ID: 1081884578

View in Genome Browser
Species Human (GRCh38)
Location 11:46483902-46483924
Sequence AAAGGTAAAAAGAAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1342
Summary {0: 1, 1: 0, 2: 6, 3: 144, 4: 1191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081884574_1081884578 17 Left 1081884574 11:46483862-46483884 CCTGGGCAACAAAGTGAGACTCT 0: 438
1: 10611
2: 46228
3: 112951
4: 203960
Right 1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG 0: 1
1: 0
2: 6
3: 144
4: 1191
1081884573_1081884578 21 Left 1081884573 11:46483858-46483880 CCAGCCTGGGCAACAAAGTGAGA 0: 2291
1: 39001
2: 98206
3: 211750
4: 329342
Right 1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG 0: 1
1: 0
2: 6
3: 144
4: 1191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081884578 Original CRISPR AAAGGTAAAAAGAAGGAGGT AGG Intronic
900704730 1:4073251-4073273 AAGGGGAAAAAGAAGGAGAGTGG + Intergenic
900904189 1:5539396-5539418 AAAGGGAGAAAGCAGGAGTTTGG + Intergenic
900926623 1:5710108-5710130 AAAGGAAAGAGGAAGGAAGTGGG - Intergenic
901480163 1:9519652-9519674 AAAAAAAAAAAGAGGGAGGTTGG + Intergenic
901963455 1:12846226-12846248 AAAGGTTGAAAGAAGGGGATGGG - Intergenic
901984767 1:13066274-13066296 AAAGGTTAAAAGAAGGGAATGGG + Intronic
901997043 1:13160496-13160518 AAAGGTTAAAAGAAGGGAATGGG - Intergenic
902101180 1:13990835-13990857 AATTGTAGAATGAAGGAGGTGGG + Intergenic
902402681 1:16166744-16166766 AAAGGAAAAAGAATGGAGGTGGG - Intergenic
902492313 1:16792767-16792789 AAAGGAAAAAAGAAGTATTTAGG - Intronic
902562654 1:17287402-17287424 AGAGGTGAAATGAGGGAGGTAGG + Intergenic
902758987 1:18568592-18568614 AAAGGAAAGAAGAAGAAGGGAGG + Intergenic
903145825 1:21371427-21371449 AAAAAAAAAAAGAAGGAGTTGGG + Intergenic
903314546 1:22491516-22491538 AAAGGTCCACAGAAGGAGGTAGG + Exonic
903865207 1:26392774-26392796 GAGGGTAAAAAGAAGTGGGTGGG + Intergenic
904240682 1:29142833-29142855 AAGAGTGAAGAGAAGGAGGTTGG - Intergenic
904257472 1:29264497-29264519 AAAAAAAAAAAGAATGAGGTTGG - Intronic
904294726 1:29512057-29512079 GAAGAGAAAAAAAAGGAGGTGGG + Intergenic
904390819 1:30184633-30184655 AAAGGAAAGAAGATGGAGGTGGG - Intergenic
904490289 1:30854484-30854506 GGAGGTAGAAAGAGGGAGGTGGG - Intergenic
904512114 1:31020055-31020077 AAAGGGAAAGGGAAGGAGGGAGG - Intronic
904535116 1:31194336-31194358 AAAAGGAAAAAGAAAGAGCTGGG - Intronic
904900051 1:33849980-33850002 AAGGGTAAAGAGGAGGAGGCAGG - Intronic
904998543 1:34650343-34650365 AGAGAGAAAAAGAAGGAGGGAGG + Intergenic
905102786 1:35540196-35540218 AAAGGGAAACAGAAGCAGGGAGG - Intronic
905589150 1:39147104-39147126 AAAGAAGAAAAGAAGGAGGGAGG - Intronic
905634323 1:39539226-39539248 AAAGGTGAAAGGTAGGTGGTTGG + Intergenic
905948316 1:41922790-41922812 AAAGGAAGAAGGAAGGAGGGAGG + Intronic
906348551 1:45037100-45037122 AAAAAAAAAAAAAAGGAGGTGGG - Intronic
906349276 1:45043784-45043806 AAAGGTAGAGAGAAGAAGCTAGG + Intronic
906370671 1:45250647-45250669 GAAGGAAGAAAGAAGGAGGGAGG + Intronic
906729891 1:48071996-48072018 AAATATAAAAAGGATGAGGTGGG - Intergenic
906783982 1:48597875-48597897 AAAGAAAAAAAGAAAGAGGGAGG + Intronic
907040390 1:51253526-51253548 AAAAAAAAAAAAAAGGAGGTGGG + Intronic
907330217 1:53666031-53666053 AAATTTAAAAAGTGGGAGGTAGG + Intronic
907522520 1:55033491-55033513 AAAGGAAAAGAGAAGAGGGTGGG - Intergenic
907548751 1:55286305-55286327 TAAGGTAAGAAAAAGGAAGTTGG - Intergenic
907684201 1:56594088-56594110 AAAGGTAGAAGCAAGGAGTTTGG + Intronic
907724556 1:57007013-57007035 AGAGAGAAAAAAAAGGAGGTAGG - Intronic
907770105 1:57452995-57453017 AAAAGAAAAAAGAAGGAGGGAGG + Intronic
907847988 1:58227199-58227221 AAAGGTTCAAAGAAGGAAATGGG + Intronic
907920756 1:58909495-58909517 AAAGGGAAGAAGAAGGATGATGG + Intergenic
908029287 1:59982722-59982744 AAAGGAAAAGAAAAGGAGCTAGG - Intergenic
908330503 1:63066216-63066238 AAAGAGAGAAAGAGGGAGGTGGG - Intergenic
908792997 1:67801936-67801958 GAAGGAAAAAAGAAGGAAGGGGG + Intronic
908900223 1:68947915-68947937 AAAGGGAAAAATAAGGGGGAAGG + Intergenic
909151696 1:72013975-72013997 AAAAAAAAAAAAAAGGAGGTTGG + Intronic
909583334 1:77262793-77262815 GAAGGTAAATAGATGGCGGTGGG - Intergenic
909606017 1:77508870-77508892 AAAAAAAAAAAGAAGAAGGTGGG + Intronic
909813653 1:79962762-79962784 AAAGGAAAAGAGAAGGAGAAAGG + Intergenic
910187265 1:84557557-84557579 AAAAAAAAAAAGAAGGAGGCTGG + Intronic
910328723 1:86043506-86043528 AAAAATAAAAAGAAGAAGTTTGG - Intronic
910405448 1:86884637-86884659 AAAAGTAAAAATACTGAGGTTGG - Intronic
910523275 1:88148434-88148456 AAAGGAAGAAAGAAGAAGGAAGG + Intergenic
910583438 1:88853502-88853524 AAAGGTAGAAAGCGGGAGCTAGG + Intronic
910707635 1:90146679-90146701 AAAAGGAAAAAGAAGGAAGAGGG + Intergenic
910981609 1:92963929-92963951 AAAGAGAGAAAGAAGGTGGTAGG + Intergenic
911122745 1:94312423-94312445 AAAAAAAAAAAGAAGGAGGGGGG - Intergenic
911201923 1:95053180-95053202 AAAAGTGAAAATAAAGAGGTGGG + Intronic
