ID: 1081871149

View in Genome Browser
Species Human (GRCh38)
Location 11:46383055-46383077
Sequence GACCAAATGCTGCCCGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081871149_1081871157 13 Left 1081871149 11:46383055-46383077 CCAGCCACGGGCAGCATTTGGTC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1081871157 11:46383091-46383113 CTAGTGTTGGGAGGAGGTCAAGG 0: 1
1: 0
2: 1
3: 15
4: 206
1081871149_1081871155 7 Left 1081871149 11:46383055-46383077 CCAGCCACGGGCAGCATTTGGTC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1081871155 11:46383085-46383107 CCCTTTCTAGTGTTGGGAGGAGG 0: 1
1: 0
2: 1
3: 14
4: 196
1081871149_1081871152 1 Left 1081871149 11:46383055-46383077 CCAGCCACGGGCAGCATTTGGTC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1081871152 11:46383079-46383101 GCTCTGCCCTTTCTAGTGTTGGG 0: 1
1: 0
2: 0
3: 15
4: 152
1081871149_1081871158 23 Left 1081871149 11:46383055-46383077 CCAGCCACGGGCAGCATTTGGTC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1081871158 11:46383101-46383123 GAGGAGGTCAAGGCCCACCCTGG 0: 1
1: 0
2: 3
3: 44
4: 636
1081871149_1081871159 24 Left 1081871149 11:46383055-46383077 CCAGCCACGGGCAGCATTTGGTC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1081871159 11:46383102-46383124 AGGAGGTCAAGGCCCACCCTGGG 0: 1
1: 0
2: 2
3: 66
4: 342
1081871149_1081871153 4 Left 1081871149 11:46383055-46383077 CCAGCCACGGGCAGCATTTGGTC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1081871153 11:46383082-46383104 CTGCCCTTTCTAGTGTTGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 163
1081871149_1081871151 0 Left 1081871149 11:46383055-46383077 CCAGCCACGGGCAGCATTTGGTC 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1081871151 11:46383078-46383100 AGCTCTGCCCTTTCTAGTGTTGG 0: 1
1: 0
2: 0
3: 18
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081871149 Original CRISPR GACCAAATGCTGCCCGTGGC TGG (reversed) Intronic
916261329 1:162845564-162845586 GACAAAATCTTGCCCTTGGCAGG - Intronic
919652981 1:200168479-200168501 AAGAAAATGCTGCCCTTGGCAGG - Intronic
1066057519 10:31695783-31695805 GACCAAATTCAGCCCATAGCAGG + Intergenic
1069718069 10:70533459-70533481 GCCCAGCTGCTGGCCGTGGCTGG + Intronic
1073486164 10:103820416-103820438 GACCAGATGCAGCCCCTGGCAGG - Intronic
1073771130 10:106736957-106736979 GACAAAATGCAGCACGTGGAGGG - Intronic
1075053576 10:119201464-119201486 GGCCAAATGCTCCCTGTGTCAGG + Intergenic
1075724885 10:124606098-124606120 GCCCAAATGCAGCCCGAGGGAGG + Intronic
1076869499 10:133186422-133186444 GCCCAAATGCAGGCTGTGGCCGG + Exonic
1077287161 11:1772803-1772825 GAACTAAAGCTGCCTGTGGCTGG - Intergenic
1081871149 11:46383055-46383077 GACCAAATGCTGCCCGTGGCTGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1084456193 11:69269428-69269450 GACCACATGCTGCCTCTGACTGG - Intergenic
1084492452 11:69486251-69486273 GAAGAAATCCTGCCCGTGGAGGG + Intergenic
1084940083 11:72607766-72607788 GAGCAGAGGCTGCCCTTGGCCGG + Intronic
1088753886 11:112869067-112869089 GTTCACATGCTGCCCCTGGCAGG + Intergenic
1091897993 12:4120185-4120207 GACCACATGGTGCCTCTGGCAGG + Intergenic
1097920377 12:65066154-65066176 GAAGAAATGTTGCCCCTGGCTGG - Intronic
1102459510 12:113091660-113091682 AAGCAAATGGTGCCCTTGGCAGG - Intronic
1103909277 12:124343214-124343236 GACGAAAGGCTGCCTGTGGACGG + Exonic
1104920326 12:132287189-132287211 GAGCCAATGCTGCCCGATGCAGG - Intronic
1105847177 13:24303218-24303240 GACACAATGCTGCACGTGTCTGG + Exonic
1108266036 13:48709578-48709600 GACCAAATGCTGTGAGTGGAAGG - Exonic
1110014924 13:70387853-70387875 GACCAAATACTGCAAGTGGCAGG + Intergenic
1118965939 14:70585472-70585494 GGCCTCATGCTGCCCGTGGGCGG - Intronic
