ID: 1081877049

View in Genome Browser
Species Human (GRCh38)
Location 11:46415679-46415701
Sequence CTAGTTTAGCCCATCTTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081877049_1081877052 12 Left 1081877049 11:46415679-46415701 CCAAAAAAGATGGGCTAAACTAG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1081877052 11:46415714-46415736 AACACAACTTGGTCTGTGACAGG 0: 1
1: 0
2: 0
3: 9
4: 92
1081877049_1081877050 1 Left 1081877049 11:46415679-46415701 CCAAAAAAGATGGGCTAAACTAG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1081877050 11:46415703-46415725 TTTCTTAGTCCAACACAACTTGG 0: 1
1: 0
2: 0
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081877049 Original CRISPR CTAGTTTAGCCCATCTTTTT TGG (reversed) Intronic
900958622 1:5905086-5905108 CTGCTTTACCCCATCTTTTGTGG - Intronic
912203186 1:107481168-107481190 CTAGAGTAGCCAATGTTTTTAGG - Exonic
916779001 1:168002794-168002816 GTAAATTAGCACATCTTTTTTGG - Intronic
919107605 1:193172760-193172782 CAAGTTTAGGCCTTCTATTTAGG - Intronic
919364500 1:196639915-196639937 ATAGTTTACTTCATCTTTTTTGG + Intergenic
920697695 1:208194081-208194103 GTCGTTTACTCCATCTTTTTAGG + Intronic
1063570494 10:7210828-7210850 CCAGTTTCGCCCACCGTTTTTGG - Intronic
1063716897 10:8536656-8536678 CTATTTTATGCCATCATTTTTGG + Intergenic
1068645298 10:59459602-59459624 ATAGTTTAGCCCTTATATTTAGG + Intergenic
1069091693 10:64207155-64207177 CTAGTTTAGCCCAACTACTAAGG + Intergenic
1070220563 10:74438731-74438753 CTCCTTTACCCCCTCTTTTTAGG + Intronic
1076167562 10:128294658-128294680 CTAGTTTTGTCCACCTTCTTGGG + Intergenic
1079539001 11:21549655-21549677 CTGGTTGAGCCCAGCTTATTAGG - Intronic
1081877049 11:46415679-46415701 CTAGTTTAGCCCATCTTTTTTGG - Intronic
1089123760 11:116161757-116161779 CTAGATTATCCCATGATTTTTGG - Intergenic
1092430113 12:8401551-8401573 CTTGTCTAGCACCTCTTTTTAGG - Intergenic
1099136860 12:78916073-78916095 CTAGTTTTACCCATCATTTTTGG - Intronic
1100026872 12:90140903-90140925 CCAGGTTTGCCCATCTTTATTGG + Intergenic
1111298900 13:86320351-86320373 CTAGTTTAGCACTTCATGTTTGG - Intergenic
1112286567 13:98109925-98109947 CTAGTTTAGGTAGTCTTTTTTGG + Intergenic
1113913358 13:113855258-113855280 CAAGGTTAGCACATCTTCTTGGG - Intronic
1114716479 14:24831078-24831100 ACAGTTTAGCTCATCTGTTTAGG - Intronic
1119549114 14:75495335-75495357 CTAGCTTCCCCCATCCTTTTTGG + Intergenic
1121500744 14:94435139-94435161 CTATTTTAGACCATCTTAATAGG + Intergenic
1122489857 14:102107306-102107328 TTGGTTTAGCCCGTTTTTTTTGG + Intronic
1125087114 15:35743111-35743133 AGAGTTTAGCCAAACTTTTTAGG + Intergenic
1127257218 15:57302679-57302701 CTAGTTTAAGTCATCTCTTTCGG + Intergenic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1127943169 15:63721693-63721715 TTAGTTTTGTCCATTTTTTTTGG - Intronic
1128278547 15:66375005-66375027 CTGGCTTTGCCCATTTTTTTTGG + Intronic
1132777552 16:1604129-1604151 CCACTTTTGCCCATTTTTTTGGG - Intronic
1135183719 16:20296872-20296894 CTGGTTTAGACCTTCTTTTAAGG + Intergenic