911219263 1:95229989-95230011 AAAGAGAAAAAAAAAGAGGTAGG - Intronic
911575865 1:99577188-99577210 AAAGGGAAAAGGGAGGAGGGAGG + Intergenic
911936343 1:103979101-103979123 AAAGGTAACAATAAGTAGGAAGG - Intergenic
912338323 1:108884617-108884639 AGAGGGAAAAGGAAGGAGATGGG + Intronic
912545638 1:110449204-110449226 AAAAATAAAAAAAAGGTGGTGGG - Intergenic
913518661 1:119625304-119625326 AAAGACAGAAACAAGGAGGTGGG + Intronic
913653492 1:120940154-120940176 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
913939860 1:125091637-125091659 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
913944481 1:125145588-125145610 ATAGGAACAAAGAAGGAGTTAGG + Intergenic
913954698 1:143278187-143278209 ATAGGAACAAAGAAGGAGTTAGG - Intergenic
913979215 1:143493455-143493477 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
913982738 1:143537178-143537200 ATAGGAACAAAGAAGGAGTTAGG + Intergenic
914043606 1:144072789-144072811 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914073618 1:144319105-144319127 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
914105537 1:144647255-144647277 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
914134481 1:144887702-144887724 AAAAGTAAAAAGGAGGAGGAGGG + Exonic
914167605 1:145188874-145188896 AAGGGTAAAAAGAAAAAGGAGGG + Intergenic
914519183 1:148400278-148400300 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914643676 1:149634313-149634335 AAGGGTAAAAAGAAAAAGGAGGG - Intergenic
914692949 1:150047370-150047392 ACAAGTTTAAAGAAGGAGGTTGG - Intergenic
915885367 1:159715961-159715983 AAAGGGAAAAAGGGGGAAGTGGG - Intergenic
915929340 1:160049433-160049455 ATAGGTAAAGACAAGGAGGAAGG - Intronic
916213894 1:162380044-162380066 AAAGAAAATAAGAAGGATGTGGG + Intronic
916324198 1:163538906-163538928 AAGGGAATAAAGAAGGAGGCTGG + Intergenic
916522023 1:165572176-165572198 AAAAACAAAAAAAAGGAGGTAGG - Intergenic
916691086 1:167190622-167190644 AATGGTAAAAGGAAGGAGAGGGG - Intergenic
916953704 1:169809414-169809436 AAACTGAAAAAGGAGGAGGTTGG - Intronic
916968822 1:169985815-169985837 AAAGGTAAGAAGGAAAAGGTAGG + Intronic
916982708 1:170155359-170155381 AAAGGAAAAAAGAGAGAGGAAGG - Intronic
917381871 1:174420191-174420213 AAAAAAAAAAAAAAGGAGGTTGG - Intronic
917683736 1:177394806-177394828 AAAGGTTACCAGAGGGAGGTAGG + Intergenic
917947813 1:179994418-179994440 AAAAGAAAAAAGAAAGAGATAGG - Intronic
917982578 1:180280393-180280415 TTAGGTACAAAGCAGGAGGTTGG + Intronic
918327797 1:183427074-183427096 AAAGGAATAAAGAGGGAAGTGGG + Intergenic
918540615 1:185627986-185628008 AAGGCTAAAAAGAGGGAGGCTGG - Intergenic
918735137 1:188052042-188052064 ATAAGTAAAAGAAAGGAGGTTGG - Intergenic
919058868 1:192606057-192606079 GAAAGAAAAAAGAAGGAGGGAGG + Intergenic
919112503 1:193238305-193238327 AAAAGGAAAAAGAAGAAGCTAGG - Intronic
919529194 1:198694760-198694782 AAAGGAAAAGAAAAGGGGGTGGG - Intronic
919538901 1:198824845-198824867 AAAGGGATAGAAAAGGAGGTGGG + Intergenic
919613511 1:199776674-199776696 AAAGGAATAAAGAGGGAGGAAGG - Intergenic
919677718 1:200401967-200401989 CTAGGTAAAAAGATGTAGGTTGG + Intergenic
920288910 1:204902735-204902757 AAAGGAAAAAAGAAGAGGGAAGG + Intronic
920358321 1:205392757-205392779 AAAGGAGAGAAGAATGAGGTGGG + Intronic
920683390 1:208090333-208090355 AAATGAAACAAAAAGGAGGTGGG + Intronic
920805039 1:209224968-209224990 AAAGGGAAAGAGAAGGAGAATGG - Intergenic
921315383 1:213885560-213885582 AAAGGGGAAAAGAAGAAGGCAGG - Intergenic
921320392 1:213932855-213932877 AAAGATCCAAAGAAGGAGGATGG - Intergenic
921868575 1:220112433-220112455 AGGGGTAAAAAGTAGGTGGTCGG - Intronic
921926741 1:220716743-220716765 ACAGGTAAAATAAAGCAGGTTGG + Intergenic
922117773 1:222631101-222631123 AAAGAAAAAAAGAAAGAGGAAGG - Intronic
922142028 1:222896615-222896637 AAAGGTAAAAAGAAAAAGCAAGG + Intronic
922230921 1:223685051-223685073 AAAAGCAAAAAGAAGAAAGTAGG + Intergenic
922821847 1:228490095-228490117 TCAGGTTAAAAGAAGGAGATAGG - Intronic
922953392 1:229578392-229578414 AAAGAGAAAAAGAGGGAGGGAGG - Intergenic
923054420 1:230415105-230415127 AAAATTAAAAAGAATTAGGTGGG + Intronic
923528135 1:234789770-234789792 AAAGGAAAAAAGAAGTATTTAGG + Intergenic
923861926 1:237900018-237900040 AAAAAAAAAAAAAAGGAGGTGGG - Intergenic
923946994 1:238899176-238899198 AATGGGAGAAAGAAGGAGGCTGG + Intergenic
923978619 1:239294728-239294750 AAAGGTAATGAGCTGGAGGTGGG - Intergenic
924196946 1:241618021-241618043 AAAAATAAAAAAAAGAAGGTGGG + Intronic
924202557 1:241675028-241675050 GAAGGAAAGAAGAAGGAGGGAGG - Intronic
924227079 1:241930888-241930910 AAAGGAAAAAGGAATGAGGCTGG + Intergenic
924230666 1:241959342-241959364 AAAGAAAAAAAAAAGAAGGTCGG - Intergenic
924261011 1:242231435-242231457 TAAGGTAAAGAGAACGATGTTGG - Intronic
924414146 1:243840818-243840840 AAAAATAAAAGGAAGAAGGTAGG + Intronic
924743862 1:246814633-246814655 AAGGGTCAAAAGCAGGCGGTGGG - Intergenic
924910833 1:248511510-248511532 GAAGGAAAAAAGAAGGAAATGGG + Intergenic
