ID: 1081880300

View in Genome Browser
Species Human (GRCh38)
Location 11:46444489-46444511
Sequence CTGTCTGATCAGAAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 224}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081880300_1081880304 -7 Left 1081880300 11:46444489-46444511 CCACCCTCCTTCTGATCAGACAG 0: 1
1: 0
2: 1
3: 24
4: 224
Right 1081880304 11:46444505-46444527 CAGACAGAGTCAAACCCTGTTGG 0: 1
1: 0
2: 1
3: 25
4: 552

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081880300 Original CRISPR CTGTCTGATCAGAAGGAGGG TGG (reversed) Intronic
900345824 1:2209838-2209860 CTGTCTGGACAGAAGGCAGGAGG - Intronic
900385178 1:2407321-2407343 CTGTGTCACCAGCAGGAGGGTGG - Intronic
900457924 1:2786325-2786347 CTGTCTGAGCACTAGGAGGTTGG + Intronic
900570597 1:3356371-3356393 CCGTCTCATCAGGCGGAGGGAGG + Intronic
901146312 1:7067128-7067150 CTGTCTCATCAGAAGTTGGCTGG + Intronic
902628584 1:17691101-17691123 CTGTCTGGTTAAAAGGAGGAGGG - Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
903001406 1:20268694-20268716 CTGTCTTATCATAATGAGGAGGG + Intergenic
903557801 1:24206186-24206208 CTGTCAGCTGAGAGGGAGGGAGG + Intergenic
903675974 1:25064907-25064929 TTGTCTGATCCCAGGGAGGGGGG - Intergenic
904319139 1:29685182-29685204 GAGTCTGATCAGCAGGAGGTGGG + Intergenic
904912159 1:33943258-33943280 CAGTCAGATCACAAGGATGGGGG - Intronic
907291152 1:53413832-53413854 CTGTGTGCTCAGGAGGTGGGAGG - Intergenic
912467112 1:109881893-109881915 CTGTCTGTTCAAAAGGATGGGGG - Intergenic
912482653 1:109995761-109995783 CTGTGTAATCAGAATGGGGGAGG + Intronic
913961481 1:143340807-143340829 CTATCTGATCAGGAGGTGGGGGG - Intergenic
914055834 1:144166380-144166402 CTATCTGATCAGGAGGTGGGGGG - Intergenic
914123312 1:144799982-144800004 CTATCTGATCAGGAGGTGGGGGG + Intergenic
914977256 1:152378054-152378076 CTGTCTTATGATAAGGAAGGGGG - Intergenic
915520279 1:156437793-156437815 TTGCCTGTTCAGAAGGAGGTCGG - Intergenic
915590334 1:156866838-156866860 CACTCTGACCAGAATGAGGGAGG - Intronic
918218651 1:182415650-182415672 CTGCCTGGTCAGAGGGAGGAGGG + Intergenic
919183713 1:194117960-194117982 CTGCCTGATCACAAGGACAGAGG + Intergenic
919664923 1:200282753-200282775 CTTTCTCAGCAGCAGGAGGGAGG + Intergenic
920044417 1:203124299-203124321 AAATCTGAGCAGAAGGAGGGTGG + Intronic
920704323 1:208240746-208240768 CTTTATGATCAGAATGGGGGTGG + Intronic
920811312 1:209288482-209288504 CTGTCTGATTAGAATCCGGGAGG + Intergenic
920912577 1:210232640-210232662 CGGCCTGAGCAGAGGGAGGGAGG + Intergenic
924883403 1:248187751-248187773 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883415 1:248187816-248187838 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883427 1:248187881-248187903 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883439 1:248187946-248187968 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883491 1:248188207-248188229 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883503 1:248188272-248188294 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883515 1:248188337-248188359 CTCTCTGAGCAGAAGCAGGAGGG + Intergenic
