ID: 1081878827

View in Genome Browser
Species Human (GRCh38)
Location 11:46430308-46430330
Sequence TGCCATTGTGGTTTTGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 193}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081878827_1081878832 19 Left 1081878827 11:46430308-46430330 CCATGCACAAAACCACAATGGCA 0: 1
1: 0
2: 3
3: 32
4: 193
Right 1081878832 11:46430350-46430372 CTGCCTTGCTGAGGAGGCTGAGG 0: 1
1: 0
2: 5
3: 62
4: 623
1081878827_1081878833 20 Left 1081878827 11:46430308-46430330 CCATGCACAAAACCACAATGGCA 0: 1
1: 0
2: 3
3: 32
4: 193
Right 1081878833 11:46430351-46430373 TGCCTTGCTGAGGAGGCTGAGGG 0: 1
1: 1
2: 3
3: 38
4: 338
1081878827_1081878830 10 Left 1081878827 11:46430308-46430330 CCATGCACAAAACCACAATGGCA 0: 1
1: 0
2: 3
3: 32
4: 193
Right 1081878830 11:46430341-46430363 AGACTGACTCTGCCTTGCTGAGG 0: 1
1: 1
2: 1
3: 21
4: 223
1081878827_1081878831 13 Left 1081878827 11:46430308-46430330 CCATGCACAAAACCACAATGGCA 0: 1
1: 0
2: 3
3: 32
4: 193
Right 1081878831 11:46430344-46430366 CTGACTCTGCCTTGCTGAGGAGG 0: 1
1: 0
2: 4
3: 21
4: 245

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081878827 Original CRISPR TGCCATTGTGGTTTTGTGCA TGG (reversed) Intronic
901559642 1:10059823-10059845 TGCCATTCTGATTGTGTGAAAGG - Intronic
901577624 1:10213405-10213427 TCCCATTTTGATTTCGTGCAGGG + Intronic
903349525 1:22709906-22709928 TGCAGCCGTGGTTTTGTGCATGG - Intergenic
906090990 1:43179572-43179594 TCCTATTGTGCTTTTGTGCCAGG - Intronic
906823421 1:48953210-48953232 TGGCAGTATGGTTTTGGGCATGG - Intronic
906889058 1:49687218-49687240 TCCAACTGTGGTTTTGTCCAGGG - Intronic
906940813 1:50253493-50253515 TACCACTGTGGTTTTGTCCAGGG + Intergenic
909541558 1:76797402-76797424 TGCCATGGTGATTTGCTGCACGG - Intergenic
910124779 1:83828539-83828561 TGCTAATGTGTGTTTGTGCATGG + Intergenic
911596527 1:99804332-99804354 AGCCATTGTTGTGTTGTGGATGG - Intergenic
912004078 1:104874090-104874112 TGCCAACGTGGTTTGCTGCACGG + Intergenic
914201688 1:145490799-145490821 TGTCATGGTGGTTTGCTGCACGG - Intergenic
914480813 1:148063923-148063945 TGTCATGGTGGTTTGCTGCACGG - Intergenic
916689678 1:167178468-167178490 TGCCATTGAGTTTTTGAACAAGG - Intergenic
917438059 1:175041026-175041048 TGCCACTGTGGTTTTGGGAGAGG - Intergenic
917810795 1:178656789-178656811 TGGCATTGTGGTTGGGAGCATGG + Intergenic
920501567 1:206488551-206488573 TGCCATTGTGGGGTAGTGCAAGG + Intronic
921722259 1:218486230-218486252 TGCCATTATGGTTGTGAGTAGGG - Intergenic
1063092964 10:2884425-2884447 TGCCATGGTGGTTTGCTGCATGG - Intergenic
1063423149 10:5929956-5929978 TGACAATGTGGTTTTGTGACAGG - Intronic
1065981326 10:30901305-30901327 TGCCAATGTGGCTTTGTGTCCGG + Intronic
1072051580 10:91709531-91709553 TGACATTGTGGTTTACTGGAGGG - Intergenic
1074437787 10:113449032-113449054 TGCCAGTGTGTTTTTGGGAAGGG - Intergenic
1074759370 10:116654902-116654924 AGCCCGGGTGGTTTTGTGCAGGG - Intergenic