924913268 1:248536530-248536552 GAAGGAAAAAAGAAGGAAATGGG - Intergenic
1062999845 10:1906133-1906155 AAAGGAAGAAAGAAGGAGGTGGG + Intergenic
1063462281 10:6222314-6222336 AAATGTAAAAAGAAGCAGGAGGG - Intronic
1063534224 10:6867065-6867087 AAAGAGAAAGAGAAGGAGGGAGG - Intergenic
1064322443 10:14318324-14318346 CAAGGTAAAAAAAAAAAGGTGGG - Intronic
1065038729 10:21668291-21668313 AAAGGAGACCAGAAGGAGGTGGG - Intronic
1065111278 10:22442473-22442495 AAAGGTACAAAATAGGAGGTAGG + Intronic
1065113639 10:22463439-22463461 AAAGGTAAACAGTCAGAGGTGGG - Intergenic
1065276554 10:24092063-24092085 TAAGGGAAAGAGAAGGACGTTGG - Intronic
1065557984 10:26935783-26935805 AAAGCAAAAAAGAAGGCAGTGGG + Intergenic
1065654400 10:27932958-27932980 AAAGGAATAAATAAGGAGCTGGG + Intronic
1065692299 10:28347056-28347078 AAAGGGAGAAAGAAAGAGGAAGG + Intergenic
1066030283 10:31415078-31415100 TAACGTAAGAAGATGGAGGTGGG - Intronic
1066052649 10:31649384-31649406 AAAGAAAAATAAAAGGAGGTGGG + Intergenic
1066102816 10:32132919-32132941 AAAGGCAAAAAGAGGGAGACAGG - Intergenic
1066780275 10:38938148-38938170 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1066956023 10:42173434-42173456 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1067244858 10:44531462-44531484 AAAGGTAGTAAGAAGGAGGGTGG + Intergenic
1067878458 10:50024413-50024435 GAAGGTGATAAGCAGGAGGTGGG - Intergenic
1067893264 10:50153515-50153537 GAAGGTGATAAGCAGGAGGTGGG + Intergenic
1068128175 10:52866677-52866699 AAAAAAAAAAAAAAGGAGGTAGG + Intergenic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068219464 10:54025854-54025876 AAATGGAAAAAGATGGAGGGAGG - Intronic
1068513868 10:58002096-58002118 AAAGGAAAAAAGAAGCAGTCAGG - Intergenic
1068540516 10:58289157-58289179 TATCTTAAAAAGAAGGAGGTGGG - Exonic
1068558241 10:58482144-58482166 AAAGGTGGAAAGAAGGAGGGAGG - Intergenic
1068755471 10:60648139-60648161 AAAGGAAAAAAAAAAGAGGCTGG - Intronic
1068757311 10:60669981-60670003 AAAGGAAAAAAAAAGTAGCTGGG - Intronic
1068842676 10:61632652-61632674 AAAGTTAAAAAAAAAAAGGTAGG - Intergenic
1068966396 10:62916155-62916177 ATTGGTAAAACAAAGGAGGTTGG + Intronic
1069172171 10:65245692-65245714 AAAGGTGAACAGAAGGCTGTTGG - Intergenic
1069254452 10:66314475-66314497 AAAGGAAAAAAGAATGATATTGG - Intronic
1069580092 10:69559913-69559935 AAAGGGGAAAAGACGGAGGGAGG + Intergenic
1069711433 10:70491410-70491432 ATAGGAAAAAAAAAGCAGGTGGG - Intronic
1069976831 10:72220490-72220512 AAAAGTAAAAAGAATTAGCTGGG + Intronic
1070868232 10:79723512-79723534 AGAGGAAACAAGAAAGAGGTGGG + Intergenic
1070947740 10:80407607-80407629 AAAAACAAAAAGTAGGAGGTTGG - Intergenic
1071359288 10:84829536-84829558 AAAAGAAAAGAGAAGGAGCTGGG + Intergenic
1071553235 10:86583622-86583644 AAAAGAAAAAAGAAGTAGTTGGG + Intergenic
1071735119 10:88290076-88290098 AAAGATGAAAGGAAAGAGGTAGG + Intronic
1071905788 10:90172175-90172197 AAAGGTAAAAAGAGGCAGCCTGG - Intergenic
1072041291 10:91609079-91609101 AAAGGGAGAAGGGAGGAGGTAGG + Intergenic
1072355390 10:94605077-94605099 AAAGGAAAAAAAAAGGGGGGGGG - Intronic
1072388973 10:94962689-94962711 AAAGGCAAAGAGTAGGAAGTTGG - Intronic
1072443361 10:95477123-95477145 AAGGGAAAAGAGGAGGAGGTCGG - Intronic
1072444744 10:95489237-95489259 AGAGAGAAAAAGAAGGAGATTGG - Intronic
1072571768 10:96664382-96664404 AATGGTAGAAGGAAGGAGGGAGG - Intronic
1073643864 10:105279431-105279453 AAATGAAGAAAGAAGGAGGGAGG - Intergenic
1074213537 10:111361326-111361348 AAAGATAAAAAGAAAGAGTTTGG - Intergenic
1074667297 10:115742952-115742974 AAAGTTACAATGAAGGAGGAAGG + Intronic
1075189190 10:120290730-120290752 AAATGGCAAAAGAAAGAGGTGGG - Intergenic
1075362562 10:121852029-121852051 TAAGGTACATAGAAGCAGGTGGG - Intronic
1075490700 10:122866196-122866218 AAAAGGATAAAAAAGGAGGTCGG - Intronic
1075596506 10:123734117-123734139 AAAGGGAAAGAGATGGAGGAAGG - Intronic
1075885016 10:125892403-125892425 AAAGGTAATAAGGAGGATTTGGG - Intronic
1076558474 10:131345644-131345666 AAAAGGAAAAAGGAGGAGGCAGG + Intergenic
1076751084 10:132543575-132543597 AAAAGTAAAAAGAATTAGCTGGG - Intronic
1076778112 10:132709316-132709338 GAGGGGGAAAAGAAGGAGGTGGG + Intronic
1077204968 11:1337620-1337642 AACGTTAAAAAGAGGGAGGGTGG + Intergenic
1077782580 11:5347751-5347773 AAAGATGGAAGGAAGGAGGTAGG + Intronic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078295477 11:10064568-10064590 AAAGGTTAAAAGAAAAAGGAGGG + Intronic
1078314680 11:10284413-10284435 AAAGCTATAAAAAAGGAGGGTGG - Intronic
1078524582 11:12090731-12090753 AAAAGAAAAAAGAAGGAGCCAGG + Intergenic
1079160621 11:17989917-17989939 AAAAGTAAAAAGAAACAGGTGGG - Intronic
1079465006 11:20721783-20721805 AAGGGTAAAGAGAAGGACTTTGG + Intronic
1079959091 11:26900567-26900589 AAAGGAAAAAAGAGGGAATTTGG - Intergenic
1079973601 11:27065154-27065176 AAAGGCAAGATGGAGGAGGTGGG + Intronic
1080021290 11:27562866-27562888 AAAGGTAAAGAAGAGTAGGTGGG + Intergenic
1080529591 11:33161852-33161874 AAAAGTAAAAAGCAGGAGCTGGG - Intronic
