ID: 1081872165

View in Genome Browser
Species Human (GRCh38)
Location 11:46388143-46388165
Sequence GCCCGCGTGCGTCTGTGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081872165_1081872169 4 Left 1081872165 11:46388143-46388165 CCGCTCCACAGACGCACGCGGGC No data
Right 1081872169 11:46388170-46388192 CACAGCCACGCCAGCCCAGCAGG No data
1081872165_1081872172 13 Left 1081872165 11:46388143-46388165 CCGCTCCACAGACGCACGCGGGC No data
Right 1081872172 11:46388179-46388201 GCCAGCCCAGCAGGCATGGTCGG No data
1081872165_1081872171 9 Left 1081872165 11:46388143-46388165 CCGCTCCACAGACGCACGCGGGC No data
Right 1081872171 11:46388175-46388197 CCACGCCAGCCCAGCAGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081872165 Original CRISPR GCCCGCGTGCGTCTGTGGAG CGG (reversed) Intergenic
No off target data available for this crispr