ID: 1081874945

View in Genome Browser
Species Human (GRCh38)
Location 11:46402066-46402088
Sequence CTGGGGGACCAGAGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 478
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 429}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081874945_1081874955 3 Left 1081874945 11:46402066-46402088 CCCACTTCTCTCTGGTCCCCCAG 0: 1
1: 0
2: 1
3: 47
4: 429
Right 1081874955 11:46402092-46402114 GAAGGGGATGCTCCTTCTCTGGG 0: 1
1: 0
2: 1
3: 18
4: 195
1081874945_1081874954 2 Left 1081874945 11:46402066-46402088 CCCACTTCTCTCTGGTCCCCCAG 0: 1
1: 0
2: 1
3: 47
4: 429
Right 1081874954 11:46402091-46402113 AGAAGGGGATGCTCCTTCTCTGG 0: 1
1: 0
2: 0
3: 25
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081874945 Original CRISPR CTGGGGGACCAGAGAGAAGT GGG (reversed) Intronic
901784527 1:11616097-11616119 CTGAGGGAGCAGAGGGCAGTGGG - Intergenic
902205231 1:14863563-14863585 TTGGGGGATCAGAGAGGAATTGG + Intronic
902511421 1:16968992-16969014 ATGGAGGCCCAGAGAGAAGTGGG + Intronic
902541098 1:17155382-17155404 CAGGAGGACCAGAGAGACCTTGG + Intergenic
902611981 1:17602930-17602952 CTAGGGGTCTAGAGAGAGGTGGG + Intronic
903389407 1:22953550-22953572 CGGGGGCACCAGCGAGAAGGTGG + Exonic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
904817094 1:33212128-33212150 CAGGAGGAACAGAGAGAAGGCGG - Intergenic
904817859 1:33219354-33219376 TCGGCGGACCAGAGACAAGTTGG + Intergenic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905873233 1:41416675-41416697 CGGGGGCACGAGAGAGATGTGGG - Intergenic
906034085 1:42740159-42740181 CAGGGGGAGCAGCGAGAAGGAGG + Exonic
906320151 1:44810590-44810612 CTGGAGGAACTGAGAGAGGTGGG + Exonic
906353544 1:45083867-45083889 CAGGAGGAAGAGAGAGAAGTGGG + Intronic
906500741 1:46340529-46340551 TTGGGGGACCAGGGAGGATTAGG - Exonic
907281750 1:53351581-53351603 CAGCGGGAACAGAGAGAAGAGGG - Intergenic
907518666 1:55009140-55009162 CTGGAGGAGCAGAGAGAATGAGG - Exonic
907718190 1:56947373-56947395 CTTGGGGAACAGTGAAAAGTTGG - Intronic
907875951 1:58488774-58488796 CAGGGGAAACAGTGAGAAGTGGG - Intronic
908342958 1:63201286-63201308 CTGGGGGATGACAGAGAAGGGGG - Intergenic
909382046 1:75009878-75009900 CAGGAGGAAGAGAGAGAAGTAGG - Intergenic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
910188455 1:84571025-84571047 GTGAAGGACCAGAGAGTAGTAGG + Intronic
910863851 1:91769411-91769433 GTGTGTGCCCAGAGAGAAGTTGG - Intronic
911164618 1:94713725-94713747 CTGGGAGAACAGAGAGAATAAGG - Intergenic
911438127 1:97888696-97888718 CAGAGAGACCAGAGAGAAGTGGG + Intronic
912084535 1:105982273-105982295 CTGGGGGAGCTGTGAGAAGAGGG + Intergenic
912856049 1:113169642-113169664 CTGGGGTAACAAAGAGAAGGGGG + Intergenic
912947379 1:114096287-114096309 CTGGGGGAGCTGAGAGATGAGGG + Intronic
913081484 1:115391570-115391592 CCTGAGGACCAGAGAGTAGTGGG - Intergenic
913483506 1:119312321-119312343 ATGGGGGAGCAGGGAAAAGTGGG + Intergenic
914827505 1:151146324-151146346 CTAGGGGACCAGGGAGGTGTCGG - Intronic
915107734 1:153544926-153544948 CTGGGGGAGCCCAGAGCAGTGGG + Intronic
915115318 1:153594915-153594937 CTGATGGACCAGAGAGAGGAAGG - Intergenic
915346540 1:155200402-155200424 CTGGGGGACCTGTGAGAATTTGG - Intronic
916699090 1:167272601-167272623 CAGGAGGAAGAGAGAGAAGTAGG + Intronic
918396745 1:184121203-184121225 CTGGTCCTCCAGAGAGAAGTAGG + Intergenic
918780614 1:188695214-188695236 AAGGGGGACTAAAGAGAAGTAGG - Intergenic
920852030 1:209634525-209634547 CTGGCGGACCCGAGGGAAGGTGG + Exonic
922366589 1:224870872-224870894 ATGGGGGAATAAAGAGAAGTTGG + Intergenic
922561065 1:226569979-226570001 CTGAGGGACCAGTGAGCTGTGGG - Intronic
922909900 1:229206575-229206597 CTCAGGGTCCAGAGAGAAGAGGG - Intergenic
1062955604 10:1538459-1538481 CTGGTAGACGAGAGAGAAGTGGG + Intronic
1063985911 10:11501682-11501704 CTGAGAGACCAGTGAGAAGGTGG - Intronic
1064946315 10:20793977-20793999 CTGGGGGAAAAGAGGGAATTGGG - Intronic
1065954757 10:30683920-30683942 CTGGGGGACCTGCTAGAAGAAGG + Intergenic
1066658962 10:37721069-37721091 GTGGGGGCCCAGTGAGAAGGAGG + Intergenic
1067038714 10:42936971-42936993 CTGGGAGACCATAGGGAAGTGGG + Intergenic
1067261687 10:44698616-44698638 CTGCAGAACCAGCGAGAAGTTGG + Intergenic
1067271244 10:44793048-44793070 CTGGCTGTCCAGGGAGAAGTGGG - Intergenic
1067514705 10:46928566-46928588 CTGGGGGCTCAGAGGGAAGCAGG - Intronic