1074921237 10:118015925-118015947 TACAGTTGTTGTTTTGTGCATGG - Intronic
1076062878 10:127427316-127427338 TGCCATTTTGGTTTTTTTCTGGG + Intronic
1076699066 10:132260809-132260831 TGCCACTGTGGTGTTGGGCGTGG - Intronic
1077957734 11:7038991-7039013 CTCCATGGTGGTCTTGTGCATGG + Intronic
1078656792 11:13247922-13247944 GGCTTTTCTGGTTTTGTGCAAGG + Intergenic
1081741753 11:45445873-45445895 TGCCTTTGTGATTTTGCTCAGGG - Intergenic
1081878827 11:46430308-46430330 TGCCATTGTGGTTTTGTGCATGG - Intronic
1082173200 11:49031105-49031127 TGCCATGGTGGTTTGCTGCCCGG + Intronic
1082688406 11:56268815-56268837 TGTCATGGTGGTTTGCTGCACGG - Intergenic
1084650787 11:70488113-70488135 TGGCATTGTGGCATTGTGCTTGG + Intronic
1085310127 11:75511284-75511306 TGACCTTGCTGTTTTGTGCAAGG - Intronic
1086692570 11:89804946-89804968 TGCCATGGTGGTTTGCTGCCCGG - Intronic
1086713230 11:90034713-90034735 TGCCATGGTGGTTTGCTGCCCGG + Intronic
1091602592 12:1926934-1926956 AGCCTTTCTGGTTGTGTGCAGGG + Intergenic
1092656636 12:10691964-10691986 TGCCATTGTCTTTTTGTGGATGG - Intergenic
1093252678 12:16827024-16827046 TGCCATGGTGGTTTGCTGCATGG + Intergenic
1096551303 12:52374299-52374321 TGTCATTGGGTTTTGGTGCAGGG + Intergenic
1096655201 12:53085849-53085871 TGCCATGGTGGTTTGCGGCACGG - Intergenic
1097338100 12:58407110-58407132 TGAGAGTGTGGTTTTGTGCCTGG + Intergenic
1098056340 12:66509873-66509895 TGCCATCATGGTTTGCTGCACGG - Intronic
1099863224 12:88245621-88245643 TGCCATTGTGGATTGATTCAGGG + Intergenic
1101418988 12:104533347-104533369 TTCCTTTGTGGTTTTGTACTTGG + Intronic
1101714249 12:107296674-107296696 TGCCATTGAAGTTTTGTGGTTGG - Intergenic
1102020336 12:109677890-109677912 TGCCATTAGGGTTGGGTGCATGG - Intergenic
1106616640 13:31336264-31336286 TGCCCTTGTGGCTGTGGGCAAGG + Intergenic
1108418374 13:50224077-50224099 AGCCATTTTGGTCATGTGCAAGG + Intronic
1111049791 13:82866091-82866113 AGCCATTTGAGTTTTGTGCAGGG + Intergenic
1111318443 13:86592033-86592055 TGTCATTGTGATATTGTGCAAGG + Intergenic
1114171509 14:20277534-20277556 TGCCATTGTGGTTTTCCCCAAGG + Intronic
1116766475 14:49076960-49076982 TGCCATTGTAGTTTATTTCATGG - Intergenic
1117144725 14:52826309-52826331 TGCCATTGTGGAAATGTGGATGG - Intergenic
1117829770 14:59739080-59739102 TGCCATGGTGTTTTGCTGCATGG - Intronic
1118378083 14:65194074-65194096 TGCCAAAGTGGGTTTCTGCATGG + Intergenic
1118559029 14:67057511-67057533 TGCCATGGTGGTTTGCTGCACGG - Intronic
1118644783 14:67827543-67827565 TGCCATGGTGGTTTGCTGTATGG + Intronic
1118785457 14:69042030-69042052 GGCCATTGTGGGTTTGTGTGTGG - Intergenic
1119607600 14:76034236-76034258 TGCCATTGTGGTTGGGTTCTTGG + Intronic
1121871399 14:97411327-97411349 TGAGATTTTGGTTTTTTGCAAGG - Intergenic
1122224185 14:100263865-100263887 TTCCATTGTGGTTTGATACATGG + Intronic
1123928513 15:25143380-25143402 TGCCACTGGGTTTTTGAGCATGG + Intergenic
