ID: 1081877939

View in Genome Browser
Species Human (GRCh38)
Location 11:46423222-46423244
Sequence GATCTAAGCAGATCAACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081877939_1081877940 7 Left 1081877939 11:46423222-46423244 CCAGCTGTTGATCTGCTTAGATC 0: 1
1: 0
2: 2
3: 8
4: 95
Right 1081877940 11:46423252-46423274 TATTGAGTTTCTTCGACCCTAGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081877939 Original CRISPR GATCTAAGCAGATCAACAGC TGG (reversed) Intronic
901724399 1:11229459-11229481 GAACTAAACAGATGAAGAGCTGG + Intronic
907859243 1:58335402-58335424 GTTCTGAGCAAAGCAACAGCAGG + Intronic
908263766 1:62359085-62359107 GATCTAAGCAAGTCACCCGCAGG + Intergenic
908609185 1:65837021-65837043 AATATAAACAGATCAACTGCTGG + Intronic
910985455 1:93000593-93000615 CATGTAGGCAGGTCAACAGCAGG - Intergenic
913273954 1:117120364-117120386 GATCGAAGGAGATCAAGAACAGG + Intronic
914867874 1:151447784-151447806 GATCAAAACACATCAAAAGCTGG - Intronic
915746872 1:158167951-158167973 GAACTAAGCAAATCAACATATGG + Intergenic
917601014 1:176573815-176573837 TATCAAAGCAGATGAAAAGCTGG + Intronic
920328126 1:205182927-205182949 GATCAGAGCAGATCAACTGAAGG + Intronic
921032541 1:211345964-211345986 GAGCTAAGCAGAGCAAGAGTAGG + Intronic
921166666 1:212513057-212513079 GGTCTAAGCAGATCCACTGCAGG + Intergenic
923482682 1:234398331-234398353 AATCTAACCAGATCAACAAGGGG + Intronic
1073155779 10:101345367-101345389 GAGCTAAGGAGATCAAGACCAGG - Intergenic
1073345326 10:102778515-102778537 GATCTGAGAGGATCAACAGCAGG + Intronic
1077705560 11:4482010-4482032 GATCTAAGTAGATAAACAAGAGG - Intergenic
1078660286 11:13280178-13280200 AAGTTAAGCAGATCAACAGATGG + Intronic
1079816168 11:25061476-25061498 GATCTAAGGAGAAACACAGCTGG - Intronic
1081311956 11:41585224-41585246 GAGATAAGCAGATCAACAAAAGG - Intergenic
1081877939 11:46423222-46423244 GATCTAAGCAGATCAACAGCTGG - Intronic
1083022146 11:59518153-59518175 GATCTTAGCAGAGTATCAGCTGG - Intergenic
1087755167 11:102047547-102047569 GCTCTAAGGAGATCACCAGCCGG + Exonic
1092161982 12:6320255-6320277 GATGTGAGCAGATAAAAAGCAGG + Intronic
1095841446 12:46698095-46698117 GATATAAGCAGCTCAATGGCAGG - Intergenic
1099384890 12:82002427-82002449 GATTTAAGAATATCAACATCAGG + Intergenic
1099909122 12:88808113-88808135 AATCTATGCAGATATACAGCAGG - Intergenic
1102953498 12:117045311-117045333 GTTTTATGCAGATCAGCAGCTGG + Intronic
1106052182 13:26201898-26201920 CTTCCAAGCAGATCCACAGCTGG - Intronic
1111344701 13:86935721-86935743 GATCTAACCAGATCAAGCTCTGG + Intergenic
1111455504 13:88478218-88478240 GATCTATACAGCTCAACACCTGG - Intergenic
1114902462 14:27081209-27081231 GATCTAAGCAAAACAACATGAGG + Intergenic
1120457056 14:84744990-84745012 GATCTAAACAGATCAATTGCAGG + Intergenic
1122953672 14:105060173-105060195 GATCTTGGCAGAGCAGCAGCTGG - Intronic
1123180893 14:106469162-106469184 GATCTGAGCAGAGCCACTGCTGG + Intergenic
1202946003 14_KI270726v1_random:27496-27518 GATCTGAGCAGAGCCACTGCTGG - Intergenic
1127470712 15:59287531-59287553 GATCTAAGCTGATCAAAGGAAGG - Intronic
1132813670 16:1815574-1815596 GGTCACAGCAGAGCAACAGCTGG + Intronic
1136104330 16:28018718-28018740 GATCTCAGGACATCAACAGTGGG - Intronic
1142931584 17:3289521-3289543 GATCTTTGGAGATAAACAGCAGG + Intergenic
1143201996 17:5119789-5119811 CATCTCAGCTGATAAACAGCTGG + Intronic
1143589124 17:7870096-7870118 AATCGAAGAAGATCTACAGCTGG + Intronic
1146477509 17:33174790-33174812 GTCCTATGTAGATCAACAGCAGG - Intronic
1146837367 17:36122933-36122955 GATGTAATCTGATCAACATCTGG + Intergenic
1148512862 17:48187924-48187946 GATCTAAACAGAACAGCAGTAGG + Exonic
1151955352 17:77377419-77377441 GAGCAAAGCAGGCCAACAGCTGG - Intronic
1155983138 18:32201829-32201851 GGTCTAAGAAGATCAAGAACAGG - Intronic
1159274228 18:66194285-66194307 GCTCTGAGCAGATCTACAGAAGG - Intergenic
1161877103 19:6920181-6920203 GATCCAATCAGATCAAGACCTGG - Intronic
1162342335 19:10098999-10099021 GATCTAAGCAGAAGAGCAGACGG - Intronic