924883527 1:248188402-248188424 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883539 1:248188467-248188489 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883551 1:248188532-248188554 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883563 1:248188597-248188619 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883575 1:248188662-248188684 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
924883599 1:248188792-248188814 CTCTCTGAGCAGAAGCAGGATGG + Intergenic
1062909584 10:1204149-1204171 CTGTCTTGTCAAAAGGTGGGAGG - Intronic
1063856234 10:10257324-10257346 CTGTCTGTGCAGCAGGAGGAGGG - Intergenic
1066550710 10:36553263-36553285 CAGTGTGATCAGAGGCAGGGTGG + Intergenic
1068423848 10:56830262-56830284 CTGGCTGATCAGCAGGGTGGTGG + Intergenic
1068721638 10:60252310-60252332 CTGTCTGATGACAGGGAGTGTGG + Intronic
1071450855 10:85790523-85790545 CTGTCTGGGCAGAGGGAGTGGGG + Intronic
1074372850 10:112914192-112914214 CTGTCTGAAAAGAAAGAAGGAGG - Intergenic
1076762175 10:132611309-132611331 CTGTCAGAGGAGAATGAGGGAGG + Intronic
1081232903 11:40607735-40607757 CTGCCTCATCACAAGGAGAGAGG - Intronic
1081880300 11:46444489-46444511 CTGTCTGATCAGAAGGAGGGTGG - Intronic
1082079438 11:48000707-48000729 CTGAGTGATAAGAAGGAGCGAGG - Intronic
1083185093 11:61012809-61012831 ATGTCTGGTGGGAAGGAGGGGGG + Intronic
1083441409 11:62678956-62678978 GTGTGTGACGAGAAGGAGGGCGG + Exonic
1084618199 11:70250684-70250706 CTGGCTGCTCAGTAGGATGGAGG + Intergenic
1085200234 11:74697401-74697423 GTGTCTGATCAGAATGGGGTGGG - Intronic
1086142052 11:83510228-83510250 CTCTCCTATCTGAAGGAGGGAGG - Intronic
1086256661 11:84885065-84885087 CTGTATGATAAGAAGAAGTGAGG - Intronic
1086395681 11:86412951-86412973 CTGTCTTATCACAAGGAGAGAGG + Intronic
1086931235 11:92695164-92695186 CTGTCTGGTCAGAAGAAGTAAGG + Intronic
1089063284 11:115643509-115643531 GACTCTCATCAGAAGGAGGGAGG - Intergenic
1089295763 11:117466670-117466692 CTGTCTCAACAAAAGGAGGGTGG + Intronic
1091889776 12:4044374-4044396 CTGAATGATCAGGAGGAGGCTGG - Intergenic
1092118623 12:6027517-6027539 GGGTCTGATCAGAGGGAGGCAGG + Intronic
1094050127 12:26210664-26210686 CTGTCTCAACAGATGCAGGGGGG - Intronic
1094325940 12:29239178-29239200 CTGCCTGTTCACAAGGAGAGGGG + Intronic
1097633120 12:62088439-62088461 CTGTCTGAGCAGAAGGACCGGGG - Intronic
1100070392 12:90709270-90709292 GTGTCTGCTCACATGGAGGGCGG + Intergenic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1106513263 13:30429860-30429882 GTGTCTGAACAGAAGGGGGTGGG + Intergenic
1107626554 13:42291861-42291883 CTGTCTGATGAAAATGAGAGGGG - Intronic
1108800686 13:54091896-54091918 CTGCCTGGTGACAAGGAGGGAGG + Intergenic
1110498103 13:76192687-76192709 CTTTCTGATCAGAAATAGGGTGG + Intergenic
1111665833 13:91266954-91266976 CTGTCTGGTCACAAGCAGGAGGG + Intergenic
1112025973 13:95411463-95411485 CTGTCTGAGCATAAGGTGGGGGG + Intergenic
1112215314 13:97424799-97424821 ATGTCTGATGGGGAGGAGGGTGG - Intergenic