1122828492 14:104383766-104383788 GAGCAGATGCTGCCCTTGGAAGG - Intergenic
1125532079 15:40420239-40420261 GACTGGATGGTGCCCGTGGCAGG - Intronic
1133275584 16:4636425-4636447 GTCCCAGTGCTGCCCGTGGACGG + Intronic
1134207921 16:12252782-12252804 CACCAAAGGCTCCCCATGGCTGG - Intronic
1135189635 16:20344304-20344326 GATAAAAAGCTGCCTGTGGCCGG + Intronic
1138117826 16:54374402-54374424 GACCACATGCTGCCCCTGGAGGG - Intergenic
1140972312 16:80025195-80025217 GGCCAAATGCAGCCAGTTGCCGG - Intergenic
1141768746 16:86075762-86075784 GACCCAGTGCTGCCCCTGGCTGG + Intergenic
1143785599 17:9253400-9253422 GACCAAAAGCTCCCCTGGGCAGG + Intronic
1143874215 17:9979573-9979595 GACAAGATGCTGCCTGTGGAGGG + Intronic
1148198142 17:45729502-45729524 GACCAAATGTGGGCAGTGGCAGG + Intergenic
1148658726 17:49309885-49309907 GAGGAAATTCTGCCCATGGCTGG - Intronic
1149272474 17:54995238-54995260 GCCCAAATGGTGCCAGTGGAAGG - Intronic
1150700285 17:67441173-67441195 GACAATTTGCTGCCAGTGGCTGG - Intronic
1151311213 17:73293465-73293487 GACCAGAGGCTGCCCCTGGAAGG - Intronic
1151970692 17:77456082-77456104 GAGGAAACACTGCCCGTGGCCGG + Intronic
1156282821 18:35657638-35657660 GAGCAAATGCCACCCTTGGCTGG - Intronic
1161260881 19:3337151-3337173 CACCAAGTCCTGCCGGTGGCAGG + Intergenic
1163359346 19:16836080-16836102 CGCCAAAGGCTGCCCGAGGCTGG - Intronic
1164157664 19:22606311-22606333 GACCTGAGGCTCCCCGTGGCTGG + Intergenic
1167829509 19:52008080-52008102 GAGGAAATTCTGTCCGTGGCTGG - Intronic
933298457 2:80516745-80516767 GACCAAATTCTGTCCTTGGCAGG - Intronic
946220189 2:218218866-218218888 AACCAACTGCAGCCCCTGGCAGG - Intronic
947625173 2:231614367-231614389 GAACAAAGGCGGCCCGAGGCCGG - Intergenic
1173105330 20:40128156-40128178 GACCAATAGCTGCATGTGGCTGG - Intergenic
1174534802 20:51242891-51242913 GACCTTAAGCTGCCCATGGCAGG - Intergenic
1179729414 21:43359296-43359318 GACCAACCCCTGCCCGTGCCCGG + Intergenic
1181462523 22:23094149-23094171 GGGCGAATGCTGCCTGTGGCAGG + Intronic
1183479064 22:38052919-38052941 GTGCAAAGGCTTCCCGTGGCGGG - Intergenic
1184527699 22:45035284-45035306 GGCCAAGTCCTGCCAGTGGCAGG + Intergenic
1185180537 22:49358280-49358302 GCCCAGAGGCTGCCTGTGGCGGG + Intergenic
1185312757 22:50165744-50165766 GCCCAGATGCTGCCCCAGGCAGG + Intergenic
950870041 3:16220431-16220453 GACCAAATGGTGCTGGAGGCTGG - Intronic
955393299 3:58536660-58536682 TAGCAAATGCTGGCAGTGGCAGG - Intronic
962381040 3:134898322-134898344 CACCAAGTGCTGCTCATGGCAGG + Intronic
967805758 3:193713414-193713436 GACCATATGCTGGCCCTGGAAGG - Intergenic
968297263 3:197586215-197586237 GCCCAAAAACTGCCAGTGGCTGG - Intergenic
992640144 5:78761992-78762014 CTCCAAATACTGCACGTGGCTGG + Intronic
992754176 5:79888887-79888909 GAGCAAGAGCTGCCCTTGGCAGG + Intergenic
1002605183 5:180378852-180378874 TAGCAAATGCTGACCATGGCAGG + Intergenic
1012127225 6:95445492-95445514 GACCAAACCCTACCTGTGGCTGG + Intergenic
1017603129 6:156105033-156105055 CACCCAATGCTGCCCTTGACAGG + Intergenic
1019990434 7:4686619-4686641 GACCATAAGCTCCCTGTGGCTGG + Intronic
1024556268 7:50605656-50605678 GTCCAAATGCTGCGGGTGCCGGG - Intronic
1025071465 7:55903371-55903393 AAAAAAATGCTGCCCATGGCCGG + Intronic
1027054052 7:75038106-75038128 GAGCAGATGCTGCCTGGGGCGGG + Intronic
1036753009 8:11455089-11455111 GCCCCAGTGCTGCACGTGGCAGG + Intronic
1037803031 8:22045295-22045317 GCCCAATGGCTGCCCCTGGCAGG - Intronic
1041254955 8:55972055-55972077 TACCAAATCCAGCCCGTGCCAGG + Intronic
1043113356 8:76216291-76216313 GACCAAAAGCTGCAAGGGGCAGG + Intergenic
1189839848 X:45063576-45063598 GGCCAAAGGCTGCCCAGGGCAGG - Exonic
1197082742 X:122439472-122439494 GCCCACATGCTGCCTGTAGCAGG - Intergenic