ID: 1081872658

View in Genome Browser
Species Human (GRCh38)
Location 11:46390643-46390665
Sequence CTCGAGGGCCGTGTTTTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081872645_1081872658 26 Left 1081872645 11:46390594-46390616 CCTGTGACCAAAGTGGGGACCCA No data
Right 1081872658 11:46390643-46390665 CTCGAGGGCCGTGTTTTCCTAGG No data
1081872646_1081872658 19 Left 1081872646 11:46390601-46390623 CCAAAGTGGGGACCCAGTTTCTC No data
Right 1081872658 11:46390643-46390665 CTCGAGGGCCGTGTTTTCCTAGG No data
1081872650_1081872658 6 Left 1081872650 11:46390614-46390636 CCAGTTTCTCACGCTAGGGTCGG No data
Right 1081872658 11:46390643-46390665 CTCGAGGGCCGTGTTTTCCTAGG No data
1081872649_1081872658 7 Left 1081872649 11:46390613-46390635 CCCAGTTTCTCACGCTAGGGTCG No data
Right 1081872658 11:46390643-46390665 CTCGAGGGCCGTGTTTTCCTAGG No data
1081872644_1081872658 27 Left 1081872644 11:46390593-46390615 CCCTGTGACCAAAGTGGGGACCC No data
Right 1081872658 11:46390643-46390665 CTCGAGGGCCGTGTTTTCCTAGG No data
1081872643_1081872658 28 Left 1081872643 11:46390592-46390614 CCCCTGTGACCAAAGTGGGGACC No data
Right 1081872658 11:46390643-46390665 CTCGAGGGCCGTGTTTTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081872658 Original CRISPR CTCGAGGGCCGTGTTTTCCT AGG Intergenic