1135717279 16:24782368-24782390 CTATTTTAGTCCAGCTTTTTTGG + Intronic
1138770998 16:59663704-59663726 CTTGTTTTGCCCATCTTTGAAGG + Intergenic
1139328920 16:66172693-66172715 CTTGTTTACCCCATGTGTTTTGG - Intergenic
1203126253 16_KI270728v1_random:1586261-1586283 TTATGTTAGCCCATCTTTTGAGG - Intergenic
1149474557 17:56948939-56948961 TTAGTTTAGACCAACTTATTTGG - Intronic
1149900158 17:60469066-60469088 CTAGTTTATCCCAGCACTTTGGG + Intronic
1150922839 17:69501416-69501438 CTCGTGTACCCCATCATTTTCGG + Intronic
1155970609 18:32079951-32079973 CTAGGTTAGTCCATTTTATTTGG - Intergenic
1158613461 18:58964272-58964294 CCAGTTTCTCCTATCTTTTTTGG + Intronic
1158847435 18:61459532-61459554 CTAGTTTAGGTCAACTTTTTGGG - Intronic
1161491904 19:4566887-4566909 CTAGTTTAGCTCTTCTTCCTGGG + Intergenic
1165778072 19:38416676-38416698 CTAGCTTAGCCCATCTTACAAGG + Intronic
1167055605 19:47110189-47110211 CTACTTGAACCAATCTTTTTTGG + Intronic
926388542 2:12363063-12363085 CCAGCTTAGCCCACCTTCTTCGG - Intergenic
927042645 2:19245303-19245325 CAAGGTCAGCCCATCTTTTAGGG - Intergenic
927406634 2:22777823-22777845 CTGGTTGGGCCCTTCTTTTTGGG - Intergenic
928167864 2:28983837-28983859 CAATTTTTGCCCATCTTTGTGGG + Intronic
928894942 2:36250373-36250395 CAAGTTTAAGCCATTTTTTTAGG + Intergenic
930567479 2:53040265-53040287 CTAGTTTAACCTATAGTTTTAGG - Intergenic
933497241 2:83065275-83065297 CTTCTTTAGCCCATCATTTTTGG - Intergenic
934633278 2:95954944-95954966 TTATGTTAGCCCATCTTTTGAGG - Intronic
937006491 2:118521267-118521289 CTCGCTAAGCCCATCATTTTTGG - Intergenic
939568321 2:143811189-143811211 CTAGTTTTGTACTTCTTTTTTGG - Intergenic
940091609 2:149925844-149925866 TTATTTTAGCCCTTCTCTTTTGG - Intergenic
940345304 2:152622528-152622550 CTTGATTGGCCCATCTTTTGTGG - Intronic
940913449 2:159229167-159229189 CTAGTTTAGTCCATATTTCAAGG + Intronic
942009806 2:171749765-171749787 CAACTTTAGTCCATATTTTTAGG + Intergenic
942891376 2:180993137-180993159 CTTGTTTATCACATCTGTTTTGG + Intronic
944748225 2:202679630-202679652 CTAATTTAGCCCCACTTTTAAGG - Intronic
945526644 2:210896205-210896227 TTAGTGCAGCCCATCATTTTAGG + Intergenic
947207816 2:227678258-227678280 CTAGTTTAGATCATGGTTTTAGG + Intergenic
1175004626 20:55669038-55669060 CATGTTTAGCCCATCCTTATAGG - Intergenic
1185254132 22:49822781-49822803 CTTGTTTACCACGTCTTTTTGGG - Intronic
951436495 3:22670858-22670880 CTAATTTAACCAATATTTTTGGG + Intergenic
953515756 3:43590692-43590714 CTAGGTTAACCCATGTTGTTTGG - Intronic
953658859 3:44875762-44875784 CTAGTTTCCACCTTCTTTTTTGG + Intronic
957073739 3:75585075-75585097 CTTGTCTAGCCCCTCTTTTGAGG - Intergenic
957536416 3:81510437-81510459 CTAGTTTAGCCCCTGTTCTTCGG - Intronic
959794444 3:110407099-110407121 CTAGCTTATCCAAACTTTTTGGG - Intergenic
963348301 3:144122913-144122935 CTAATTTAGGTCTTCTTTTTTGG + Intergenic
967300212 3:188005159-188005181 CTGATTCAGGCCATCTTTTTTGG + Intergenic
969064934 4:4471261-4471283 CTATTTTTGCCCATCTCTTGCGG - Intronic
972305858 4:37828903-37828925 CAAGTAAACCCCATCTTTTTTGG - Intronic
