ID: 1081878804

View in Genome Browser
Species Human (GRCh38)
Location 11:46430056-46430078
Sequence ACTAGCACGATAAACAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081878797_1081878804 20 Left 1081878797 11:46430013-46430035 CCAGTCTTACTTTCCTGACTTAC 0: 1
1: 0
2: 0
3: 16
4: 231
Right 1081878804 11:46430056-46430078 ACTAGCACGATAAACAGAGAAGG 0: 1
1: 0
2: 1
3: 2
4: 114
1081878798_1081878804 7 Left 1081878798 11:46430026-46430048 CCTGACTTACCCATCATTAAAAC 0: 1
1: 0
2: 1
3: 15
4: 165
Right 1081878804 11:46430056-46430078 ACTAGCACGATAAACAGAGAAGG 0: 1
1: 0
2: 1
3: 2
4: 114
1081878796_1081878804 21 Left 1081878796 11:46430012-46430034 CCCAGTCTTACTTTCCTGACTTA 0: 1
1: 0
2: 2
3: 30
4: 280
Right 1081878804 11:46430056-46430078 ACTAGCACGATAAACAGAGAAGG 0: 1
1: 0
2: 1
3: 2
4: 114
1081878802_1081878804 -2 Left 1081878802 11:46430035-46430057 CCCATCATTAAAACTGGGAGGAC 0: 1
1: 0
2: 0
3: 9
4: 128
Right 1081878804 11:46430056-46430078 ACTAGCACGATAAACAGAGAAGG 0: 1
1: 0
2: 1
3: 2
4: 114
1081878803_1081878804 -3 Left 1081878803 11:46430036-46430058 CCATCATTAAAACTGGGAGGACT 0: 1
1: 0
2: 2
3: 9
4: 119
Right 1081878804 11:46430056-46430078 ACTAGCACGATAAACAGAGAAGG 0: 1
1: 0
2: 1
3: 2
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081878804 Original CRISPR ACTAGCACGATAAACAGAGA AGG Intronic
901467177 1:9429692-9429714 GCTAGCAAAAGAAACAGAGAAGG - Intergenic
902838805 1:19062689-19062711 ACGAGCTTGAAAAACAGAGATGG - Intergenic
904655741 1:32045605-32045627 ATTAACAGGATAAACAGAGTGGG - Intronic
906384495 1:45355811-45355833 AGTAGCACGAAAGACACAGAGGG + Intronic
909233522 1:73121518-73121540 ACCAGCACGAGGAAAAGAGAAGG - Intergenic
910748033 1:90594978-90595000 ACTAGCTAGATTAACTGAGAGGG + Intergenic
916786677 1:168091638-168091660 ACTAGCGTGAAAGACAGAGATGG + Intronic
919935007 1:202245535-202245557 CCTAGCACCATAGCCAGAGAGGG - Intronic
921977870 1:221222095-221222117 ACTATCAAGAGAAACAGAGCAGG + Intergenic
923846658 1:237741185-237741207 GCTATCATGATAAACAGAAAGGG + Intronic
1067190508 10:44064095-44064117 AGGAGCATGAGAAACAGAGAGGG - Intergenic
1070538870 10:77401557-77401579 AGGAGCAGGAAAAACAGAGAAGG - Intronic
1074336595 10:112582479-112582501 ACAAGCAAGATGACCAGAGATGG - Intronic
1075016460 10:118913388-118913410 ACTAGCTGGATAAGGAGAGATGG - Intergenic
1079789391 11:24717137-24717159 ACTAGATTGATAAACAGAGTAGG + Intronic
1080863898 11:36176327-36176349 ACTAGCACGAGGAACAGAATAGG - Intronic
1081878804 11:46430056-46430078 ACTAGCACGATAAACAGAGAAGG + Intronic
1082670604 11:56032870-56032892 CCCAGCAAGATCAACAGAGAAGG + Intergenic
1086126565 11:83355013-83355035 ACAAGCCAGATAAAGAGAGATGG - Intergenic
1087312759 11:96568884-96568906 CCCAGCACGATATACAGAGGAGG + Intergenic
1092466029 12:8732426-8732448 ACTATCTCCATAAACAGAAATGG - Intronic
1094696265 12:32821949-32821971 AATACCACGATACTCAGAGAAGG + Intronic
1095681446 12:44981210-44981232 ACTGGCAAGCTAAAAAGAGAAGG + Intergenic
1099525515 12:83713738-83713760 ACAAGCATGATAAATAGACATGG + Intergenic
1100603795 12:96134382-96134404 ACTGGCACGACACACAGAGGTGG + Intergenic
1100768840 12:97898697-97898719 CCCAGCAAGATCAACAGAGAAGG - Intergenic
1101300996 12:103481700-103481722 ATTATCACAATAAACAGAAAAGG - Intronic