1124040630 15:26099712-26099734 TGCCATTGTTGTTTTGAGACAGG + Intergenic
1124373150 15:29114856-29114878 TGCGAGTGTGGGTGTGTGCAGGG + Intronic
1125450887 15:39805936-39805958 TGCCATTGTGGTTAAGAGAATGG - Intronic
1126939098 15:53746259-53746281 TGCAAATGTGGTTTTGTGGGTGG + Intronic
1127480756 15:59374785-59374807 TGCGACAGTAGTTTTGTGCAAGG + Intronic
1131591397 15:93752730-93752752 TGCCATGATGGTTTGCTGCACGG - Intergenic
1132315072 15:100883734-100883756 TGCCATGGTGGTTTGCTGCATGG + Intronic
1133416129 16:5608411-5608433 TGGCAAAGTGGTTCTGTGCATGG + Intergenic
1133617728 16:7494190-7494212 TGCAATTCTCGTTTTGAGCATGG + Intronic
1135158697 16:20074693-20074715 TGTGAGTGTGGTCTTGTGCATGG - Intergenic
1137325794 16:47435108-47435130 TACCATGGTGGTTTGTTGCATGG - Intronic
1137822212 16:51457024-51457046 TGCCATTGTGTTTTTTTTAAGGG - Intergenic
1138257058 16:55574621-55574643 TGCCATCATGGTTCTGTGAAAGG - Exonic
1139372428 16:66477368-66477390 TGCCATTGTCGTGTTGGGCATGG - Intronic
1143258759 17:5583416-5583438 TGGCATTGTAGTTATGAGCACGG - Intronic
1153730476 18:8006498-8006520 TACCTGTGTTGTTTTGTGCAAGG - Intronic
1153987129 18:10362299-10362321 TGACATTGTGTTGTTGTGCTTGG - Intergenic
1155459095 18:26056163-26056185 TGACATTTTGGTTTTGTGTAAGG - Intronic
1155842646 18:30665168-30665190 TGCCACAGTGGTTTGCTGCATGG - Intergenic
1160378208 18:78429783-78429805 TGCCATCCTGGGGTTGTGCATGG + Intergenic
1160386582 18:78500555-78500577 AGCCTCTGCGGTTTTGTGCAAGG - Intergenic
1165750315 19:38255644-38255666 TGTCCTTGTGGGTTTGTGCATGG + Intronic
1165985374 19:39764138-39764160 TGCCGTGGTGGTTTGCTGCAGGG - Intergenic
924977255 2:189958-189980 TGACTTTACGGTTTTGTGCAAGG - Intergenic
926278382 2:11423991-11424013 TGCCATTGTGGTTTGCTGCACGG - Intergenic
928245654 2:29624670-29624692 TGCCATGGTGGTTTGCTGCACGG - Intronic
929950052 2:46402371-46402393 TGACAGTGTGGTATTGTGTATGG + Intergenic
930029367 2:47048980-47049002 AGCCATTGTGGTTTTATAGATGG + Intronic
930716747 2:54600455-54600477 AGCCATCATGGTTTTGAGCAGGG - Intronic
931446229 2:62329585-62329607 TCCCATTTTGGGATTGTGCAAGG - Intergenic
931758073 2:65391808-65391830 TGCTATTGTGGTTTTGGTGAGGG - Intronic
932462295 2:71890662-71890684 AGCCAGTGTGGCTTTGTGAAAGG - Intergenic
933324931 2:80823431-80823453 TGCCAGTGTGGAAGTGTGCAAGG + Intergenic
934518728 2:95006024-95006046 TGCCGTGGTGCTTTTGTGCTAGG - Intergenic
935353311 2:102174678-102174700 TGACATTGTGCTTTGGTACAGGG + Exonic
937840876 2:126523359-126523381 TGCCATGGTAGTTTTCTGCAGGG - Intergenic
937857697 2:126684479-126684501 TGCCAGTGTGGTAGTGGGCATGG - Intronic
938146040 2:128835595-128835617 GGCCTCTGTGGTTATGTGCAAGG - Intergenic
938163521 2:129007236-129007258 TGCCATTCTGGTTATGTGTGTGG - Intergenic
938227806 2:129631605-129631627 TGCCTTTGTGTGTTTGTCCAAGG + Intergenic
938688041 2:133760393-133760415 AGCCATTGTGGTTTCGTAAAGGG - Intergenic