1112323884 13:98430588-98430610 CTGTCTGAGCAGACGGGGCGAGG + Intronic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1117162400 14:53002231-53002253 CTGGGAGATGAGAAGGAGGGAGG - Intergenic
1117785337 14:59278181-59278203 CTGTGTGATCAGATGAAGTGAGG + Intronic
1118839072 14:69497550-69497572 CTGGCTGAAGAGAAAGAGGGAGG + Intronic
1118920753 14:70147745-70147767 CTGTCTTATCTGAAGCATGGGGG - Intronic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1121851926 14:97229137-97229159 GTGTCTGATGAAAAGCAGGGAGG + Intergenic
1122386281 14:101350476-101350498 TTTTCTGAGCAGCAGGAGGGTGG - Intergenic
1122773059 14:104105731-104105753 CTGCCTGTCCAGAAGAAGGGCGG + Intronic
1125587473 15:40831020-40831042 CTTCCTGAGCAGGAGGAGGGGGG + Intergenic
1126181961 15:45794021-45794043 CCCTCTGTGCAGAAGGAGGGAGG + Intergenic
1128261506 15:66236192-66236214 CTGTGTGTTCTGGAGGAGGGAGG + Intronic
1128589323 15:68880736-68880758 AGGCCTGATGAGAAGGAGGGGGG + Intronic
1132224211 15:100128014-100128036 ATGTCTGGTCATGAGGAGGGTGG - Intronic
1133481918 16:6179083-6179105 CTGTCTTACCACAGGGAGGGTGG + Intronic
1134024067 16:10941537-10941559 CTCTCTGAACAGGATGAGGGCGG - Intronic
1134685763 16:16157043-16157065 CTGTAGGTTCAGAGGGAGGGAGG + Intronic
1138008940 16:53360364-53360386 CAGTCAGATCAGAAAGAAGGGGG + Intergenic
1139484914 16:67249951-67249973 CTGGCTGCTCAGAAGGGAGGAGG - Intronic
1140107382 16:71973180-71973202 CTGCCTGGGCAAAAGGAGGGAGG - Intronic
1141422193 16:83924572-83924594 CTGTCTGAGCAGCAGGAGTGAGG - Exonic
1143017081 17:3896632-3896654 CTGTCTGAACAGAAGGTCTGGGG - Exonic
1143564196 17:7711785-7711807 GTGGCTGATCAGAAGGAAGTAGG + Intergenic
1148113673 17:45162165-45162187 CTTTCTGAGAGGAAGGAGGGAGG + Intronic
1150465408 17:65388490-65388512 CTGTGTGAACAGAAGGATAGTGG - Intergenic
1150472424 17:65448474-65448496 CTGTAAGATAAGAATGAGGGTGG + Intergenic
1151820234 17:76493082-76493104 CAGTCAGGACAGAAGGAGGGCGG + Intronic
1152303189 17:79507184-79507206 GTGTCTGATAAGAAGCAGGCGGG - Intronic
1153773778 18:8435422-8435444 CTGCCTTATCACAAGGAGAGAGG - Intergenic
1155384379 18:25261251-25261273 CTGTCTGATTAGCAGGAGCTAGG + Intronic
1155488573 18:26373788-26373810 CTGGGTGAACAGAGGGAGGGAGG - Intronic
1155615356 18:27715725-27715747 CTGTAACATCAGAAGTAGGGAGG - Intergenic
1156786061 18:40916866-40916888 CTATCTGAACCAAAGGAGGGAGG - Intergenic
1157776934 18:50403202-50403224 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1159869842 18:73748017-73748039 TGCTCTGATCAGAAGGAGGGAGG - Intergenic
1159921367 18:74230191-74230213 CTGGCCGGTCAGAAGGAAGGAGG + Intergenic
1160297880 18:77654580-77654602 CTGTGTGATGAGAGGGAGAGCGG - Intergenic
1161510521 19:4668369-4668391 ATGTCTGGACAGAAGGAGGGAGG - Intronic
1161660704 19:5544189-5544211 CTGGCGGTTCAGCAGGAGGGAGG - Intergenic
1162621440 19:11847527-11847549 CTGTCTGGTCAGAGAAAGGGTGG - Intergenic
1164497590 19:28782155-28782177 CTGTCTCATCAGAATGACAGTGG - Intergenic
1165272772 19:34724775-34724797 CTCTCTCAGCAGGAGGAGGGGGG - Intergenic