1101478750 12:105076520-105076542 ACTAGGATAATAAACAGAGTTGG - Intronic
1103622176 12:122194041-122194063 AGTAGCACAAAAAAGAGAGAAGG - Intronic
1104509420 12:129363051-129363073 ACTAACACAATAAACAAAGATGG - Intronic
1106322339 13:28653181-28653203 ACTAGAATGATAAACAAACAAGG + Intergenic
1106505106 13:30364359-30364381 ACTGGCCAGATAAACAGATAAGG - Intergenic
1109556351 13:63981193-63981215 AATAGAACCACAAACAGAGAGGG + Intergenic
1110011861 13:70345790-70345812 TCTACCACGGTAAATAGAGAGGG - Intergenic
1110146952 13:72203171-72203193 ATTAGCACAATAGACAGAGCAGG + Intergenic
1111122614 13:83873559-83873581 ACTAGCACCATAAACAATAATGG - Intergenic
1115056161 14:29129951-29129973 AATAGTACCATTAACAGAGATGG - Intergenic
1117375136 14:55112650-55112672 AGTAGCAAGAGAAACAGTGATGG + Intergenic
1120540479 14:85744340-85744362 ACTAGCACAATAAACAGAGGTGG - Intergenic
1120583439 14:86282130-86282152 ACTAGTACAATAAACATAAATGG + Intergenic
1130634232 15:85601340-85601362 GCAAGAACAATAAACAGAGATGG - Intronic
1133395238 16:5441846-5441868 ACTATCACGAAAAACAGATAGGG + Intergenic
1134311964 16:13083179-13083201 ACTGCCAGGAGAAACAGAGAAGG - Intronic
1139667037 16:68464520-68464542 ACTTGAACCATAAACAGAGGAGG - Intergenic
1145281827 17:21473585-21473607 AATAGCACGCTAAACACAGGAGG - Intergenic
1145395620 17:22492034-22492056 AATAGCACGCTAAACATAGGAGG + Intergenic
1150300252 17:64041886-64041908 ACTAGTATGATAAGCAGAAAAGG + Exonic
1157236792 18:45972189-45972211 ACTGGCATAATAATCAGAGAAGG + Intergenic
1158999833 18:62963346-62963368 ACTAACAAGAGAAACAGGGAGGG - Exonic
1159221263 18:65466175-65466197 ACGAGAACGAGAAAGAGAGAGGG + Intergenic
1159425547 18:68280496-68280518 ACATGCAAGATAATCAGAGAGGG - Intergenic
1162246979 19:9409372-9409394 AAGAGCACGATGAACAAAGAAGG - Intergenic
1166279748 19:41783884-41783906 AATAGCTCGAAAAAAAGAGAAGG + Intergenic
926976592 2:18522089-18522111 AGTAGAATGACAAACAGAGATGG - Intergenic
929698061 2:44136719-44136741 GCAAGCACGAGAGACAGAGAGGG - Intergenic
930400584 2:50879728-50879750 AATAGCAAGAAAAACAGAGGTGG - Intronic
930460977 2:51675363-51675385 AATACCAGGATAAACAGATAAGG + Intergenic
936417602 2:112331730-112331752 ATTAACACAACAAACAGAGAAGG + Exonic
936810770 2:116398921-116398943 ACTAGCAAACAAAACAGAGAAGG - Intergenic
941529252 2:166645088-166645110 TCTAACACTATAAACAAAGAAGG - Intergenic
944703074 2:202263023-202263045 AATAACACTATAAACAGACATGG + Intergenic
945610455 2:211994806-211994828 AACAGCACAATTAACAGAGAAGG + Intronic
1169498546 20:6137395-6137417 TCAAGCACAACAAACAGAGAGGG - Intergenic
1171943221 20:31351047-31351069 ACCAGGACAATAAGCAGAGAAGG + Intergenic
1176885340 21:14248690-14248712 ACAAGCATGAGAAACAGGGAGGG - Intergenic
1179173377 21:38990340-38990362 GCTAGGACGTTAAACAGAGCAGG + Intergenic
1182185472 22:28397180-28397202 ACTAGTAAGATAAAGAGACAAGG + Intronic
949123189 3:412574-412596 ACTAATAGGATAAATAGAGATGG - Intergenic
949141659 3:641053-641075 CCTAGTAAGATAAACAGAAATGG + Intergenic
951826062 3:26870302-26870324 AGGAGCCCAATAAACAGAGATGG + Intergenic
959495948 3:107051984-107052006 ACTGGCAGGAAAATCAGAGAAGG + Intergenic
960760174 3:121064367-121064389 CCTAGCAAGATCAACACAGAAGG - Intronic