1080613194 11:33923165-33923187 AAAAGTAAAAAGAAACAGGCAGG - Intergenic
1080971046 11:37277360-37277382 AAAGGGAAAAAGAAGGAAGGAGG - Intergenic
1081015613 11:37875938-37875960 AAAGTTAAAAACATGGAGCTGGG - Intergenic
1081019158 11:37921823-37921845 GAAGGTAAACAGAAAGAGGCAGG - Intergenic
1081424341 11:42908450-42908472 AAAGGAAAAAAGAAAAATGTTGG + Intergenic
1081612276 11:44569690-44569712 CAAGGTAAAAATAGGGAGGTAGG - Intronic
1081641636 11:44759642-44759664 AATGGTAGAAAGAAGGAACTAGG - Intronic
1081884578 11:46483902-46483924 AAAGGTAAAAAGAAGGAGGTAGG + Intronic
1082952057 11:58827866-58827888 ACAAGAAAAAAGAAGGAGGCCGG - Intergenic
1083028393 11:59570193-59570215 AAAAAAAAAAAAAAGGAGGTTGG - Intergenic
1083477022 11:62921403-62921425 AAAGGGAAAGAGAGGGAGGGAGG + Exonic
1084467118 11:69330550-69330572 GAAAGAAAAAAGAAGGAGGAGGG - Intronic
1084591494 11:70093224-70093246 AGAGTGAAAAAGAGGGAGGTGGG - Intronic
1084870921 11:72098128-72098150 AAAAGTTAAGAGAACGAGGTGGG + Intronic
1085089039 11:73693917-73693939 AAAGTTAAAAATAAGGATGGGGG - Intronic
1085099206 11:73786273-73786295 AAAGGGAAAAAGAAGGAAGAAGG - Intergenic
1085374902 11:76051555-76051577 ACAAGTAAAAAAAAGGAGGGGGG + Intronic
1085899192 11:80677475-80677497 AATGATAAAAAGAATAAGGTTGG + Intergenic
1086249883 11:84799807-84799829 AAAGTTAGAAAGCAGGAGGGTGG - Intronic
1086322617 11:85666044-85666066 AAAGGAAAAAAAAATGAGGATGG - Intronic
1086474104 11:87151914-87151936 AAAGGAAAAAAAACAGAGGTAGG - Intronic
1086814117 11:91347220-91347242 AGAGGTAATAAAAAGGTGGTAGG - Intergenic
1086853039 11:91833584-91833606 GAAGGAAAAAAGAAAGAGGCAGG + Intergenic
1087121689 11:94581628-94581650 AATGGTTTACAGAAGGAGGTGGG + Intronic
1087163816 11:94977636-94977658 AAAGATAAAAAGAAGAAAGAGGG - Intronic
1087594188 11:100233251-100233273 AAAAGGAAAAAGAGAGAGGTAGG + Intronic
1087728128 11:101746447-101746469 AAGGGTGAAAAGGAGGAGGGAGG - Intronic
1087820791 11:102709737-102709759 ACAGGCAGAAAGAAGGAGGAAGG + Intergenic
1087902208 11:103653743-103653765 AAAGGAAAAAAGCAGGGGGAAGG - Intergenic
1088056885 11:105593631-105593653 AAGGGTAAAAAAGGGGAGGTTGG - Intergenic
1088237300 11:107739611-107739633 AATGGTAAACAAAAGAAGGTAGG - Intergenic
1088250425 11:107857208-107857230 GAAGGAACAAAGAAGGAGGGAGG + Intronic
1089036205 11:115395336-115395358 AAAGGGAAAAGGAAAGAGTTGGG + Intronic
1089074759 11:115729098-115729120 CAAGGGAAAAGCAAGGAGGTGGG - Intergenic
1089126669 11:116181130-116181152 AGAGGCAAAAGGAAGGGGGTGGG + Intergenic
1089134657 11:116239426-116239448 TAAGTGAAGAAGAAGGAGGTGGG - Intergenic
1089331165 11:117689939-117689961 AAAGGGAAAGTCAAGGAGGTGGG + Intronic
1089372707 11:117972558-117972580 AAAGGAAAAAAAATGGAGGTGGG + Intergenic
1089826046 11:121278834-121278856 AAAGAGACAAAGAAGGAGGAAGG - Intergenic
1090021835 11:123135322-123135344 AAAGTTAAAAAAAAGGTGGGGGG + Intronic
1090461962 11:126899056-126899078 AAAGGTTAACAGAAGGTGGAAGG + Intronic
1090859023 11:130636620-130636642 AGAGGTAAAAAGAAAGACTTTGG - Intergenic
1090952262 11:131484050-131484072 AAAGGTAATGAGCAGGAGGAGGG + Intronic
1091807081 12:3364516-3364538 AAAGGTAAAAGCAAGATGGTGGG + Intergenic
1092212090 12:6652926-6652948 AAAGGCAAAAAGAGTGAGGAGGG - Exonic
1092560408 12:9607239-9607261 AAAGAAAAAGAGAAGGAGGAAGG - Intronic
1092576017 12:9783213-9783235 AAAGGCAAGAAGAAGGTGGTGGG + Intergenic
1092715772 12:11389171-11389193 ATAGGTAAAAATTAGCAGGTGGG + Intronic
1092953569 12:13529497-13529519 AAGAGTAAACAGAAGGAAGTGGG - Intergenic
1092966958 12:13653329-13653351 AAGGCTTAAAAGAAGGGGGTTGG + Intronic
1093039820 12:14365344-14365366 AAAGAAAGAAGGAAGGAGGTAGG - Intergenic
1093290478 12:17314463-17314485 GAAGGCACAAAGAATGAGGTTGG + Intergenic
1093318288 12:17678938-17678960 AAAAGAAAAGAGAAGGAGGGAGG + Intergenic
1093671159 12:21877705-21877727 AAAAGGAGAGAGAAGGAGGTGGG + Intronic
1093739194 12:22662059-22662081 AAAGGAAAAAAAAAGGGGGGGGG - Intronic
1093787814 12:23213147-23213169 AAAGTTTAAAAAAAGGAGGAAGG - Intergenic
1093867581 12:24247298-24247320 AAAGGAACACAGTAGGAGGTTGG + Intergenic
1094013730 12:25838588-25838610 AAAATAAAAAATAAGGAGGTTGG - Intergenic
1094016123 12:25866431-25866453 AAAGGTGGAAAGAAGAAGGCAGG + Intergenic
1094108837 12:26839628-26839650 AAAGCTAAAAGGAAAAAGGTGGG + Intergenic
1094280051 12:28726837-28726859 AAAGGTAAAAGAAAAGAGATTGG - Intergenic
1094440737 12:30473326-30473348 AAAATTGAAAAGAAGGAGGAAGG + Intergenic
1095131395 12:38547664-38547686 AAAGGTGAGAAGATGAAGGTAGG - Intergenic
1095232983 12:39764100-39764122 AATGGTAAAAAGATGTAGGCAGG - Intronic
1095827919 12:46549500-46549522 GAAGAAAAAAAAAAGGAGGTGGG + Intergenic
1095861658 12:46924273-46924295 CAAGGAAAAGGGAAGGAGGTAGG + Intergenic
1096068026 12:48756535-48756557 AAAAGAAAAAAGCAGGAGCTGGG + Intergenic
1096296799 12:50390984-50391006 AAAAACAAAAAAAAGGAGGTAGG - Intronic
1096366567 12:51033267-51033289 AAAAAAAAAAAGAAGGAGGAGGG - Intergenic