1165895064 19:39136463-39136485 CTGACTGAACAGAAGGAAGGAGG - Intronic
1165991644 19:39818590-39818612 CTGTCTGCTCAGAAGGGCTGTGG - Intergenic
1167094504 19:47367164-47367186 CTGAGTGATCAGGAGGGGGGTGG - Intronic
1167107114 19:47436826-47436848 CTGTCTGAGGCCAAGGAGGGTGG + Intronic
1167717150 19:51150819-51150841 CTGTGTGATTAGACAGAGGGAGG + Intronic
1202695319 1_KI270712v1_random:119057-119079 CTATCTGATCAGGAGGTGGGGGG - Intergenic
925088946 2:1137611-1137633 CTGTCTGGTCAGCTGCAGGGTGG - Exonic
925920129 2:8632583-8632605 CTGTTTGAGCAGAAGGATGGAGG + Intergenic
927139175 2:20118159-20118181 CTGGAAGATCAGGAGGAGGGTGG + Intergenic
929115816 2:38443137-38443159 CTGACTGATCTGGAGGAGCGGGG - Intergenic
932144206 2:69304781-69304803 CTGCCTGATCTGAGGGTGGGTGG + Intergenic
932343716 2:70982347-70982369 CTGGCTCCTCAGCAGGAGGGTGG + Intronic
933249784 2:80016355-80016377 CAGGCTGCTCAGAAGGAAGGAGG + Intronic
934276486 2:91576105-91576127 CTATCTGATCAGGAGGTGGGGGG - Intergenic
937243532 2:120477640-120477662 CAGTATGTTCAGAAGGAGGCTGG - Intergenic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942309972 2:174647109-174647131 GTGTCTGATCAAAAGTAAGGAGG + Intronic
944066473 2:195624537-195624559 TTGTCCACTCAGAAGGAGGGAGG + Intronic
944821715 2:203439540-203439562 CTGTCTGATCAACAGAAGGCTGG - Exonic
946197080 2:218040037-218040059 CTGTCTGATAAGAATAAAGGGGG - Intronic
946407973 2:219502209-219502231 CTGGCTGTTCAGAAGTAGGGAGG + Intronic
948217379 2:236241725-236241747 CTGTATCATCACAAAGAGGGTGG - Intronic
948259302 2:236591042-236591064 CTGTCTGAGCAGGAGGCAGGAGG - Intergenic
1171000687 20:21412836-21412858 CTGTCTAAAAAAAAGGAGGGAGG - Intergenic
1172066333 20:32223291-32223313 CTGTCTGGAAAGAATGAGGGGGG - Intronic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1174276797 20:49409861-49409883 CTGTCTGAGCAAAGGTAGGGAGG - Intronic
1176233775 20:64044905-64044927 CTGACTCAGCAGGAGGAGGGTGG + Intronic
1176933231 21:14838909-14838931 CTGTAAGACCAGAAGGAAGGTGG + Intergenic
1177752655 21:25304725-25304747 GTGTCAGAACAGAAGGAAGGCGG + Intergenic
1180228949 21:46414761-46414783 CTGTGTGTCCAGGAGGAGGGTGG - Intronic
1182994735 22:34801624-34801646 CTGCCTTATCAGAAGGACAGAGG - Intergenic
1183167829 22:36160917-36160939 CTCTTGGATCAGCAGGAGGGTGG - Exonic
1183717746 22:39543751-39543773 CTTTCTGAGCAGGAGGAGTGGGG - Intergenic
1184409103 22:44316387-44316409 CTGTTGGATCAGAACCAGGGTGG + Intergenic
1184677445 22:46051385-46051407 CTGTCCCATGAGCAGGAGGGTGG + Exonic
1185398244 22:50603467-50603489 CAGTGTGGTCAGACGGAGGGTGG - Exonic
950076949 3:10194028-10194050 CTGGCAGAACTGAAGGAGGGTGG + Intronic
951120438 3:18920698-18920720 CTGTGTTTTCAGAAGGAGGAAGG - Intergenic
952387417 3:32852277-32852299 TTCTCTGACCAGAGGGAGGGTGG + Intronic
953054990 3:39380973-39380995 CTGTCAGAGCAGGAGGAGGTGGG - Intergenic
955168548 3:56540129-56540151 TTGCCTGGTCTGAAGGAGGGAGG - Intergenic
955480593 3:59385557-59385579 CTGTCTTATCACAAGGACAGAGG - Intergenic