1067541846 10:47160593-47160615 CTGAGGGACCAGAGAGCACAAGG + Intergenic
1067647551 10:48123247-48123269 CTGGGGGCTCAGAGGGAAGCAGG + Intergenic
1068639859 10:59391397-59391419 CTTAGGGAGCTGAGAGAAGTGGG - Intergenic
1069058738 10:63871747-63871769 CTGGAGGGCAAGAGGGAAGTGGG + Intergenic
1069345271 10:67462171-67462193 TTGAGGGAACAGAGAGAATTAGG - Intronic
1069869377 10:71523912-71523934 CTTGGGGACCACAAAGAAGGTGG - Intronic
1070187164 10:74075587-74075609 CTGGGGGAACAGAGATACTTGGG + Intronic
1070746246 10:78935749-78935771 CTGATGGACCAGAGAGGGGTGGG + Intergenic
1070772954 10:79093014-79093036 CTGGGGGTTCAAAGAGCAGTGGG + Intronic
1071398746 10:85248739-85248761 CTTGGGAACCAGAGAGATTTGGG - Intergenic
1071782070 10:88856887-88856909 CTGAGGGAACAGAGTGAGGTTGG - Intergenic
1073053941 10:100687202-100687224 CCAGGGGACCAGAGGGCAGTTGG - Intergenic
1073323330 10:102628605-102628627 CTGGGGGAGCAGAGGAAAGTAGG + Intronic
1073326684 10:102647410-102647432 CTGGGGCACCAGAAAGAATCAGG - Intronic
1073510548 10:104039991-104040013 CTGGGGGACCTGAGGGAAAAAGG + Exonic
1074200763 10:111233167-111233189 CAGAGGAACCAGAGAGAAGATGG - Intergenic
1075291792 10:121237079-121237101 CTGGGCCACCACAGAGCAGTGGG + Intergenic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076279000 10:129229494-129229516 CTTGGGAACCACAGAGAAGTGGG + Intergenic
1076500598 10:130933316-130933338 CTGGGAGACCAGGGAGGTGTTGG + Intergenic
1076607032 10:131695790-131695812 CTGGGGGGACAGAGAGATGCAGG + Intergenic
1077846667 11:6032653-6032675 CTGGTGGACTAGAGGGAAGCGGG + Intergenic
1077921377 11:6644329-6644351 GTGAGGGACCATGGAGAAGTTGG - Intronic
1078603201 11:12751437-12751459 CTGTGGGAACACAGAGGAGTGGG + Intronic
1078674099 11:13393300-13393322 GAGGAGGACCAGAGAGAACTTGG - Intronic
1078800752 11:14642897-14642919 ATGGGGGAGCGGAGAGAACTAGG - Intronic
1079135232 11:17772736-17772758 CTGGGGGCCCAGGGAGATGCTGG + Intronic
1079736197 11:23999808-23999830 CTGGATGACCAGGCAGAAGTTGG - Intergenic
1079816925 11:25072921-25072943 CAGGAGGACCAGAGAGACCTTGG + Intronic
1081724950 11:45321546-45321568 CTGGGGGTCCAGCGAGAAGGTGG - Intergenic
1081874945 11:46402066-46402088 CTGGGGGACCAGAGAGAAGTGGG - Intronic
1082003445 11:47407323-47407345 CTGGGCCACCAGGGAGAAGTTGG + Intronic
1085313160 11:75527900-75527922 CTGATGGAGCTGAGAGAAGTTGG - Intergenic
1085777541 11:79380047-79380069 CTGGTGGGGCAGAGAGAAGCAGG + Intronic
1087871304 11:103295934-103295956 CAGGAGGACCAGAGAGACCTCGG - Intronic
1088475636 11:110235885-110235907 CTGGGGGACCAGAGAGTTGTCGG - Intronic
1088695333 11:112361441-112361463 CTGGGGGAACAAAAAGAAGGAGG + Intergenic
1089596031 11:119580841-119580863 CTGGGTGATCAGCGAGGAGTTGG - Intergenic
1089750600 11:120648563-120648585 CTGGCTGCCCAGAGAGAAGCTGG - Intronic
1090333982 11:125950787-125950809 GTAGGGGAGCAGGGAGAAGTGGG - Intergenic
1090528059 11:127559191-127559213 CTGGAGCTCCAGGGAGAAGTTGG + Intergenic
1091315886 11:134613802-134613824 CTGTGGGGCCAGAGAGCACTGGG + Intergenic
1091657952 12:2359607-2359629 CTTGGGGACTGGAGAGAACTTGG + Intronic
1092709710 12:11322797-11322819 CTTGGGGACAAGAGAGAATATGG + Intergenic
1096365896 12:51027898-51027920 CTCGGGGACCAAAAAAAAGTGGG + Intronic
1096390998 12:51229006-51229028 CTGAGGGACCAGAGAGAGGCAGG - Intergenic
1096562045 12:52442740-52442762 CTGGGGGAGGAGAGAACAGTCGG + Intergenic
1096898234 12:54846602-54846624 CTGGGGAAACAATGAGAAGTAGG + Intronic
1097093187 12:56523972-56523994 CTGGGTAACCTGAGAGAACTAGG - Intronic
1097722760 12:63041383-63041405 GTGGGGAAACAGAGAGAAGCTGG + Intergenic
1097887844 12:64747890-64747912 CTGGGGCAGCAGAGAGCACTTGG + Exonic
1099222929 12:79935299-79935321 CTGGGCCACCAGAGGGAAGCGGG + Intronic
1099587010 12:84532059-84532081 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
1099951120 12:89304864-89304886 TTTGGGGATCAGACAGAAGTGGG + Intergenic
1100376628 12:94022432-94022454 CGGGGAGACCAGTGAGAAGATGG + Intergenic
1100682612 12:96944547-96944569 CTGGGACAAAAGAGAGAAGTAGG + Intronic
1101805787 12:108062405-108062427 CTGGGGCACCTGAGAGCAGCAGG - Intergenic
1104610805 12:130226179-130226201 CTGGGGGACCAGCAGGACGTGGG - Intergenic
1106304416 13:28496613-28496635 CTGGGGGACCAGCAAGGAGAAGG - Intergenic
1106876824 13:34083419-34083441 TTGGGGGATGAGAGAGAAGAAGG + Intergenic