1096528655 12:52229826-52229848 AAAGGTGAAAGGAGGGTGGTGGG + Intergenic
1096732455 12:53625740-53625762 AAGGGTAATAGGAAGGAGGTAGG - Intronic
1096836841 12:54356609-54356631 AAAGGCAAGAAGCAGGAAGTTGG - Intergenic
1097182985 12:57181359-57181381 CAAGGTAAGAAGAGGAAGGTGGG - Intronic
1097253891 12:57657263-57657285 AAAGGTAAAAAGAAAAATCTTGG + Intergenic
1097547820 12:61026483-61026505 AAAAGTAAAAAAAAGAAGGAAGG - Intergenic
1097614346 12:61865427-61865449 AAAGGAAGAAAGATGGAGGAGGG + Intronic
1097852211 12:64423449-64423471 AAAGCAAAAAAAAAGGAGGGGGG - Intronic
1097950033 12:65417638-65417660 AAGGGTAAGAGGAAGGAGTTTGG - Intronic
1098187862 12:67916985-67917007 AAAGGAAAAAGGAAGGAAGCAGG - Intergenic
1098338563 12:69428237-69428259 AAAGATAAGAAGAAGTAGGGAGG + Intergenic
1098391387 12:69973190-69973212 AAAAATAAAAATAAGGAGATTGG - Intergenic
1098768556 12:74521928-74521950 AAAGGTCAAGAGAATGAAGTTGG + Intergenic
1098805413 12:75015954-75015976 AAAGGGAAAAAAAAGGAGGAGGG + Intergenic
1098894655 12:76043957-76043979 AAAGCCAAAAAGAAGGAACTAGG - Exonic
1098993310 12:77090256-77090278 AAAGAGAGAAAGAAGGAGGAAGG - Intergenic
1099221865 12:79924057-79924079 AAATTTAAAAAAAAGGAGATGGG + Intronic
1099228346 12:79994828-79994850 AAAGAAAAAAGGAAGGAGGTGGG + Intergenic
1099609420 12:84848596-84848618 AAAGGAAGAAAGATGGAGGGAGG + Intergenic
1099609426 12:84848640-84848662 AAAGGAAGAAAGAAAGAGGAAGG + Intergenic
1099711545 12:86232138-86232160 AAAGAAAAAAAAAAGGAGGGGGG + Intronic
1099860519 12:88220035-88220057 AAAGGTAAAGAGAGGCAAGTTGG + Intergenic
1100208850 12:92380466-92380488 AAAGTAAATAAGAAAGAGGTTGG + Intergenic
1100465186 12:94838078-94838100 AAAGGAAAAAAGAAGAAAGATGG + Intergenic
1100643443 12:96504884-96504906 AAAAGCAAAAAGCAGAAGGTAGG - Intronic
1100727465 12:97423857-97423879 AAAGTTAAAAACCAGGAGGCAGG - Intergenic
1100877267 12:98975297-98975319 AAAGGAAGAAGGAAGGAGGGAGG - Intronic
1101047124 12:100820057-100820079 AAAGGGAAATAGAGGGAGGGAGG - Intronic
1101107675 12:101455982-101456004 AAAGGACAAAAGAAGGTGGACGG + Intergenic
1101326773 12:103722724-103722746 AAAGGAAAAAAAAAGGAGTTTGG + Intronic
1101629470 12:106478989-106479011 AAAGGAATAAAGTAGGAGGGAGG - Intronic
1101666697 12:106823444-106823466 AAAGGTAAAAAGTAGAATTTTGG + Intronic
1101886660 12:108669776-108669798 TAAGGTATTAAGAAGCAGGTAGG + Intronic
1101935244 12:109051868-109051890 TAAAGTGAAAAGCAGGAGGTAGG - Intronic
1102052800 12:109875293-109875315 ACAGGCAAAAGGAGGGAGGTGGG + Intronic
1102718413 12:114995126-114995148 TAAGTTAAAAAGAAGGGGGAAGG - Intergenic
1102852965 12:116268168-116268190 AGAGGTACACAGAGGGAGGTAGG + Intronic
1103109647 12:118264568-118264590 GCAGGTAAAAAGGAGTAGGTAGG + Intronic
1103420886 12:120781536-120781558 AAACGTAACAATAAGGAGATGGG - Intronic
1103622237 12:122194621-122194643 AAAGGAAGAAAGAGGGAGGGAGG - Intronic
1103956796 12:124581960-124581982 AAGGGAAAGTAGAAGGAGGTAGG + Intergenic
1104232898 12:126902585-126902607 AAAGGGAAAGAGAAAGAGGGAGG - Intergenic
1104407707 12:128532340-128532362 AAAGAAAAAAAAAAGGAGGCCGG + Intronic
1104772843 12:131374981-131375003 AATGTTAAGAAGAATGAGGTTGG + Intergenic
1104804664 12:131577628-131577650 ATAAGAAAAAATAAGGAGGTGGG + Intergenic
1105233933 13:18527864-18527886 ATAGGAACAAAGAAGGAGTTAGG + Intergenic
1105429445 13:20324001-20324023 AAAGAGAGAAAGAAGGAGGGAGG - Intergenic
1105490962 13:20887872-20887894 AAAAGAAAAAAAAAAGAGGTCGG + Intronic
1105628544 13:22137666-22137688 AAAGGTAGAATGAAGTAGTTAGG - Intergenic
1105870230 13:24498017-24498039 ACAGGTAAGAAGAAAAAGGTTGG + Intronic
1106216483 13:27706448-27706470 AAATGAAAAAAGAGGGAGGCAGG - Intergenic
1106224948 13:27778232-27778254 AGTGGGAAAAAGAAGGTGGTGGG + Intergenic
1106726639 13:32493219-32493241 AAAGGAAAAAAGAAAGAGACTGG - Intronic
1107215737 13:37916520-37916542 AAAGACAAAAGGAAGGAGATTGG - Intergenic
1107333094 13:39322747-39322769 AAAGGAAGAGAGAAGGAGGAAGG + Intergenic
1107411863 13:40165367-40165389 AAAAGGAAAAATGAGGAGGTGGG - Intergenic
1108033283 13:46259301-46259323 AAAGGGAGAAAAAGGGAGGTGGG + Intronic
1108195940 13:47994795-47994817 ACAAGTAATAAGAAGCAGGTAGG - Intronic
1108317393 13:49250014-49250036 AGAGGTAAAATGAGGGGGGTGGG + Intronic
1108405473 13:50096522-50096544 AAAGGTAAGAAGAAGAAGAAAGG - Intronic
1108723693 13:53158793-53158815 AAAGGAAAGAAGAAGAAGGAAGG - Intergenic
1108781880 13:53846644-53846666 AAAGGTAAAGAAAAGCAGCTGGG + Intergenic
1109297819 13:60556145-60556167 ATAGGTTAAAAGAAATAGGTTGG - Intronic
1109611226 13:64767109-64767131 AAAGGGACAAAGAAAGAGGGAGG + Intergenic
1109873995 13:68374120-68374142 AAAGGAAAAGAGAGGGAGGTAGG + Intergenic
1109939278 13:69339093-69339115 AAAGGAAAAAAGAAGTACATAGG - Intergenic
1110612102 13:77500389-77500411 GAAGGGAAAAATAAGTAGGTAGG - Intergenic
1110700560 13:78542842-78542864 AAAGGGAAAAAGAAGGAAAAAGG + Intergenic
1111374170 13:87355742-87355764 GAAGGGAAAAAGAAGTATGTTGG - Intergenic