955509154 3:59662100-59662122 ATGTGTGATGAGCAGGAGGGAGG + Intergenic
959520170 3:107316439-107316461 CTGTCTGGTGACAAGTAGGGTGG + Intergenic
960739102 3:120813143-120813165 CCATGTGATGAGAAGGAGGGAGG - Intergenic
964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG + Intergenic
966509810 3:180749322-180749344 CTTTAAGAGCAGAAGGAGGGTGG + Intronic
967184001 3:186930314-186930336 CTGCCTGCTCTCAAGGAGGGTGG - Intergenic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
968278458 3:197458291-197458313 CTGTCTGTTCAGCAGCTGGGTGG + Intergenic
968505446 4:969091-969113 CTGGCTGGTCAAAAGCAGGGAGG + Intronic
968505479 4:969199-969221 CTGGCTGGTCAAAAGCAGGGAGG + Intronic
968507981 4:980769-980791 CTGGCTGATAAGAGGGAAGGAGG - Intronic
968588923 4:1448217-1448239 CTGCCAGGACAGAAGGAGGGTGG + Intergenic
972199203 4:36693086-36693108 CTCTCTTACCAGAAGGAGGAGGG - Intergenic
973120711 4:46518436-46518458 CCGTCTAATCAGAATGAGGGTGG + Intergenic
978589420 4:110308858-110308880 CTGCCTGGTGAGCAGGAGGGAGG + Intergenic
981423828 4:144581222-144581244 CTGTCTTATCACAAGGACAGTGG - Intergenic
983196340 4:164811036-164811058 CTGTCTAAAAAGAAGGAAGGAGG + Intergenic
984887021 4:184458112-184458134 CTGACTGGCCGGAAGGAGGGAGG - Intronic
985652997 5:1115691-1115713 CTTTCTGGTGAGAAGGAGTGTGG - Intergenic
993030740 5:82703019-82703041 ATGTCTGATGTGATGGAGGGAGG - Intergenic
993077608 5:83253907-83253929 CTGTCAGATGAGAAGAAGTGTGG + Intronic
994674747 5:102806181-102806203 CTGTCTAAACAGAATTAGGGTGG - Intronic
996349330 5:122520966-122520988 TTGCCTAATCAGAAGGAGGCAGG + Intergenic
998092553 5:139379826-139379848 CAGCATGATCTGAAGGAGGGGGG + Exonic
999357776 5:150953308-150953330 CTATCTGGTCAGAAGTAGGGAGG + Intergenic
999357795 5:150953392-150953414 CTATCTGGTCAGAAGTAGGGAGG + Intergenic
1001305242 5:170567651-170567673 CTTTCTGATCAGAAGTTGGATGG + Intronic
1001563725 5:172686424-172686446 CTGTATGCTCAGCTGGAGGGAGG + Intronic
1006098081 6:31668675-31668697 CTTACTGCTCAGAAGGAGGCAGG - Intronic
1006193318 6:32222573-32222595 CTTTTGGAACAGAAGGAGGGAGG + Exonic
1006298903 6:33182928-33182950 CTGTTTGGTCAGAATGAAGGTGG - Intronic
1006391795 6:33763016-33763038 CTGTCAGAAGATAAGGAGGGAGG - Intergenic
1006505508 6:34486276-34486298 CTGTCAGCTGAGAGGGAGGGAGG + Intronic
1008892179 6:56507687-56507709 CTTTCTAATCAGTAGCAGGGAGG + Intronic
1009733820 6:67648126-67648148 CTGACTGATCAGAGAGATGGTGG - Intergenic
1014325416 6:119986948-119986970 CTGTCTTATCAGAAGGACAGAGG - Intergenic
1015414262 6:132930881-132930903 CTGTCTGAGCAGCAGGAGGGAGG + Intergenic
1015809825 6:137150867-137150889 CTCTCTAATTAGCAGGAGGGTGG - Intronic
1016005007 6:139080173-139080195 CTTTCTAATCAGAAGGAGGAGGG + Intergenic
1016556976 6:145349787-145349809 CTGTCTGAAGAGAAGCAGGATGG + Intergenic
1017980160 6:159394311-159394333 CTGTCTTATCACAAAGATGGAGG - Intergenic
1019413890 7:918813-918835 CTGTCTGCTCTGTAGGAGGTGGG - Intronic
1019435839 7:1021709-1021731 CTGTCTGGTGACAAGTAGGGAGG - Intronic
1019647584 7:2139318-2139340 CTGTGAGCTCAGAGGGAGGGTGG - Intronic