1108150358 13:47527406-47527428 CTGGGGGACCTGAGGGACCTGGG - Intergenic
1109319510 13:60792614-60792636 CTGTGGGACCAGAGTGAAATGGG - Intergenic
1110371304 13:74743559-74743581 CCTGGGGACCAGGGGGAAGTGGG - Intergenic
1111144166 13:84158299-84158321 CTGAGGGACCTGAGTGAAGGAGG - Intergenic
1112103726 13:96218177-96218199 CTGTGTCCCCAGAGAGAAGTGGG + Intronic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1113488795 13:110676310-110676332 CAAGGGGACCAGGGAGAAGGCGG + Intronic
1113601919 13:111575620-111575642 TCTGGGGACCAGAGAGAAGATGG - Intergenic
1113693306 13:112327159-112327181 CTGGGGGATCACACAGCAGTGGG - Intergenic
1114484969 14:23056949-23056971 GCTGGGGACCAGAGAGAAGGCGG + Intronic
1115165096 14:30439360-30439382 CTGGGGGAGAAGAGAGGAGGGGG - Intergenic
1115906503 14:38208691-38208713 CTGCGGGACGGGAGAGAAGCTGG + Intronic
1117313472 14:54551267-54551289 CTGGGGAAACAAAGTGAAGTTGG - Intergenic
1117561584 14:56945632-56945654 CTTGGAGGCCACAGAGAAGTAGG + Intergenic
1118227018 14:63911148-63911170 CTGGCGGACCAGGGAGAATATGG - Intronic
1118346410 14:64944378-64944400 CTGGAGGCCCAGAGAGTACTAGG - Intronic
1118462540 14:66000059-66000081 CAGGAGGACCAGAGAGACCTTGG - Intronic
1118840017 14:69502862-69502884 CAGAGGGAGCAGAGAGAGGTAGG + Exonic
1119002092 14:70891558-70891580 CTGCAGGAGCAGAGAGAAATAGG + Intergenic
1119401452 14:74365405-74365427 CTGGGGGAACAGAGATAGGAGGG + Intergenic
1121509349 14:94500792-94500814 CTGGGGGTCCAGAGGCAAGGTGG - Intronic
1122042604 14:98999690-98999712 CGGGGGGCCCAGAGGGAAGCCGG - Intergenic
1122393717 14:101407965-101407987 CTGGGGGTACAGAGAGAAATTGG - Intergenic
1122922653 14:104886374-104886396 CTGCGGGCCCAGAGAGCAGCAGG + Exonic
1122987487 14:105219233-105219255 CTGGGCGAGCACAGGGAAGTGGG + Intronic
1124072861 15:26411964-26411986 CTGGGGGAGAAGAGAACAGTGGG + Intergenic
1124556385 15:30729573-30729595 ATGGGGGAAGAGAGAGAATTTGG - Intronic
1125368163 15:38941638-38941660 CTGGGGGACAAGAGTACAGTGGG - Intergenic
1125933346 15:43615603-43615625 CTGGGAGACTGGAGAGCAGTAGG + Exonic
1125946444 15:43715065-43715087 CTGGGAGACTGGAGAGCAGTAGG + Intergenic
1126598446 15:50404910-50404932 CGGGGAGATCAGTGAGAAGTGGG - Intergenic
1127766724 15:62193067-62193089 CTGGGAAACAAGAGAGAATTTGG - Intergenic
1128547416 15:68577839-68577861 CTGGGGGAACAGAGAGGAGATGG - Intergenic
1129043832 15:72715045-72715067 CTGGGAGTAGAGAGAGAAGTAGG + Intronic
1129224921 15:74163641-74163663 CTTCGGGATCAGAGAGATGTGGG + Intergenic
1129692005 15:77719075-77719097 CGGAGGGTCCAGAGAGAACTGGG + Intronic
1130220826 15:82018141-82018163 CTGTGTGTCCAGGGAGAAGTGGG + Intergenic
1130693466 15:86106347-86106369 CTGGGGGAGCATGGAGAAGGAGG + Intergenic
1130960558 15:88656061-88656083 CTGTGGAGTCAGAGAGAAGTAGG + Exonic
1132103080 15:99041525-99041547 CTGGGTAACCAGATAGCAGTTGG + Intergenic
1132210510 15:100018535-100018557 CAGGAGGAAGAGAGAGAAGTGGG - Intronic
1132336469 15:101051424-101051446 CTGGGGGGCCTGAGAGGAGTGGG - Intronic
1132396573 15:101479369-101479391 CTGGGTGAGCACAGAGCAGTGGG + Intronic
1132408822 15:101561525-101561547 CTGGGGGACAAGGGAGCAGGCGG + Intergenic
1133333293 16:4989671-4989693 CTGGAGGACCCAAGAGGAGTTGG - Intronic
1133895997 16:9929499-9929521 CTGTGGATTCAGAGAGAAGTGGG - Intronic
1134316891 16:13127109-13127131 CTGAGGGAACAGAGAGAGGGAGG + Intronic
1134811445 16:17170422-17170444 CTGGGGACCCAAAGAGAAATAGG - Intronic
1135522157 16:23185994-23186016 CTGGGGGCCGTAAGAGAAGTAGG + Intronic
1135880519 16:26251259-26251281 CTGAGGGAGCAGAGAAAAGAAGG - Intergenic
1136053340 16:27669303-27669325 CTGGGGATCCAGGGAGAAGGTGG - Intronic
1136109695 16:28057076-28057098 CTGTGGGGGCAGAGAGGAGTGGG + Intronic
1136251662 16:29009434-29009456 TTGGGGGATCAGAGAGATATTGG + Intergenic
1136690953 16:32028641-32028663 CTGGATGTCCAGAGAGAAGATGG - Intergenic
1138443140 16:57047045-57047067 CTGGAGGCCTAGAGAGAGGTGGG - Intronic
1139633450 16:68244546-68244568 CTGGGGAACCAGAGAGGACATGG - Intergenic
1140103671 16:71939750-71939772 CTGGGAGAAGAAAGAGAAGTTGG + Intronic
1140739470 16:77928233-77928255 CCTGGTGACCAGAGAGATGTTGG - Intronic
1140899386 16:79353945-79353967 CATGGAGACCAGAGATAAGTGGG + Intergenic
1141433014 16:83980638-83980660 GTGGGGGATCAGACAGACGTGGG + Intronic
1142694031 17:1623594-1623616 CTGGAGGAGAGGAGAGAAGTGGG - Intronic