1111579883 13:90209057-90209079 ATAGGTAAAAAGTAAGATGTTGG - Intergenic
1111612339 13:90620367-90620389 AAAGCTAGTAGGAAGGAGGTTGG + Intergenic
1111652900 13:91115227-91115249 AAAAGTAAAAAGAGGCAGATGGG + Intergenic
1111717138 13:91893761-91893783 AAAATGAAAAAAAAGGAGGTAGG - Intronic
1112110157 13:96287764-96287786 AAGAATAAAAAGAAGGAGATGGG - Intronic
1112575358 13:100630705-100630727 AAAGGAAAACAGCAGGAGCTTGG - Intronic
1112588461 13:100741202-100741224 ATGGGCAAAAAAAAGGAGGTTGG - Intergenic
1112630895 13:101160299-101160321 AAAGCGAAAAAGAAGGAAGAGGG - Intronic
1112739697 13:102459049-102459071 AAATGTACAGAGAAAGAGGTTGG + Intergenic
1113056922 13:106278202-106278224 ATAGGGAAAAAAAAGGGGGTGGG + Intergenic
1113187747 13:107708687-107708709 AAAGGTATAAAGTAGTTGGTTGG - Intronic
1113490241 13:110686015-110686037 AAAGAAAAAAAGAAAGAGGAGGG + Intronic
1114337616 14:21708340-21708362 AAAGAAAGAAAGAAGGAGGATGG - Intergenic
1114370415 14:22081118-22081140 GAAGGTAAAAAGAATGAGAGGGG - Intergenic
1114464351 14:22910477-22910499 AAAGGAAAAAAGAAAGCGGTGGG + Intronic
1114549079 14:23522946-23522968 AAAGGTGAAAGGAAGGATGAAGG + Intronic
1115602216 14:34966436-34966458 AAAGTAAAACAGAAGCAGGTAGG + Intergenic
1115872516 14:37821052-37821074 AAAGGAAAAAAGAAAGAAGAAGG - Intronic
1116116053 14:40652418-40652440 AAAGGAAAAAGGAAGGAGGAAGG - Intergenic
1116192377 14:41677105-41677127 AAAAGTAAAAACAAGGAGAAAGG + Intronic
1116434352 14:44879594-44879616 AAAGTTAAAAAGCAGGGGGAGGG + Intergenic
1116647329 14:47545691-47545713 AAAGGAAAAAAGAAGCTGCTTGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1116992697 14:51292581-51292603 AAAGAAAAAAAGAAAGGGGTTGG - Intergenic
1117406334 14:55407789-55407811 ATAGGGGAAAAGATGGAGGTGGG + Intronic
1117482844 14:56166276-56166298 AAAGTTAAAAAGCAGGTGGAGGG - Intronic
1117794320 14:59376623-59376645 AAAGGTAAAACTAGGGAGGCAGG + Intergenic
1117907300 14:60603663-60603685 AAAGATAAAAAGCAGGAGAAAGG + Intergenic
1118113091 14:62744958-62744980 GAAGGGAGAAAGAAGGAAGTTGG + Intronic
1118179152 14:63473884-63473906 AAAGGTAAAGAGAAGGAACCTGG + Intronic
1118343776 14:64918525-64918547 AAGGGTAATAAGAAGATGGTGGG + Intronic
1118533909 14:66737229-66737251 AAGGGGAAAAAGAAAGAGGAAGG - Intronic
1118615250 14:67570718-67570740 AAAAATAAAAAGGAGGAGGTAGG - Intronic
1118866798 14:69710778-69710800 AAAGTCATAAAAAAGGAGGTAGG + Intronic
1118941191 14:70339887-70339909 TGAGGTTAAAAGAAGGAGGATGG - Intronic
1118942922 14:70355099-70355121 ATAGGAACAAAGAAAGAGGTTGG - Intronic
1119111872 14:71982306-71982328 AAAAATAAACAGAAGGAGGGAGG - Intronic
1119224926 14:72937763-72937785 AAGGGTAACAGGAAGGAAGTGGG + Intronic
1119456478 14:74760353-74760375 AAAGGAAAAGGGAAGGAGGGAGG - Intergenic
1119571212 14:75674818-75674840 AAAAGTAAAAGGAAACAGGTAGG + Intronic
1119747906 14:77057466-77057488 AGAGTTAAAAAGAATGAGGCTGG - Intergenic
1119847289 14:77839940-77839962 AAAGGAAAAAAGAAGTAGGGAGG + Intronic
1120122971 14:80704784-80704806 AAAGGTAGAAAGAAAGAAGAAGG - Intronic
1120808419 14:88777673-88777695 AAAGTTAAAAAGCAGGAGGATGG + Intronic
1121077029 14:91077405-91077427 AAAGAAAGAAAGAAGGAGGGAGG + Intronic
1121152934 14:91654070-91654092 AAAGGGATAAAGAAGGAGGTGGG + Intronic
1121295094 14:92814119-92814141 AAAGGTAATTAGAAGTAAGTTGG + Intronic
1121743002 14:96267157-96267179 AGAGGGAAGAAGAAGGAGGTTGG + Intronic
1121966193 14:98308174-98308196 GGAGGTAAAAAAAAGGAGGAGGG + Intergenic
1122065441 14:99170253-99170275 AAAGTTAAAAAAAAGGGGGGAGG - Exonic
1122487881 14:102093970-102093992 AAAAGAAAAAAGAAGGAAGGTGG + Intronic
1122566985 14:102666134-102666156 AAAGATAAAGAGAAGGAAGTGGG + Intronic
1123061318 14:105595917-105595939 AAAAGTGAAAGGAAGGAGGAGGG - Intergenic
1123085772 14:105716828-105716850 AAAAGTGAAAGGAAGGAGGAGGG - Intergenic
1202831018 14_GL000009v2_random:30467-30489 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1202873023 14_GL000225v1_random:181551-181573 AAAGGTAATAAGGAGGATTTGGG + Intergenic
1202876452 14_KI270722v1_random:6743-6765 ATAAAAAAAAAGAAGGAGGTTGG - Intergenic
1123392900 15:19895243-19895265 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1123632329 15:22270266-22270288 AAAGTTAAAAATAAGAAAGTAGG - Intergenic
1123701352 15:22916886-22916908 AAAGGTTAAAAGGGGTAGGTAGG + Intronic
1124035891 15:26053357-26053379 AAAAGGAAAAAGAAAGAGGGAGG + Intergenic
1124534071 15:30529389-30529411 AAGGCTAAAAAGAAGGAAGAGGG - Intergenic
1124601344 15:31135000-31135022 AAAGGAAAAAAAAAAGAGATTGG + Intronic
1124642441 15:31404271-31404293 AAGGGTAGAAGGGAGGAGGTTGG + Intronic
1124764576 15:32478221-32478243 AAGGCTAAAAAGAAGGAAGAGGG + Intergenic
1125402385 15:39318010-39318032 AAAGGTAAGGAGGAGGAGGAGGG - Intergenic
1125581590 15:40789467-40789489 AAGGTTAAAAGGGAGGAGGTGGG - Intronic
1125583060 15:40801009-40801031 AAATGTAAAATGAAGGAGTAGGG - Intronic