1166246493 19:41530835-41530857 GAAATAAGCAGAACATCAGCTGG - Intergenic
1166246522 19:41531160-41531182 GAAATAAGCAGAACATCAGCTGG - Intergenic
1167377773 19:49120573-49120595 GTTCTAAGCAGAGCAAACGCTGG - Intronic
1167833281 19:52045118-52045140 GATCTAAGGTGACCAACAGGTGG + Intronic
927789670 2:26000535-26000557 AATCTAAACAGAACAACAGCTGG + Intergenic
930341820 2:50126025-50126047 GAACGAAGCAGAACAATAGCAGG + Intronic
931564573 2:63601999-63602021 AGGCTAAGCAGATCAATAGCTGG + Intronic
933724949 2:85421335-85421357 GTTTTCAGCAGATAAACAGCCGG + Intronic
937530420 2:122820692-122820714 GATTAAAGCAGATGAACTGCAGG + Intergenic
940831023 2:158466095-158466117 GCTCTAAGCTACTCAACAGCAGG + Intronic
947359032 2:229328454-229328476 GAACCAATCAGATCATCAGCTGG + Intergenic
948664427 2:239526194-239526216 GATCTCAGCAGCTCTCCAGCAGG - Intergenic
1173386134 20:42589739-42589761 GATCAAAACAGATCAGGAGCTGG - Intronic
1178160577 21:29908420-29908442 GCTCTAAGAAGAGCACCAGCAGG - Intronic
1184143163 22:42591635-42591657 GCACTAAACAGATCAACATCTGG + Intronic
949968365 3:9379513-9379535 GTTCTATGCAGATTAACAGAAGG - Intronic
954366816 3:50150895-50150917 GCTCTGAGCCGATCAAAAGCTGG - Intergenic
956358141 3:68416581-68416603 GATCTTAGCAGGTGAACTGCCGG - Intronic
956362738 3:68466621-68466643 GATATAAGCAGTTCAACATTAGG - Intronic
958677945 3:97291869-97291891 AATCTAAGCAGAGGCACAGCTGG - Intronic
959374267 3:105568689-105568711 GGTCTAAGTAGACCAAAAGCTGG - Intronic
972417882 4:38860678-38860700 GAGCAAAGGAGATCAACAGATGG + Intergenic
973598477 4:52516666-52516688 GATCTAATCAGAGCAACTGAAGG + Intergenic
975847196 4:78537191-78537213 GAACTTAGCATACCAACAGCAGG - Intronic
976176706 4:82361784-82361806 CACCTAAGCATATCATCAGCTGG + Intronic
979647944 4:123093752-123093774 GATCTAAGGAGCCCAACAGCAGG + Intronic
982917871 4:161235969-161235991 TATCTAATCAGATAAACAGGAGG - Intergenic
984188773 4:176579367-176579389 GGTGTAAACAGACCAACAGCAGG - Intergenic
998030775 5:138865777-138865799 GATATAAAAAGATCAAAAGCAGG - Intronic
1000761238 5:165227348-165227370 GATACAATCAGATCAACAGCTGG - Intergenic
1003095945 6:3143765-3143787 GATCTAAGCATATCAATATGAGG + Intronic
1006574342 6:35033313-35033335 GAACTAAGCAAATCCTCAGCTGG + Intronic
1008052751 6:46916482-46916504 GCTCTGAGCACATCAGCAGCAGG - Intronic
1009909305 6:69905476-69905498 CATCTTTGCAGATGAACAGCGGG - Intronic
1010375774 6:75168470-75168492 CATCTGAGCAGGTCAACAACAGG + Intronic
1010436914 6:75842152-75842174 CATCTAAGTTGATCAAGAGCAGG - Intronic
1012718212 6:102703295-102703317 CAACTAAGTACATCAACAGCTGG - Intergenic
1018166895 6:161106374-161106396 TATCTATTCAGATAAACAGCAGG - Intronic
1019958243 7:4434419-4434441 GATCTCAACAGCTCACCAGCTGG - Intergenic
1020372779 7:7452436-7452458 GGTTTTAGGAGATCAACAGCAGG - Intronic
1024012291 7:45279381-45279403 GATCTAAGCAAATGAACAGCAGG - Intergenic
1024775951 7:52785820-52785842 TATCTAAGCAGGGCATCAGCAGG - Intergenic
1029018859 7:97343010-97343032 AATCTCAGCAGATCAAAGGCTGG + Intergenic
1033415161 7:141155466-141155488 GCTCTCAGCAGTTTAACAGCTGG + Intronic
1033705445 7:143881951-143881973 GAGGCACGCAGATCAACAGCTGG - Intronic
1033836133 7:145314604-145314626 GATCTGAGCAGTTTAACACCTGG - Intergenic
1037229666 8:16642114-16642136 TATATAAGCATATCAACAGATGG - Intergenic
1038131258 8:24733999-24734021 GAACTAAGGAGAACATCAGCAGG + Intergenic
1039505615 8:38050258-38050280 GATCTAAGCAAATCAACAGGAGG - Intronic
1039797708 8:40929361-40929383 GATCTTAGCAGACCATCAGAAGG - Intergenic
1043307492 8:78814537-78814559 AATCTTAGCAGATCAAAAACAGG - Intergenic
1044057423 8:87588462-87588484 GATCTATTAAGATCAACACCAGG + Intronic
1044203386 8:89462683-89462705 GATCTTATCAGATTGACAGCAGG - Intergenic
1045156550 8:99480855-99480877 TATGTAAGCAAATCCACAGCTGG - Intronic
1047743132 8:127823356-127823378 AATTTAAGCATATCAAAAGCAGG - Intergenic
1049758014 8:144319377-144319399 GATGTGAGCAGATCAGCAGCTGG - Intronic
1201251274 Y:12060537-12060559 TATCTGAACAGATCAATAGCAGG + Intergenic