1143034300 17:3985741-3985763 CTGGGGGAGCAGGGAGCAGAGGG + Intergenic
1143105819 17:4530169-4530191 CTGAGGGCCCAGTGTGAAGTGGG - Intronic
1143916117 17:10294704-10294726 CAGGAGGAAAAGAGAGAAGTGGG + Intergenic
1144249715 17:13403486-13403508 CTGGGGTACCAGAAGGAAGGTGG - Intergenic
1144316054 17:14062625-14062647 CTGGGGAAACAAAAAGAAGTTGG - Intergenic
1144765111 17:17728341-17728363 CTTGGAGACCAGAGGGAAGACGG - Intronic
1144772843 17:17769470-17769492 CTGGAGGAGCAGAAAGTAGTAGG + Intronic
1146013819 17:29216800-29216822 TTGGGGGGCGAGGGAGAAGTAGG + Intergenic
1146954712 17:36930803-36930825 CTGGTGGTCCAGAGAGAGCTGGG - Intergenic
1146976016 17:37112684-37112706 TGGGGGGACAAGAGAGAAGCGGG + Intronic
1147054799 17:37825893-37825915 CACGGGGACCAAAGAGAAGGAGG - Intergenic
1147121392 17:38337321-38337343 CTGGGGCTCCAGGGACAAGTGGG + Intronic
1147833731 17:43315365-43315387 CCGGGGCCACAGAGAGAAGTCGG - Intergenic
1148849594 17:50548219-50548241 CTGGGGGGCCTGGGAGAAGGTGG + Intronic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1149535702 17:57431817-57431839 CTGGGGGCAGAGAGTGAAGTGGG - Intronic
1150250852 17:63703752-63703774 CTGGGGGAGAAGAGAGAGGTGGG + Intronic
1150321382 17:64217256-64217278 CTGGGAGGACAGAGAGAAGAGGG - Intronic
1151274853 17:73026626-73026648 CTGGGGGAAAAGATAAAAGTAGG + Intronic
1153443826 18:5150619-5150641 CTGGGTGATCATAGAGAAGCAGG - Intronic
1154065391 18:11102639-11102661 CTGGGGGCCCAATGGGAAGTGGG - Intronic
1154333495 18:13448655-13448677 CTGGGGGACCACCGATAAGGCGG + Intronic
1156316501 18:35973569-35973591 CTGGGGGAGGAGAGAGAGTTAGG - Intronic
1156569205 18:38233500-38233522 CGGGTGGTCCAGAGAGAAGATGG + Intergenic
1156734853 18:40243465-40243487 CTGGGGAAACAGGGAGATGTTGG - Intergenic
1157585672 18:48799696-48799718 CTGGGTGCACAGAGAGAGGTGGG - Intronic
1157649849 18:49317443-49317465 ATGGGGCAACAGTGAGAAGTGGG + Intronic
1157698037 18:49739240-49739262 CAGGCAGACCAGAGTGAAGTTGG + Intergenic
1158499178 18:57984486-57984508 CTGTGGGACAAGAGAGCAGCTGG - Intergenic
1158606243 18:58898802-58898824 CTGGGGTACCAGAGAAAAAGTGG - Intronic
1158615898 18:58986858-58986880 AAGGGGGACTAGAGAGAACTGGG + Intergenic
1159002961 18:62989315-62989337 CTGGGGGAACTGGGACAAGTTGG - Intergenic
1159471445 18:68861734-68861756 CTGGGGGCCCACAGAGTATTCGG - Intronic
1159748303 18:72268048-72268070 CTGGAGGACGAGAGAAAAGTAGG - Intergenic
1160078830 18:75703886-75703908 CTGGGGGTGCAGAGAGCTGTGGG + Intergenic
1160837527 19:1131819-1131841 CTGGGGGACCCGAGCGGAGTGGG - Intronic
1160883576 19:1334137-1334159 CTGGGGGGCAAGAGAGAGGCTGG + Intergenic
1161288124 19:3479141-3479163 CTGGGGGCCCAGAGAGGGGAGGG + Intronic
1161458408 19:4381556-4381578 CAGGGGGAACAGAGAGAGGCAGG - Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161742046 19:6027358-6027380 CTGGAGGACCAGGGGAAAGTAGG + Intronic
1165064076 19:33219063-33219085 ATGGCTGACCAGAGAGATGTAGG + Intronic
1165119347 19:33549150-33549172 CTGGAGGATCAGAGAGAAATGGG - Intergenic
1165141747 19:33704000-33704022 CTGGGGTCCCAGAGGGAAGTCGG + Intronic
1165155187 19:33782546-33782568 ATCTGGGACCACAGAGAAGTGGG + Intergenic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166650031 19:44566160-44566182 ATGGGGGAAAAGAGGGAAGTGGG + Intergenic
1166665966 19:44680621-44680643 CTGGGAGACCAGTGAGGAGCTGG - Intronic
1166717487 19:44977683-44977705 CTCAGGGACCAGAGAGAAATTGG + Intronic
1166879704 19:45920344-45920366 CTGGGGGTCCAGAGACGAGTGGG + Intergenic
1167371032 19:49082138-49082160 CTGGGTGTCCAGGCAGAAGTCGG + Intergenic
1167529764 19:50007984-50008006 TTGGGGCACCAGATAGGAGTCGG + Intronic
1168692632 19:58386188-58386210 CTGGGGGAAGGGACAGAAGTTGG + Intergenic
925188697 2:1866401-1866423 GTGGGGGAGGAGAGAGAAGGAGG + Intronic
925482468 2:4291593-4291615 CAGGAGGAACAGAGAGAAGGGGG - Intergenic
926369839 2:12168663-12168685 CAGGGGGCCCAGAGAGAAGAAGG + Intergenic
926606709 2:14905494-14905516 CAGGGGCACCAGAGAGAGTTGGG - Intergenic
926912520 2:17864348-17864370 CTGAGGGACCAGTGAGCAGGAGG + Intergenic
927256530 2:21044580-21044602 CTGGGGGAGGAGAGAGAAGGGGG + Intergenic
927395672 2:22648185-22648207 CTGGAGGAAGAGAGAGAAGTGGG - Intergenic
927395968 2:22651582-22651604 CTGGGGCAGCACAAAGAAGTAGG + Intergenic
927404900 2:22755687-22755709 CTGAGGATCCAGAGAGAAATGGG - Intergenic
927928703 2:27030386-27030408 CTGGGAGACCAGTGAGAGGGTGG - Intergenic
