ID: 1081872665

View in Genome Browser
Species Human (GRCh38)
Location 11:46390679-46390701
Sequence CGACCACGGCGGAGACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081872665_1081872671 -4 Left 1081872665 11:46390679-46390701 CCTCCATGTCTCCGCCGTGGTCG No data
Right 1081872671 11:46390698-46390720 GTCGAAGGAGCCCTGGCTCTCGG No data
1081872665_1081872672 -3 Left 1081872665 11:46390679-46390701 CCTCCATGTCTCCGCCGTGGTCG No data
Right 1081872672 11:46390699-46390721 TCGAAGGAGCCCTGGCTCTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081872665 Original CRISPR CGACCACGGCGGAGACATGG AGG (reversed) Intergenic
No off target data available for this crispr