGCAGGAGG - Intronic
1052954265 9:34241143-34241165 GAAGGGGGTGTGAACCCAGGTGG - Intronic
1052991813 9:34523011-34523033 GGAGGAGGTGCGGCCCCAAGGGG - Exonic
1053282683 9:36831187-36831209 CAAGGAGGTGTGGTCTCAGGAGG - Intergenic
1056580426 9:87885428-87885450 GTAGGTGGAGAGGCCCCAGGTGG - Exonic
1057181877 9:93034899-93034921 CAAGGAGGGGTGGGCCAAGGGGG + Intronic
1057222442 9:93264476-93264498 CAGGGAGGGGTGGCTCCAGAGGG - Intronic
1058740716 9:107939568-107939590 GGAGGAGGCTTGGGCCCAGGAGG + Intergenic
1059125689 9:111682665-111682687 GAAGGAAGGGAGACCCCATGTGG + Intergenic
1060414226 9:123419360-123419382 GGAGGAGGCCTGGCCCCAGAGGG + Intronic
1060482163 9:124022934-124022956 GAGGGAGGGGCGGGCCCAGAGGG - Intronic
1060972874 9:127748835-127748857 TGAGGAGGGGTGGCATCAGGTGG + Intronic
1061015890 9:127980678-127980700 GAAGGTGGGGCACCCCCAGGGGG + Intergenic
1061208447 9:129177400-129177422 GCCGGAGGGGCGGCCCCTGGGGG + Exonic
1061237008 9:129349165-129349187 GGAGGAGGCATGACCCCAGGTGG + Intergenic
1061282266 9:129604276-129604298 GAGGGTGGGGTGGGGCCAGGTGG - Intergenic
1061420390 9:130470337-130470359 CAGGGAGGGGTGCCCCCAGAAGG + Intronic
1061431533 9:130534359-130534381 GAAGGAGGCCGAGCCCCAGGTGG - Intergenic
1061801753 9:133116613-133116635 GAAGGTGGGCTGGTCCCAAGGGG + Intronic
1061848124 9:133399545-133399567 GAGGGAGGTGTGGCTCCGGGTGG - Intronic
1061850210 9:133410511-133410533 GAACCAGGGGCTGCCCCAGGCGG + Intronic
1061887450 9:133599010-133599032 GAAGGGGGGAGGGCCCCTGGGGG - Intergenic
1062161771 9:135084241-135084263 AAAGGAGAGGTGGCTCCATGTGG + Intronic
1062249397 9:135586766-135586788 GGAGGAGGCGTGGCCACAGTGGG + Intergenic
1062317733 9:135976776-135976798 GAAGCAGCGGTGGCCCCAACGGG + Intergenic
1062369384 9:136229818-136229840 GCAGGAGAGGTGGCCAGAGGAGG - Intronic
1062622038 9:137427565-137427587 GAAGGAGAGGCTGCCCCAGAGGG - Intronic
1187194757 X:17072498-17072520 GAAGGAGGGGTGAGCCCTGCTGG - Intronic
1188389922 X:29607536-29607558 GAATGAGAAGTGCCCCCAGGAGG - Intronic
1188880553 X:35486758-35486780 GATAGGGGGGTGGCCACAGGTGG + Intergenic
1195221665 X:102749707-102749729 GAAGGAGGGCTTGCCTCAGATGG - Exonic
1196070034 X:111510211-111510233 GAAGTATGGGTGGCCCAAAGAGG + Intergenic
1200133153 X:153862360-153862382 GAAGTAGGGGTGGCCCGAAAGGG - Exonic
1200134366 X:153867724-153867746 GGAGGAGGGAGGACCCCAGGAGG + Intronic
1200150537 X:153949269-153949291 GTGGGAGGGGTGGGCCCTGGCGG + Exonic