927972029 2:27311907-27311929 AAGGGGGACCAGGTAGAAGTTGG + Exonic
928615435 2:33034001-33034023 CTGGGGGACAGGAGAGCAGATGG + Intronic
929158768 2:38811261-38811283 CTGGGGGGCCAGCGAGTAGCAGG + Intronic
929884072 2:45863015-45863037 CTGGAGGAGAAGAGAGCAGTTGG + Intronic
930446449 2:51479614-51479636 CTGGGGGAATAGAGAGGATTGGG + Intergenic
931085114 2:58821419-58821441 CTTGGGGAGCAGAGAAAAGGAGG + Intergenic
931216944 2:60254179-60254201 CAGGGGGACCAGCCAGAAGTTGG - Intergenic
931630886 2:64297647-64297669 CTGGGGGCCAGGAGAGATGTGGG - Intergenic
931981031 2:67694489-67694511 GTGGGGGAGGAGAGAGGAGTGGG + Intergenic
932234217 2:70108310-70108332 GAGGGGGCCCAGAGAGCAGTGGG + Intergenic
932471564 2:71962716-71962738 CTGGGGGGCCAGAGAACTGTGGG - Intergenic
933452850 2:82478780-82478802 CTGGGGAAGAAGAGAGAACTAGG - Intergenic
933605170 2:84375108-84375130 CTCAGGGACTAGAGAGAACTGGG + Intergenic
934014478 2:87864461-87864483 CTGGGGGACCAGAAAGAGAGTGG - Intergenic
935224511 2:101041528-101041550 TTGGGGGAAGAGAGAGAAATGGG + Intronic
935534202 2:104274037-104274059 CTGGTGGACCAGGGAGGAGCTGG + Intergenic
935606286 2:104974957-104974979 CTTTGGGACCACAGAGATGTGGG - Intergenic
935947814 2:108301902-108301924 CTAGGGGACTGGAGTGAAGTTGG + Intronic
936407095 2:112214545-112214567 CAAGGGGAGCAGAGGGAAGTAGG + Exonic
937087152 2:119179030-119179052 CTGAGGCTCCAGAGAGATGTTGG + Intergenic
937712204 2:124990817-124990839 CTAGGACACCAGACAGAAGTTGG - Intergenic
938771751 2:134506806-134506828 TTGGGGGACCAGAGACGGGTGGG + Intronic
939101873 2:137904451-137904473 ATGGCGGAACAGAAAGAAGTTGG + Intergenic
940039920 2:149349328-149349350 CTGTAGGTACAGAGAGAAGTAGG + Intronic
940293261 2:152098426-152098448 CACGGGGGCCAGAGAGAAGCCGG + Intronic
940594788 2:155776658-155776680 CTGGGAGAACAGAGACAAGTAGG - Intergenic
943649947 2:190446583-190446605 TTGGGGGATCAGAGAGAGGGAGG + Intronic
944645246 2:201773418-201773440 GTGGGGGACCAAGGAGAAGCAGG + Intronic
945892740 2:215447533-215447555 CTGGGGGTCCAGACTGAATTTGG - Intergenic
946334242 2:219027035-219027057 CTTGGGGCCCAGAGAAAAGTAGG - Intronic
946615477 2:221504985-221505007 CTGGGGGAACAAATAGAAGTTGG - Intronic
946677513 2:222177458-222177480 CTGGGAGACTAGAGAGAGATAGG + Intergenic
948103113 2:235391147-235391169 CTGGGGGACCACACAGGAGATGG + Intergenic
948530307 2:238599861-238599883 GTGGGGGACAGGAGAGCAGTGGG - Intergenic
948772137 2:240257084-240257106 ATCGGGGACCAGTGAGCAGTGGG - Intergenic
948784482 2:240345138-240345160 CTGGCCAACAAGAGAGAAGTGGG - Intergenic
948823934 2:240565411-240565433 CTGCACCACCAGAGAGAAGTAGG + Intronic
948991164 2:241554797-241554819 TTGTGTGACCAGAGAGAGGTCGG - Intergenic
1168796417 20:612671-612693 CAGGGGGGCCAGGAAGAAGTGGG - Intergenic
1168810520 20:701670-701692 GTGGGGGACCAGTGACAAGCTGG + Intergenic
1168860374 20:1042021-1042043 CTGAGGGATCAAAGAGATGTGGG + Intergenic
1169932341 20:10847997-10848019 CTGGGGGGCAAGAGGAAAGTAGG - Intergenic
1170482363 20:16779085-16779107 CTGAGGAAGCAGAGAGAACTAGG + Intergenic
1171091606 20:22290684-22290706 CTGAAGGACCAGAGAGAGATAGG + Intergenic
1171500937 20:25592833-25592855 CTTAGAGGCCAGAGAGAAGTGGG + Intergenic
1172110453 20:32541635-32541657 GTGGGGGCCCAGAGAGAAGCTGG - Intronic
1172379549 20:34476680-34476702 GTGGGGGAACTGAGAGAACTTGG + Intronic
1173527657 20:43745296-43745318 CTGGGAGGAGAGAGAGAAGTAGG - Intergenic
1174526627 20:51176934-51176956 GTGGAGGAACAGAGGGAAGTGGG + Intergenic
1175925588 20:62469830-62469852 CTGCGGGACCAGAGGAAACTGGG + Intronic
1177149516 21:17440897-17440919 CTGGGGTGCTGGAGAGAAGTAGG - Intronic
1178758212 21:35373493-35373515 CTGGGTGAGCAGAGATAACTTGG + Intronic
1178998416 21:37429509-37429531 CAGGAGGAAAAGAGAGAAGTGGG + Intronic
1179088606 21:38242756-38242778 CTGGGGGAACACAGAGCAGGTGG - Intronic
1179410943 21:41162774-41162796 CTTTGGGACCAGAGGGAAGTAGG - Intergenic
1180173928 21:46078405-46078427 CGGGGGGTCCAGAGAGACGACGG + Intergenic
1180187075 21:46145340-46145362 CTGGGGCCCCAGTGAGAAGCGGG - Intronic
1180907139 22:19422401-19422423 GTGGGGGACCAGAGGGAGGGAGG - Intronic
1181331853 22:22098829-22098851 CTGGGGGACCACAGAAAACAGGG + Intergenic
1181535075 22:23537620-23537642 CTGGGGACCCAGAGAGAAGGAGG + Intergenic
1182512751 22:30830633-30830655 CTGGGGGACAGGTGAGGAGTGGG - Intronic