1019667316 7:2258367-2258389 CGGGCTGATGAGCAGGAGGGCGG - Intronic
1019937511 7:4266073-4266095 CTGTCAGGTGAGAAGGAAGGGGG - Exonic
1022921094 7:35015564-35015586 CTGTATGGTCTGAAAGAGGGAGG + Intronic
1023214654 7:37848805-37848827 CTGTCTGGGAAGAAGAAGGGGGG - Exonic
1023516571 7:41008038-41008060 CTGGCTGCTTAGAAAGAGGGTGG + Intergenic
1026503259 7:70960580-70960602 CTGCCAGAGGAGAAGGAGGGTGG + Intergenic
1032455298 7:132068596-132068618 CTATCTGGTGAGAAGGAAGGGGG - Intergenic
1035692877 8:1571556-1571578 GTGTCTGATGAGATGGAGAGGGG + Intronic
1036168090 8:6456731-6456753 CTGTCTGATCAAAAGGCATGAGG + Intronic
1036429942 8:8680858-8680880 CTCTCTGATCTGAAGCAGGTGGG - Intergenic
1036799712 8:11781266-11781288 CTGGAAGTTCAGAAGGAGGGTGG + Intronic
1039152491 8:34522236-34522258 CTGGCTGTTCATAAGCAGGGAGG + Intergenic
1040425527 8:47281261-47281283 CTGACTGATCAGATGGTTGGTGG + Intronic
1040782139 8:51121926-51121948 CTGCCTTATCAGAAGGACAGAGG - Intergenic
1041713537 8:60913893-60913915 GTGTCTGATGTGCAGGAGGGAGG + Intergenic
1044573326 8:93743320-93743342 CTGTGTGAATAGAAGGAGGATGG - Intergenic
1044722441 8:95164048-95164070 ATGTCAGCTCTGAAGGAGGGAGG - Intergenic
1047402530 8:124558646-124558668 CTGTCTGAGCAGCAGGCAGGGGG + Intronic
1047771963 8:128037040-128037062 CTGACTGGTCAGGAGGAGAGGGG - Intergenic
1048919009 8:139210859-139210881 CTGTCTAATTAGAAGGCGAGTGG + Intergenic
1049732040 8:144183502-144183524 CTGATTGATCAGAAGGATGCTGG - Intronic
1050880896 9:10699535-10699557 CTGTCAGATCAGCAGCAGTGGGG + Intergenic
1053466117 9:38309934-38309956 CTCTCCAACCAGAAGGAGGGTGG - Intergenic
1053885925 9:42645209-42645231 TAGTCTGAGCAGTAGGAGGGGGG + Intergenic
1054224943 9:62452658-62452680 TAGTCTGAGCAGTAGGAGGGGGG + Intergenic
1055132740 9:72794084-72794106 CTGTCTGGTGACAAGGAGGGGGG - Intronic
1057449084 9:95140577-95140599 CTGTCTGAGCAGTAGAGGGGAGG + Intronic
1058286770 9:103188446-103188468 CTGCCTAATTAGAAGGAGGCAGG - Intergenic
1058498536 9:105587289-105587311 ATGTTTGGTTAGAAGGAGGGAGG + Intronic
1060506334 9:124200945-124200967 CTTTCTGGCCACAAGGAGGGAGG - Intergenic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1061315928 9:129795760-129795782 CTGTGGGATGAGAACGAGGGAGG + Intergenic
1061315933 9:129795783-129795805 CTGTGGGATGAGAACGAGGGAGG + Intergenic
1187257914 X:17657974-17657996 CTTCCTGGTCAGCAGGAGGGTGG + Intronic
1187697540 X:21937172-21937194 CTGTCTGCTCAGAAGCAAGTGGG + Intergenic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1189487785 X:41446237-41446259 GGGTCTGATCAAAATGAGGGTGG - Intergenic
1192098493 X:68238934-68238956 CTGCCTTATCACAAGGAGAGAGG + Intronic
1197356078 X:125438647-125438669 CTGTCACATCAAAAGGAAGGAGG - Intergenic
1198209330 X:134502027-134502049 ATGTCTTATCAGAACCAGGGAGG + Intronic
1199473509 X:148221095-148221117 CAGTCTGTTCAGAAGGAGTTAGG - Intergenic
1200487349 Y:3785639-3785661 CTATCTGCTGAGAAGGGGGGGGG - Intergenic
1200924413 Y:8641667-8641689 CTGTTGGATGAGAAGCAGGGAGG + Intergenic