939061410 2:137426280-137426302 TGCCATTGAGGTTTTGATAAGGG - Intronic
940266797 2:151847385-151847407 TGCCAGTCTTTTTTTGTGCATGG - Intronic
940751458 2:157630500-157630522 TGCCATTGTTGTAATGTGTATGG - Intergenic
941714403 2:168748853-168748875 TGCCATGCTGAGTTTGTGCAAGG + Intronic
944350328 2:198718694-198718716 TGCCATGGTGGTTTGCTGCCAGG + Intergenic
946625013 2:221602070-221602092 TGCCATGGTGGTTTGCTGCATGG - Intergenic
948169274 2:235888179-235888201 GGCCAATGTGGTTATGGGCAGGG + Intronic
948423145 2:237872704-237872726 TGCCATGATGGTTATTTGCAAGG + Intronic
948425664 2:237885433-237885455 TGCCCTCGTGGGTTTGTTCATGG + Intronic
1170952694 20:20951303-20951325 TGGCCTTGTGGTTTGTTGCAAGG - Intergenic
1171041667 20:21769782-21769804 TGCCATGGTGGTTTGCCGCACGG + Intergenic
1175393723 20:58644192-58644214 TGCCACTGTGGTTAGGTGAAAGG + Intergenic
1179602644 21:42490332-42490354 GGCCAGAATGGTTTTGTGCAGGG - Intronic
1181567317 22:23747038-23747060 TGGGATTGTGCTTTTGTGCTGGG - Intronic
1182401481 22:30080909-30080931 AGCCATTGAGGTTTTCTGCCAGG + Intronic
1182761643 22:32727049-32727071 GGCCATGGTGGTTTGCTGCATGG + Intronic
1184038121 22:41928131-41928153 AGCCACTGGGGCTTTGTGCAGGG + Intergenic
1184456756 22:44615273-44615295 CGCCATTGACATTTTGTGCAAGG + Intergenic
1184565133 22:45287314-45287336 TGCCATTGGGGATGTGTCCAAGG + Exonic
949116387 3:330844-330866 AGCCATTATGGTTCTGTGCAGGG + Intronic
949584468 3:5424330-5424352 TGCTATTTTTGTTTCGTGCATGG + Intergenic
951257226 3:20464140-20464162 TGCCATGGCGGTTTGCTGCATGG + Intergenic
952470546 3:33646018-33646040 TGTCATGGTTGATTTGTGCAGGG - Intronic
952922768 3:38297529-38297551 TCCCATGGTGGTTTGCTGCATGG + Intronic
953564873 3:44022623-44022645 TGACTTTGTTGTTTTGTGGAAGG + Intergenic
953792597 3:45959542-45959564 TTCCAATGTGGTTTTGTCCCAGG - Exonic
954486307 3:50855747-50855769 TGCCATGGTGGTTGGCTGCACGG + Intronic
960249972 3:115440927-115440949 TTCCATGGTGGTTTTGTGGTTGG - Intergenic
960517903 3:118622637-118622659 TGGCATTGTGGTTAAGAGCATGG - Intergenic
961589729 3:127968695-127968717 TGCCATGGTGGTGTGCTGCACGG - Intronic
962487497 3:135859219-135859241 TGCCAGTGTGGATTGGTACAGGG - Intergenic
962856254 3:139347929-139347951 TGCCTTTGTGGTTTTGATAACGG + Intronic
962885102 3:139617356-139617378 TGGCATGGTGGTTATGTGCATGG + Intronic
963820241 3:149883769-149883791 TGCCATGGTGGTTTGCTGCACGG + Intronic
964438924 3:156684028-156684050 TGCAATTGTCTTTTTGTGGAAGG + Intronic
966022646 3:175234738-175234760 TGGCATTGTGGTTAAGTGCAAGG + Intronic
966927042 3:184651426-184651448 TGCCATTGTGGTTAAGGGCCTGG - Intronic
970549739 4:17167178-17167200 TGCCCATGTGGTCTTGTGCCCGG + Intergenic
974931496 4:68365777-68365799 TGCCCTTGTGGCTCTGGGCAGGG - Intergenic
975193579 4:71495887-71495909 TGCCAATGTGGTTGGGTGGAAGG - Intronic
977673695 4:99724710-99724732 TTCCAGTCTGGCTTTGTGCAAGG + Intergenic
977999802 4:103543445-103543467 TGCCATAGTGATTTGCTGCAAGG - Intergenic