1183143014 22:35961903-35961925 GTTGGGGACCAGAGAGGAGGAGG - Intronic
1183167758 22:36160473-36160495 TTGGGGGCCCAGAGAGAGGGAGG + Intronic
1183465999 22:37980716-37980738 CTGGGAGACCAGGGAGAAAGAGG - Intronic
1183822881 22:40361090-40361112 CTTCGGGAACAGAGAGGAGTCGG + Intronic
1183828657 22:40406649-40406671 CTGGGCCACCTGAGAGAGGTTGG - Exonic
1184128347 22:42502726-42502748 CTGGGGGACAAAAGAGCTGTGGG - Intergenic
1184137139 22:42556041-42556063 CTGGGGGACAAAAGAGCTGTGGG - Intronic
1184266441 22:43349409-43349431 CTGGGAGTCCTGAGAGAAGCAGG - Intergenic
1184716980 22:46288038-46288060 CTGGAGACCCAGAGAAAAGTGGG + Intronic
949165296 3:933494-933516 GTGGGGGAGCTGAGAGAAGCAGG - Intergenic
949588183 3:5464238-5464260 CTGGGGGAGTAGAAGGAAGTGGG + Intergenic
950800782 3:15550443-15550465 CTGGTGGAGCTGTGAGAAGTGGG + Intergenic
951781522 3:26368596-26368618 GTGGGGGGACAGAGAGAAGCTGG + Intergenic
952342414 3:32457283-32457305 CTGTGGATCCAGTGAGAAGTAGG - Intronic
952883358 3:37998739-37998761 CTCAGGGACCTCAGAGAAGTCGG + Intronic
953384632 3:42499610-42499632 ATGGGGGAACAGAGAGTAGGAGG + Intronic
953821205 3:46208887-46208909 CTTGGGGAGCAGAGAGCAGAGGG - Intronic
958531038 3:95330370-95330392 CTGGGGGGCAAGTGGGAAGTGGG - Intergenic
960052105 3:113248950-113248972 CACCGGGAGCAGAGAGAAGTGGG + Intronic
960165870 3:114400692-114400714 CTGGGGGACCCTAGGGAAGGAGG + Intronic
960498541 3:118406859-118406881 CTAGGGGACCAGAGAGATGCTGG + Intergenic
961105168 3:124234723-124234745 CTGGGTGATCAGACAGAAATAGG - Intronic
961367191 3:126407524-126407546 CTGGTGGAGCAGAGAGACTTGGG - Intronic
961623737 3:128244655-128244677 CTGGGAGACCAAAGATGAGTAGG - Intronic
961816047 3:129550943-129550965 CCAGGGGACCAGAGAGAAGGTGG - Intronic
962299846 3:134229651-134229673 CTGGGGGAAGGGAGAGATGTTGG + Intronic
962884231 3:139608881-139608903 TTGGGAGACAGGAGAGAAGTGGG - Intronic
965841576 3:172911416-172911438 CTGGGGAATCAAAGAGAAGTTGG - Intronic
965966279 3:174494351-174494373 ATGGGGGAGCAGCTAGAAGTAGG + Intronic
966133408 3:176670628-176670650 GTGGGGGACCACAGGGAAGTGGG - Intergenic
966547127 3:181161894-181161916 CTGGAGCAAGAGAGAGAAGTGGG + Intergenic
968729829 4:2264467-2264489 CTGGGGGAGCAGGAAGGAGTTGG + Intergenic
968981959 4:3855054-3855076 GTCGGGAACCAGAGAGAAGTGGG + Intergenic
969515710 4:7647084-7647106 CCAGGGGACGAGAGGGAAGTAGG + Intronic
969573259 4:8022494-8022516 CTGGGGGGCCAGAATGAGGTGGG - Intronic
969670659 4:8588281-8588303 CTGGGGGAGCCAAGAGAAGGTGG + Intronic
971132319 4:23826329-23826351 CTGGTAGACCAGAGACTAGTAGG + Intronic
971262895 4:25073223-25073245 ATAGGGTATCAGAGAGAAGTGGG + Intergenic
971504558 4:27352055-27352077 CTGGGGAACCAGTGAAAACTGGG + Intergenic
973710093 4:53621297-53621319 CTCTGGGACCCCAGAGAAGTTGG + Intronic
973774079 4:54229922-54229944 CTGGGGGACCAGGGGGAGGTGGG + Intronic
975406517 4:73996615-73996637 ATAGGGGACCAGAGAGAGCTTGG - Exonic
976131882 4:81893179-81893201 ATGGGTCACCAGAGAGAAGCCGG + Intronic
976444566 4:85116023-85116045 CTGGGGGGACAGAGAGAGGCAGG - Intergenic
977355779 4:95943958-95943980 TTGGTGGACCAGTAAGAAGTGGG - Intergenic
978843056 4:113237228-113237250 CTGGGGGATGATAAAGAAGTAGG + Intronic
984704004 4:182834634-182834656 CTGGGGGACAGGAGAGGAGAAGG - Intergenic
984955711 4:185043442-185043464 CTGAAGAACCAGAGAAAAGTGGG + Intergenic
985993486 5:3583140-3583162 CTCAGGGACCAGTGAGCAGTAGG - Intergenic
987953589 5:24707748-24707770 TTGGGGGACCTGGGAGAGGTGGG - Intergenic
989404174 5:41042087-41042109 CTGGGGGATCAAAGACAGGTGGG - Exonic
990982402 5:61614051-61614073 GTGGGGGACCAGGGAAATGTTGG + Intergenic
991138390 5:63210217-63210239 CTGTGGGTCCAGAGAAAATTGGG - Intergenic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
993351830 5:86858977-86858999 CAGGAGGAAAAGAGAGAAGTGGG - Intergenic
993814326 5:92522510-92522532 CCTGGGGACCAGAGAGTAGAAGG + Intergenic
994744959 5:103666618-103666640 CTGTTGGGCCAGTGAGAAGTTGG - Intergenic
994900397 5:105762563-105762585 CTGGGGGAGCTGTGAGAAGAGGG - Intergenic
994973171 5:106769498-106769520 CTGGGGGTTCTGAGAGAAGGAGG + Intergenic
996093716 5:119376566-119376588 CTGGGGGAGCAGAAAGACGGGGG - Intronic
996390277 5:122952932-122952954 CTGGGACTCCAGAAAGAAGTAGG - Intronic
997365269 5:133321502-133321524 CAGGGGCACCAGGGAGGAGTGGG - Intronic
1000364227 5:160476307-160476329 CTGGGTGACCAGGGACAGGTGGG + Intergenic