966301223 3:178481483-178481505 ATTTGCAAGATAAACAGAGTTGG + Intronic
967355102 3:188560410-188560432 AGTAGCATGAGAAACAGATAAGG - Intronic
970376144 4:15459111-15459133 ACTAGAAGGATAAAGAAAGAAGG + Intergenic
972050712 4:34729491-34729513 ACTTGCACGAAAAAGGGAGAAGG - Intergenic
973399948 4:49630350-49630372 ACTATCCCAAAAAACAGAGAAGG + Intergenic
973652906 4:53014606-53014628 ACAAGGACTATAAACACAGAGGG - Intronic
973790351 4:54372479-54372501 ACTAGGAAGATGAAAAGAGATGG + Intergenic
974045861 4:56897989-56898011 CCTTGCACCTTAAACAGAGAAGG + Intergenic
974971709 4:68838063-68838085 AGTAGCAAGATAGAAAGAGACGG - Intergenic
976609158 4:87011492-87011514 ACTAGCTCAAAAATCAGAGACGG - Intronic
977551255 4:98446258-98446280 ACTAGCAGGAGGACCAGAGAAGG + Intergenic
978502282 4:109422187-109422209 ACTATAAAGATAAACAGAAATGG + Intergenic
978605136 4:110471615-110471637 ACTGGCACAATAAAGGGAGAGGG - Intronic
985338567 4:188922515-188922537 AGTAGCAAAACAAACAGAGAGGG - Intergenic
989979322 5:50623854-50623876 ACTAGAACGATAATGGGAGAAGG - Intergenic
991609217 5:68433684-68433706 CCTAGCAAGAGAAAAAGAGAAGG + Intergenic
992599575 5:78384987-78385009 ACTATTCCGAAAAACAGAGAGGG - Intronic
995690700 5:114823441-114823463 ACAAGCAAGAAAAAGAGAGAGGG + Intergenic
1000376222 5:160584427-160584449 CCTAGCAAGATCAACACAGAAGG - Intronic
1003789014 6:9521604-9521626 ACTTGCAGGATAATCAAAGAAGG + Intergenic
1009583854 6:65570663-65570685 ACTTTTAAGATAAACAGAGATGG + Intronic
1013330505 6:109095292-109095314 ACAAGCACGACAAAGAAAGAGGG + Exonic
1015336884 6:132049226-132049248 ACTACCATAATAAACAGTGAGGG - Intergenic
1016447138 6:144146026-144146048 ACTAGCATGAAAAAGAGAAATGG + Intergenic
1020899836 7:13990648-13990670 ACTAGGACGTTAAGCAGTGAGGG + Intronic
1021774706 7:24041263-24041285 ACCAGCATGATAAACTTAGATGG + Intergenic
1023169133 7:37373629-37373651 AATAGCACCATAAACAAATAAGG - Intronic
1024357056 7:48424880-48424902 AGTAGCCCAATTAACAGAGAGGG - Intronic
1027914199 7:84294139-84294161 ACTAGCAAGACAAATAGACAAGG - Intronic
1028090890 7:86699359-86699381 ACTACCACAATAAACAGTGCAGG - Intronic
1028311709 7:89346243-89346265 ACTAGCAGGTTAAAGAGAAATGG + Intergenic
1028905421 7:96148877-96148899 ACTATGAAGATAAAAAGAGATGG + Intronic
1036982966 8:13491754-13491776 ACTAGCAGGCAGAACAGAGAGGG + Intronic
1040653310 8:49474978-49475000 ACTAGCTAGATAAATAAAGAAGG + Intergenic
1040932984 8:52754873-52754895 ACTACCCAAATAAACAGAGAAGG + Intergenic
1042110822 8:65379681-65379703 CCCAGCAAGATCAACAGAGAAGG + Intergenic
1042208713 8:66355676-66355698 ACTAGCACTATAAAATGAGCTGG - Intergenic
1045651137 8:104342611-104342633 ACAAGCACCAGAAACAGTGAAGG - Intronic
1048078901 8:131103233-131103255 ACCAGCAGGAAATACAGAGAAGG + Intergenic
1052296904 9:26906972-26906994 ACTAGCAATAAATACAGAGATGG + Intronic
1057379960 9:94558859-94558881 AAATGAACGATAAACAGAGATGG - Exonic
1057407409 9:94785625-94785647 ATTAGCAAGACTAACAGAGAGGG - Intronic
1059222339 9:112635767-112635789 ACTAGCAAGAAGAAGAGAGAAGG - Intronic
1190070492 X:47275346-47275368 ACTACCACATTCAACAGAGAAGG + Intergenic
1194473065 X:94321243-94321265 ACTAACAGGAGAGACAGAGAGGG - Intergenic
1194888132 X:99344437-99344459 ACTATCAGAAGAAACAGAGAAGG - Intergenic