979174777 4:117650162-117650184 TACCATGGTGGTTTGCTGCACGG - Intergenic
981251218 4:142603307-142603329 TGCCATGGTGGTTTGCTACATGG - Intronic
982524200 4:156456920-156456942 TGCCAAGGTGGTTTGCTGCACGG - Intergenic
982776915 4:159451560-159451582 TGCCATTGTGGTTTACTGCACGG + Intergenic
983493593 4:168417648-168417670 TGACCTTGTGGTTTAGTGAAGGG - Intronic
983949725 4:173625734-173625756 TATCATTGTGGTTTTTTGTAGGG + Intergenic
984640488 4:182159241-182159263 TACCATTATGGTTTTGTGGAGGG + Intronic
987074179 5:14365298-14365320 TGCCAGTGGGATTCTGTGCATGG + Intronic
987398262 5:17446458-17446480 TGTCATTGTGGATTTGAACATGG - Intergenic
987558328 5:19484373-19484395 TGACATTGTGGTGTTGAGCAGGG - Intronic
987625791 5:20398713-20398735 TGCCGTGGTGGTTTTTTACATGG - Intronic
987625825 5:20398969-20398991 TGCCATGGTGGTTTTCTACGTGG - Intronic
988031037 5:25762567-25762589 TGCCATGGTGGTTTGTTGCAAGG + Intergenic
990955542 5:61334601-61334623 TGCAAACGTGGTTTTCTGCATGG + Intronic
993335945 5:86659109-86659131 TGCCATGGTGGTTTGCTGCATGG + Intergenic
993685345 5:90930462-90930484 TGCCTGGGTGGTTTTGTACATGG + Intronic
995026343 5:107427633-107427655 TGCCATTATGATTTGGGGCATGG + Intronic
995358699 5:111269106-111269128 TGCTTTTATAGTTTTGTGCATGG + Intronic
995442958 5:112212126-112212148 TGCCCTTGTGATTTTGTTAATGG - Intronic
995841269 5:116445501-116445523 TGCCAACATGGTTTTGTCCATGG - Exonic
997564872 5:134879256-134879278 TTCCCTTTTGATTTTGTGCAGGG + Intronic
998222154 5:140292328-140292350 TGACATTCTGCTTTTGTACAAGG - Intronic
999957357 5:156717400-156717422 TGCCTTGGTGGTCTTGTACATGG + Intronic
1000928530 5:167223548-167223570 TTCCATTGTGTTTATGTGCCAGG + Intergenic
1003086687 6:3065782-3065804 TTCCATTCTGGTGTTCTGCAAGG + Intronic
1003475318 6:6476423-6476445 TGCTATAGTGTTTTTGTGGATGG - Intergenic
1004146194 6:13069023-13069045 TGTCTCTGTGGTTTTGTACAGGG - Intronic
1006412594 6:33883470-33883492 TCACATTGTATTTTTGTGCATGG - Intergenic
1006914460 6:37585431-37585453 TGACAGTGTGGCTTTCTGCACGG - Intergenic
1008711200 6:54229432-54229454 TGCCATAGTGGTTTGCTGCATGG + Intronic
1009614244 6:65984679-65984701 TTTCATTGTGTTTTTATGCAAGG - Intergenic
1009902090 6:69820071-69820093 CACCATTATGATTTTGTGCATGG + Intergenic
1011013318 6:82726522-82726544 TGCCATGGTGGGTTTGAGCAGGG + Intergenic
1014310712 6:119797923-119797945 ACCCTTTATGGTTTTGTGCATGG + Intergenic
1016642676 6:146367489-146367511 TGCCACTGAGGTTTGGTGTAGGG + Intronic
1020960101 7:14791761-14791783 TCCAATTATGGTTTAGTGCAGGG - Intronic
1021440925 7:20675097-20675119 TGCCATTGGGATTTTGATCAAGG - Intronic
1022213959 7:28239675-28239697 TGTCATTCTACTTTTGTGCAGGG + Intergenic
1023553840 7:41399292-41399314 TCCCATGGTGGTTTTGCGTATGG + Intergenic
1024201168 7:47107136-47107158 TGGTATTCTGGTTTTGTGAATGG + Intergenic
1026285344 7:68957817-68957839 TTTCATTTTGCTTTTGTGCATGG + Intergenic