1000561203 5:162791725-162791747 CTAGGGGAATAGAGAGAACTGGG - Intergenic
1000658787 5:163914799-163914821 CTGGGGGACAAGTGAAAAGAAGG - Intergenic
1001976850 5:176007178-176007200 CAGGGTGACCAGAGACAGGTGGG - Intronic
1002240578 5:177836602-177836624 CAGGGTGACCAGAGACAGGTGGG + Intergenic
1003261532 6:4521133-4521155 CTGAGGGAGCCGAGGGAAGTGGG - Intergenic
1005360185 6:25024078-25024100 CTGGGGGACCAGCGAGTACCAGG + Intronic
1006026220 6:31148729-31148751 CTGGGGGAGGAGAGAGAGCTAGG + Intronic
1006094350 6:31646603-31646625 CTGGGAGACCAGGGAGAAAGAGG - Intronic
1006283829 6:33078133-33078155 GTGGGGGAGCAGAGAGCAGAAGG + Intronic
1007770991 6:44192319-44192341 ATGGGGGGCAAGAGAAAAGTGGG - Intergenic
1007919404 6:45592826-45592848 CTTGGGGACCAGAGACAGATAGG - Intronic
1007962518 6:45973196-45973218 CTGTGGGACCAGTCAGATGTCGG + Intronic
1009905881 6:69868782-69868804 CTGGAGGACCAGAAAGTAGATGG - Intronic
1011372802 6:86656694-86656716 GTGGGGGATGAGAGGGAAGTGGG + Intergenic
1011731119 6:90264830-90264852 CTGGGAGACCCGTGAGAGGTTGG + Intronic
1012945992 6:105466323-105466345 CTTTGGGACCAGATAGAAGCTGG - Intergenic
1013941574 6:115669475-115669497 TTAGGAGACCAGAGTGAAGTGGG + Intergenic
1014828608 6:126075482-126075504 CAGGGGGAAGAGAGATAAGTGGG - Intergenic
1015443622 6:133277337-133277359 TTTTGGGGCCAGAGAGAAGTTGG - Intronic
1016136004 6:140543988-140544010 CTGGAGAAAGAGAGAGAAGTGGG - Intergenic
1017103397 6:150866753-150866775 CTGCGGGCCCAGAGCGAACTGGG + Intronic
1017702429 6:157088315-157088337 CTGTGGGAACAAAGAGAAATGGG - Intronic
1018379290 6:163243226-163243248 CTGGGGGCCCAGGGAGACTTGGG - Intronic
1019050597 6:169180127-169180149 CTGGTGGAGCAGTGAGAAGAGGG - Intergenic
1019648041 7:2141451-2141473 CTGGGGGGCCACAGAGAACCCGG + Intronic
1019861491 7:3662537-3662559 CTGGAGGTCCAGAGAGAAGAAGG + Intronic
1021275272 7:18642360-18642382 CAGGGGAACCACAGAAAAGTAGG - Intronic
1021491155 7:21221034-21221056 CTGGGGGGCCAGTGAGTAGCAGG + Intergenic
1021543631 7:21788929-21788951 ATGGTGGACCAGAGAGAATGTGG + Intronic
1022663193 7:32385733-32385755 CAGGGGAACCAGAGAGAATTTGG + Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024402072 7:48935865-48935887 GTGGTAGAGCAGAGAGAAGTGGG + Intergenic
1024673401 7:51616880-51616902 CAGAGTGACCAGAGAGAACTGGG + Intergenic
1024799068 7:53054967-53054989 CTGGGGGAACTGGGAGAAGTTGG + Intergenic
1025233906 7:57220790-57220812 CTGGAGAACCAGAGAGGAGCCGG + Intergenic
1026223791 7:68423155-68423177 ATGGGGGAGAAGAGAGAGGTGGG + Intergenic
1026285447 7:68958744-68958766 CTGGGGGAGCAGGGAGGATTAGG - Intergenic
1027800924 7:82747850-82747872 CTGGAGGATCAGAGACAAGAAGG + Intergenic
1028940815 7:96520580-96520602 CTGGGGGACCAAGGAGAAGGAGG - Intronic
1029481575 7:100816669-100816691 CTGGGGGTACAGAGTGAAGCAGG + Intronic
1029538834 7:101171477-101171499 ATGAGGGGCTAGAGAGAAGTGGG + Exonic
1029799007 7:102926012-102926034 ATGGGGGACCAGAAAGAAGCAGG + Intronic
1030090279 7:105852147-105852169 ATGGGGGACTAGAGAGAGGCAGG - Intronic
1030791295 7:113732312-113732334 CTGTGGTATCAGAGTGAAGTGGG - Intergenic
1031363951 7:120881359-120881381 TTGGGGAACCAGAGAGACTTTGG - Intergenic
1031998250 7:128246909-128246931 CAGGGAGTGCAGAGAGAAGTGGG + Intronic
1032196163 7:129789844-129789866 CTGGTGGAACAGAGATAACTAGG - Intergenic
1034076980 7:148241525-148241547 CTGTGGGAGCACAGAAAAGTAGG + Intronic
1034415207 7:150961004-150961026 CTGGGGGGCCATAGAGGAGCTGG - Intronic
1036604487 8:10293630-10293652 TTGGGGAACCAGAGACACGTCGG - Intronic
1037565991 8:20118965-20118987 CAGGGGGAAGAGAGAGAAGGGGG - Intergenic
1037765656 8:21770797-21770819 TTGTGGGGCTAGAGAGAAGTGGG - Intronic
1038139070 8:24822745-24822767 CTAGGGGACCCGTGAGAAGAGGG + Intergenic
1041330216 8:56716229-56716251 CTGGGCCACTAGACAGAAGTGGG - Intergenic
1041664495 8:60429578-60429600 CAGGGAGACCTGTGAGAAGTTGG - Intergenic
1042310507 8:67374700-67374722 CAGGTGGACCAGAGAGAAGGTGG - Intergenic
1043973832 8:86563352-86563374 ATGGGGCACTGGAGAGAAGTGGG - Intronic
1044030569 8:87230109-87230131 CAGGAGGAACAGAGAGAAGAGGG + Intronic
1044457368 8:92403828-92403850 CTGGGGGATCTGAGTGAAGGGGG - Intergenic
1046681809 8:117178889-117178911 GTGGGGGAAGAGAGAGAAGAAGG + Intergenic
1046733371 8:117750084-117750106 CTTGGGGACCAAAGAGAATCAGG + Intergenic