972527136 4:39925211-39925233 TGATTTTAGCCCATGTTTTTTGG - Intronic
977317235 4:95465599-95465621 GTAGATTTGCCCATCATTTTGGG + Intronic
977778045 4:100946121-100946143 CTAGTTTAGCAGATCTTAATTGG - Intergenic
978647036 4:110946707-110946729 GTAGTGTAGCCCATTCTTTTAGG + Intergenic
980185792 4:129459427-129459449 GTTATTTAGACCATCTTTTTTGG + Intergenic
984350069 4:178578947-178578969 CTCGGTTAGGCAATCTTTTTGGG + Intergenic
984597451 4:181686094-181686116 CTAGTTTTACTCATCTTTGTAGG + Intergenic
990193480 5:53287943-53287965 CTAATTTGGCCCATCTATTAAGG + Intergenic
992936849 5:81716206-81716228 CTATTTTAGCTGATTTTTTTTGG - Intronic
993641499 5:90410880-90410902 CAAATTTAGCCCATCCTTCTAGG - Intergenic
994132204 5:96242813-96242835 CTATTTTTGACCATCTTTTATGG - Intergenic
994301545 5:98154030-98154052 CTAGGTTATCCAATTTTTTTTGG - Intergenic
997742477 5:136269165-136269187 CTGCTTTAGCCCACATTTTTTGG - Intronic
999973082 5:156884286-156884308 CATTTTTAGCCCATCATTTTGGG + Intergenic
1005758009 6:28942950-28942972 GTAGTTTAGACCATCTTTTAAGG - Intergenic
1006292970 6:33154733-33154755 TTATTTTAGCCCCTGTTTTTTGG + Intergenic
1010375970 6:75170774-75170796 CTTGTTTAGTCCATCTTTAAGGG + Intronic
1010704049 6:79086832-79086854 TTAGGTTAGGCCTTCTTTTTGGG - Intergenic
1011078196 6:83460739-83460761 GGATTTTAACCCATCTTTTTTGG - Intergenic
1013581370 6:111537996-111538018 CTAGTTTTCACCATCTTTCTAGG + Intergenic
1014944375 6:127479141-127479163 CTTGTTTAGCATATCATTTTTGG - Intronic
1016968185 6:149738010-149738032 CTAATTTAGTTCATTTTTTTTGG - Intronic
1018444079 6:163839381-163839403 CTAGTTTAGTGCATCTGGTTGGG + Intergenic
1020618568 7:10490958-10490980 CTTGTTTAGCACTTCTTATTTGG - Intergenic
1021923517 7:25512068-25512090 CTAGTGCAGCCAATCTTTTACGG + Intergenic
1022915980 7:34953291-34953313 ATAGTTTATAGCATCTTTTTTGG + Intronic
1024726109 7:52197195-52197217 ATAGTTTAGCTCATATGTTTAGG + Intergenic
1030252000 7:107456875-107456897 CTAGTTTAGCCCTACTGTTAAGG - Intronic
1038261615 8:26001081-26001103 ACATTTTAGCACATCTTTTTAGG - Intronic
1039261419 8:35775786-35775808 CTAGTTGAGCCCTTCGTTCTTGG - Intronic
1041520781 8:58753748-58753770 CAAGTCTAGGCCATCCTTTTTGG + Intergenic
1046591999 8:116218127-116218149 CTAGTTTAGCCTGTCTTTGCAGG - Intergenic
1048118921 8:131556560-131556582 TTTGTTGAGACCATCTTTTTTGG - Intergenic
1051677571 9:19573602-19573624 CTGCTTTAGCCCAACATTTTAGG - Intronic
1053102170 9:35380305-35380327 CTAGGATAGCCCAACTTTCTTGG + Intronic
1054852377 9:69861301-69861323 CTATTTTAGCCTCTCCTTTTGGG + Intronic
1055322770 9:75098716-75098738 CTATTTTTCCCCATCTCTTTTGG + Intronic
1057321020 9:94012811-94012833 CTACTTAAGCCCATTGTTTTAGG + Intergenic
1057922411 9:99107855-99107877 TTAGTTTTGCCCCTTTTTTTGGG + Intronic
1058977607 9:110138933-110138955 CTAGTTAAACCCATCTGATTTGG + Intronic
1197943728 X:131816244-131816266 CTAGTTCAGGCCTTCTCTTTCGG + Intergenic
1201517404 Y:14833007-14833029 CTAGGTGAGCCCATCTCTTATGG - Intronic
1202587100 Y:26442614-26442636 TTATGTTAGCCCATCTTTTGAGG + Intergenic