1027187359 7:75980371-75980393 CGCCCTGGTGGTTTTCTGCATGG + Exonic
1027256416 7:76433528-76433550 TGCCAGTGTGGATTTCTGCCTGG - Exonic
1028062098 7:86333600-86333622 TACATTTGTGGTTTTTTGCAGGG - Intergenic
1028540012 7:91932602-91932624 GGCAATGGAGGTTTTGTGCAAGG + Intergenic
1030927397 7:115475944-115475966 TGCCTTTGTGGGTTGGTGAATGG - Intergenic
1031338200 7:120564373-120564395 TACTATTGTAGTTTTCTGCAGGG - Intronic
1033527882 7:142234545-142234567 TGCCAGTGTGAATGTGTGCATGG + Intergenic
1035898884 8:3435780-3435802 AGCCATGGAAGTTTTGTGCAGGG - Intronic
1041173494 8:55169574-55169596 TGTCATGATGGTTTTGTGGAAGG - Intronic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1041385392 8:57297041-57297063 AGCCAGTGAGGTTTTCTGCAGGG + Intergenic
1042081535 8:65059687-65059709 GGCCATGGTGGTTTTGGGAAAGG - Intergenic
1042616339 8:70654079-70654101 TTGTATTGTGGTTTTGTGGAGGG - Intronic
1046215468 8:111140497-111140519 TGCCATGGTGGTGTTGGGTAAGG + Intergenic
1047367053 8:124221337-124221359 TGTCATGGTGGTTTGCTGCACGG + Intergenic
1048525768 8:135201086-135201108 TGCCATTGTGGTTTAGTAAAAGG - Intergenic
1055297265 9:74846984-74847006 TGTCATGGTGGATTAGTGCATGG - Intronic
1055514758 9:77023367-77023389 TGCCATTGTCATTCTGTGCATGG - Intergenic
1055690011 9:78819854-78819876 TGCCATTGTGGTGCTGTGAAAGG + Intergenic
1056045897 9:82715491-82715513 TGCCATGGTGGTTTGCTGCACGG + Intergenic
1057459505 9:95246912-95246934 TGCCATTTTGGTTTTATCCAAGG - Intronic
1061868099 9:133505829-133505851 TGCCATTGTGGTTTCTGGAATGG + Intergenic
1185798518 X:2987486-2987508 TGCCATGGTGATTTACTGCACGG + Intergenic
1186552520 X:10521692-10521714 TGCAATTGTGGTTTATTTCATGG + Intronic
1187799886 X:23049752-23049774 TGCCTTTGTGGTTTTGTGCTTGG + Intergenic
1188270091 X:28128455-28128477 TGCCATGGTGGTTTGCTGCATGG + Intergenic
1189305243 X:39982050-39982072 TGCCCTTGTGGGCTTGTGGAGGG - Intergenic
1189699011 X:43696827-43696849 TACCATTGTGTTGATGTGCATGG - Intronic
1189900276 X:45699391-45699413 TGCAATTGTGGTTTTGATTAGGG + Intergenic
1190306337 X:49084674-49084696 TGCCATTGTGAGATTGTGCCTGG - Intronic
1190502546 X:51094173-51094195 TGCCATGGTGATTTGCTGCACGG + Intergenic
1191707330 X:64106899-64106921 TGCCATGGTGGTTCACTGCACGG - Intergenic
1193259258 X:79386148-79386170 TGCCATGGTGGTTTGCTGCACGG - Intergenic
1194329820 X:92567925-92567947 TGCCATGGTGGTTTGTCGCATGG - Intronic
1197633992 X:128893448-128893470 TGTCATTGGAGTTTTGTGAATGG - Intergenic
1198132849 X:133715881-133715903 TGACCTTGAGGTTCTGTGCAAGG + Intronic
1198500278 X:137237719-137237741 AGCCATTGTGCTTTTCTGTAGGG - Intergenic
1198549787 X:137733112-137733134 TGCCATTGGAGTTTGGTACAAGG - Intergenic
1198969430 X:142265594-142265616 TGTCTGTGTGGTTTTGTCCACGG + Intergenic
1199150472 X:144479011-144479033 TGCCATGGTATTTTTCTGCACGG - Intergenic
1200022683 X:153225466-153225488 GGCCATTGTGGTTTTCCACAGGG - Intergenic