1047025362 8:120817795-120817817 CTGCTGGAGCAGAGAGGAGTGGG - Intergenic
1047211252 8:122842266-122842288 CTGGGGGCCCTGAGAGAAGAAGG - Intronic
1047574485 8:126137768-126137790 CTGGGGGAAGAGAGTGAAGGGGG + Intergenic
1050766493 9:9141216-9141238 CGGGGGGAGGAGAGAGAAGGGGG - Intronic
1050828785 9:9984743-9984765 CTGGGGCAGCAGAGAGAATTAGG + Intronic
1051133885 9:13895484-13895506 CTAAGGAACCACAGAGAAGTTGG + Intergenic
1052009204 9:23385952-23385974 CTGGGGGACTACAGGGAAGGTGG + Intergenic
1052995346 9:34549149-34549171 GTCGGGGAGCAAAGAGAAGTAGG + Intergenic
1053018157 9:34675837-34675859 CTGGGGTGTCAGAGGGAAGTAGG + Intergenic
1054718693 9:68582367-68582389 CAGGGGGTCCAGGGAGAAGAAGG + Intergenic
1056042058 9:82678274-82678296 CTGGCTGACAAAAGAGAAGTAGG + Intergenic
1056545225 9:87607231-87607253 CTGGGGAACCAGACAGAACTGGG + Intronic
1056751737 9:89356931-89356953 CTGGTGCACCAGAGAGAGGATGG - Intronic
1056944561 9:90983508-90983530 CAGGGGGTGGAGAGAGAAGTAGG - Intergenic
1058765103 9:108174830-108174852 CTTGGGGGTCAGAGAGAAGGGGG - Intergenic
1059405193 9:114094957-114094979 CTGGGGGATCAGGCAGGAGTTGG - Intronic
1059456254 9:114402178-114402200 CTGGGGGTGCAGAGGGAAGCTGG + Exonic
1060097470 9:120804887-120804909 CAGGAGGACCAGAGAGACCTTGG + Intergenic
1060401928 9:123354422-123354444 CTGGGGGATCACTGAGAAGCTGG + Intergenic
1061245500 9:129399423-129399445 CTGGGGACCCTGAGAGAAGGAGG - Intergenic
1062315292 9:135964231-135964253 CTGGGGGAACAGAGAGAGGAGGG + Intergenic
1203544841 Un_KI270743v1:121156-121178 AAGCGGGACCAGAGAGAAGAGGG + Intergenic
1185843033 X:3410905-3410927 GTGAGGGCCCAGAGAGAAGACGG - Intergenic
1186210418 X:7244651-7244673 CTAGGGGAGAACAGAGAAGTTGG + Intronic
1186381888 X:9069593-9069615 CTGAGGCCCCACAGAGAAGTTGG - Intronic
1186664335 X:11702996-11703018 CTGGGGGACTAGAAAGAAAGAGG - Intergenic
1188928395 X:36074774-36074796 TTGAGGGACCCGAGAGATGTTGG - Intronic
1189318053 X:40069651-40069673 CAGAGGGACCTGGGAGAAGTGGG - Intronic
1193736839 X:85167234-85167256 CTGGGGAATCAGAGAGATGGGGG + Intergenic
1195416713 X:104628320-104628342 GAGGGGGAACAGAGAGAGGTTGG - Intronic
1195678223 X:107523620-107523642 CTGGGGGAGAAAAGACAAGTGGG - Intronic
1196442372 X:115728490-115728512 CTGGGGGACCAGGCAGGACTAGG - Intergenic
1196443185 X:115732414-115732436 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196443844 X:115735382-115735404 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196444330 X:115737515-115737537 CTGGGGGACCAGGCAGGACTAGG - Intergenic
1196445506 X:115844329-115844351 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196446177 X:115847310-115847332 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196446848 X:115850291-115850313 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196447516 X:115853274-115853296 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196448187 X:115856253-115856275 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196448856 X:115859244-115859266 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196449527 X:115862235-115862257 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196450196 X:115865218-115865240 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196450866 X:115868203-115868225 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196451537 X:115871182-115871204 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196452208 X:115874169-115874191 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196452878 X:115877138-115877160 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196453548 X:115880131-115880153 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196454217 X:115883140-115883162 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196455297 X:115888211-115888233 CTGGGGGACCAGGCAGGACTAGG + Intergenic
1196904722 X:120420008-120420030 CTTTGGCACCAGAGAGAACTGGG + Intergenic
1197455188 X:126670448-126670470 CTGGGGGAGCAGGGCGACGTGGG + Intergenic
1198285924 X:135191865-135191887 TTGGGGGATCAGGGAGAAATGGG + Intergenic
1199129999 X:144174011-144174033 CTGGGGGACCAGAAAGAGAGTGG + Intergenic
1199511672 X:148629876-148629898 CTGGGGGTTCACAGAGAAGAAGG - Intronic
1199966374 X:152824148-152824170 CGGGTGGACCAGAGAGATGGAGG - Intergenic
1201232162 Y:11875670-11875692 GTGAGGGCCCAGAGAGAAGACGG + Intergenic