1126219941 15:46201365-46201387 AAAGGCAAAAACAAGTAAGTGGG - Intergenic
1126309306 15:47297876-47297898 AAATGAGAAAAGAAGGAGGTTGG + Intronic
1126376456 15:48001722-48001744 ACATGCAGAAAGAAGGAGGTGGG + Intergenic
1126567070 15:50112185-50112207 AAAGGGAAAAGGAAGGAGCCAGG + Intronic
1126583292 15:50260315-50260337 AAAACAAAAAAGAAGGAGGCCGG - Intronic
1126623342 15:50662338-50662360 AAAGGTAAAAAGAATAATTTTGG + Intronic
1126876736 15:53050946-53050968 AAAGGTACAAAGAAGCATGAAGG + Intergenic
1126980742 15:54239748-54239770 ACAGATAAGAATAAGGAGGTGGG - Intronic
1127016217 15:54691428-54691450 AAAGTTAAAAAAAAAAAGGTGGG + Intergenic
1127017671 15:54707454-54707476 AAAAGTAAAAGGAAAGAGGGCGG - Intergenic
1127141405 15:55981359-55981381 AAAAGAAAAAAAAAGGAGGCCGG - Intronic
1127223211 15:56902106-56902128 GAAGGAATAAAGAAGGAGGGAGG + Intronic
1127446653 15:59070018-59070040 AAAAAAAAAAAGCAGGAGGTGGG - Intronic
1127478893 15:59360112-59360134 AAATGTAAAAATAAGTAAGTTGG - Intronic
1127631067 15:60828106-60828128 AAAGGTATAAGGCAGGAGGCGGG + Intronic
1127633547 15:60848373-60848395 TAAGGGAAAAAGAGGGAGGAAGG + Intronic
1127684010 15:61324064-61324086 AAAGGGAAAAAGATGCAGGAAGG - Intergenic
1127728227 15:61772084-61772106 AAAGGAAAAAAAAAGGTGGCAGG + Intergenic
1128043493 15:64596146-64596168 AAAGAAAAAAAGAAAGAGCTTGG - Intronic
1128302154 15:66572882-66572904 AAAAGTAAAAAAAAAGAGGCTGG + Intergenic
1128435780 15:67646106-67646128 AGTGGTAAGAAGAAGGAGGTGGG + Intronic
1128458809 15:67850636-67850658 AAAGGAAGACAGAAGCAGGTGGG + Intergenic
1128754108 15:70169862-70169884 AAAGGGAAAAGGAAGGGGTTGGG - Intergenic
1129638433 15:77348512-77348534 ATAGGTAAAATAAAGGAGTTTGG - Intronic
1130241135 15:82192852-82192874 AAAGAAAGAAAGAAAGAGGTAGG + Intronic
1130410603 15:83645145-83645167 AAAGGTAAGTAGACAGAGGTAGG - Intergenic
1130557250 15:84931248-84931270 AAAAATAAAAAGGAGGAGGGAGG - Intronic
1130942067 15:88519099-88519121 AAAGGTAAAATGATGGGGGCTGG + Intronic
1131029835 15:89177324-89177346 CACTGTAAAATGAAGGAGGTGGG + Intronic
1131036419 15:89225335-89225357 AAAAGTAAAAAGAAACAGGTGGG - Intergenic
1131161985 15:90111709-90111731 AAAAAAAAAAAGAATGAGGTAGG + Intergenic
1131430554 15:92384949-92384971 AAAGGGAAAGAGAAGGACATCGG + Intergenic
1131531581 15:93197608-93197630 AAAAGGAAAAAGAAGGAAGATGG - Intergenic
1131673765 15:94650010-94650032 AAAAGGAAAAAGAAAGATGTAGG - Intergenic
1131837752 15:96408184-96408206 ATAAGAATAAAGAAGGAGGTGGG - Intergenic
1132282661 15:100633639-100633661 AAAGGAAGAAGGAAGGAGGAAGG + Intronic
1132839790 16:1973451-1973473 ATAAGTAAAAAGAGGTAGGTAGG + Intronic
1132888301 16:2192136-2192158 AAAGGAAAAAAAAAGTAGCTGGG + Intronic
1133536709 16:6709519-6709541 AAAAGTAGAAAGAAGTATGTAGG - Intronic
1133577595 16:7108883-7108905 ATCTGTGAAAAGAAGGAGGTTGG + Intronic
1134345081 16:13383154-13383176 AAAAGTAGAAAGAAGGTGGTGGG + Intergenic
1134383996 16:13755037-13755059 AAAGTTAAAAAGAAATAGCTGGG - Intergenic
1134392261 16:13830837-13830859 AAAAAAAAAAAGAAGGAGGTTGG - Intergenic
1134861409 16:17563766-17563788 AAAGGGAGAAAGATGGAGGCTGG + Intergenic
1135140233 16:19915030-19915052 AGAAATAAAAAGAAGGAGGTTGG - Intergenic
1135170434 16:20178908-20178930 AAAGACAAGAAGAAGGAGGAGGG - Intergenic
1135333001 16:21576576-21576598 AAAAGTAAAAAGACTTAGGTTGG + Intergenic
1135938795 16:26803250-26803272 AAAGGAGGAAAGAAGGAGGGAGG + Intergenic
1135973473 16:27089324-27089346 AAGGGTAGAGAGAAGAAGGTAGG + Intergenic
1136315166 16:29450141-29450163 AAAGATAAAAATAACGAGGGAGG + Intronic
1136397532 16:30001329-30001351 AAATGCAAACAGAAGGAGGATGG - Intronic
1136401283 16:30020544-30020566 AAAGAAAAAAAGAAGTAGGCTGG + Intronic
1136429743 16:30189480-30189502 AAAGATAAAAATAACGAGGGAGG + Intergenic
1136495627 16:30641868-30641890 AAAGAAAAAAAAAAGGAGGGAGG - Intergenic
1136519903 16:30788527-30788549 AAAAAAAAAAAGAAGGAGGGAGG + Intergenic
1136574397 16:31114912-31114934 AAAAGAAAAAAGAGGGAGGAAGG - Intergenic
1136799203 16:33055254-33055276 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1136901689 16:34046479-34046501 AAAAGTAAAAAGGAAGAGGAGGG - Intergenic
1136935377 16:34458446-34458468 ATAGGAACAAAGAAGGAGTTAGG - Intergenic
1136938212 16:34496073-34496095 ATAGGAACAAAGAAGGAGTTAGG - Intergenic
1136946315 16:34655497-34655519 ATAGGAACAAAGAAGGAGTTGGG + Intergenic
1136956881 16:34798203-34798225 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1136961606 16:34852484-34852506 ATAGGAACAAAGAAGGAGTTAGG + Intergenic
1136964441 16:34890124-34890146 ATAGGAACAAAGAAGGAGTTAGG + Intergenic
1136968588 16:34944818-34944840 ATAGGAACAAAGAAGGAGTTAGG + Intergenic
1137093133 16:36219519-36219541 AAAGGTTAAAAAAAAAAGGTGGG - Intergenic
1137093583 16:36224590-36224612 ATAGGAACAAAGAAGGAGTTAGG + Intergenic
1137218452 16:46423987-46424009 ATAGGAAAAAAGAAGGAGTTGGG - Intergenic
1137289978 16:47045828-47045850 AAAGAGAGAAAGAAAGAGGTAGG - Intergenic
1137727159 16:50664858-50664880 AAAGGAAAATGGAAGGAGGCTGG - Intergenic
1137771387 16:51018319-51018341 GAGGGTAAAATGAAGGAGCTTGG + Intergenic
1137820392 16:51439129-51439151 AAAAGAAAAAAGAGGGAGGAAGG + Intergenic
1137822408 16:51458728-51458750 AAAGACAAAAAAAAGGAGGGGGG + Intergenic
1138562693 16:57811387-57811409 AAAGGAAGAAGGAAGGAGGGAGG + Intronic
1138621174 16:58212568-58212590 AAAGGAAAGAATAAGGAGGAAGG + Intergenic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1139131444 16:64151262-64151284 TAAAGTAAAATAAAGGAGGTGGG - Intergenic
1139633388 16:68244212-68244234 AAAAGAAAAAAGAAAGAGGGAGG + Intergenic
1139918823 16:70445949-70445971 AAAAAAAAAAAGAAGGAGGAAGG - Intergenic
1140582243 16:76245203-76245225 AAAGAAAAACAGAAGGAAGTGGG + Intergenic
1140970427 16:80007238-80007260 AAAGGTAGAGAGAAGGATGGTGG - Intergenic
1141113363 16:81288421-81288443 AAAAATAAAAAGAATGAGCTAGG - Intronic
1141384602 16:83608310-83608332 AAAGGTAAATGGTAGGAGTTAGG + Intronic
1141490550 16:84369394-84369416 GAAGCTAAAAAGAAGGGTGTTGG - Intronic
1141876861 16:86831120-86831142 AAAAAAAAAAAAAAGGAGGTTGG + Intergenic
1141970645 16:87480100-87480122 AAAGTTAAAAATAAGAAAGTAGG + Intronic
1143171510 17:4933233-4933255 AAAAGCAAAAGGCAGGAGGTGGG - Exonic
1143294838 17:5863208-5863230 AAAGGAAAAAGGAAGGAGGAAGG - Intronic
1143913487 17:10271718-10271740 AAAGGTAAAAAGATGCAGGCTGG + Intergenic
1143960256 17:10711415-10711437 AAAGTTAAAAAAAATCAGGTAGG - Intronic
1143980356 17:10863867-10863889 AAGGGGAAAAAGAAAGAGGAAGG - Intergenic
1144017846 17:11213562-11213584 AAATATAAAATGAAGGAAGTGGG + Intergenic
1144114803 17:12077622-12077644 CCAGGCAACAAGAAGGAGGTTGG + Intronic
1144237770 17:13278664-13278686 AGAGGTAAAATGATGGAGGCAGG + Intergenic
1144300070 17:13915169-13915191 AAAGGAAGGAAGAAGGAGGGAGG + Intergenic
1144419238 17:15080866-15080888 AAAGGTAAAAAGGAGGGGTTAGG + Intergenic
1144473614 17:15565354-15565376 ATAAGAAAACAGAAGGAGGTTGG - Intergenic
1144733500 17:17541960-17541982 AAAAGAAAAAAGAGGAAGGTGGG - Intronic
1144741414 17:17584608-17584630 AAAGGTAAAGAAAAGGAAGATGG - Intronic
1144922907 17:18779457-18779479 ATAAGAAAACAGAAGGAGGTTGG + Intergenic
1145079071 17:19879673-19879695 AAGGGGGAAAAGAGGGAGGTGGG - Intergenic
1146522092 17:33533445-33533467 AAAGGCAAGAAGAAAAAGGTAGG - Intronic
1146703595 17:34982944-34982966 AAAGATATAAACAAGGAGATAGG - Intronic
1146722921 17:35135923-35135945 AAAGTAAAAAAGAAGCATGTTGG + Intronic
1147610217 17:41797599-41797621 AAAGGAAGAAAGGAGGAGGAAGG - Intergenic
1147681931 17:42254795-42254817 AATGGAAAAAAAAAGAAGGTCGG + Intronic
1147725575 17:42564408-42564430 AAGGGTAAAAAGAGGGAAGGAGG - Intronic
1147873230 17:43602752-43602774 GAAGGGAAAAAGCTGGAGGTGGG - Intergenic
1148228190 17:45914044-45914066 AAAGGATAAAAAAAGGAGGAGGG + Intronic
1148257453 17:46148003-46148025 AATGGTAAAACAGAGGAGGTAGG + Intronic
1148545756 17:48517705-48517727 AAGGATAAAAAGAGGGAAGTGGG + Intergenic
1148844396 17:50520565-50520587 AAAGGAAAAAAGAAACAGGTGGG - Intronic
1149215335 17:54347418-54347440 GGAGGTAGAATGAAGGAGGTAGG + Intergenic
1149695015 17:58609948-58609970 AAGGGTAAGAGGAAGTAGGTGGG + Intronic
1149742073 17:59056198-59056220 AAAGAAAAAAAAAAGGGGGTGGG - Intronic
1149826385 17:59832405-59832427 AAACAAAAAAAGAAGTAGGTTGG - Intronic
1149923398 17:60679279-60679301 AAGGGAAAAAAGGAGGAAGTAGG - Intronic
1150250746 17:63703204-63703226 AAAGTTAAATAGAATGAGGCTGG + Exonic
1150502061 17:65660418-65660440 AAAGAAAGAAAGAAGGAGGGAGG - Intronic
1150739814 17:67770176-67770198 AAAAATAAAAAGGAGGAGGCCGG - Intergenic
1150772043 17:68050445-68050467 AAAGGAAGAAAGAAAGAGGAAGG - Intergenic
1151170448 17:72241403-72241425 AAGGGTAAAAAGTAGGAGTTAGG + Intergenic
1151292438 17:73160275-73160297 AAAAAAAAAAAAAAGGAGGTTGG - Intergenic
1151737448 17:75953199-75953221 AAAGTTAAAAATAATAAGGTGGG + Intronic
1151763342 17:76119810-76119832 GAAGGCAAAGTGAAGGAGGTCGG + Intronic
1151909417 17:77072038-77072060 AAAAGAAAAAAGAAGGAGAAGGG - Intergenic
1151920093 17:77148168-77148190 AAAGGGAAAATGAAGGAGGCGGG + Intronic
1151938268 17:77277279-77277301 AAAAGAAAAAAGAAAGAGGCCGG - Intergenic
1152922263 17:83071953-83071975 AAAGAAAAAAGGAAGGAGGAAGG - Intergenic
1203184148 17_KI270729v1_random:96140-96162 ATAGGAACAAAGAAGGAGTTAGG + Intergenic
1153813866 18:8776261-8776283 AAAGCTAGAAGGAAGCAGGTGGG - Intronic
1153868965 18:9298729-9298751 ACTGCTAACAAGAAGGAGGTTGG - Intergenic
1153883967 18:9446688-9446710 AAAGGAAAAGAGAGGGAGGGAGG - Intergenic
1154139316 18:11809266-11809288 AAAGGAAGAAAGCAGGAGGCTGG + Intronic
1154515608 18:15162011-15162033 ATAGGAAAAAAGAAGGAGTTAGG - Intergenic
1154515815 18:15164471-15164493 AAAAGGAAAAGGAAGGAAGTAGG - Intergenic
1155259564 18:24028140-24028162 AGGGGAAAAAAAAAGGAGGTGGG + Intronic
1155550510 18:26960029-26960051 AAAGGTAAAAATAAGGAAATAGG + Intronic
1155582539 18:27325495-27325517 AAAGGAAGAAAGAAAGAGGGTGG + Intergenic
1155692588 18:28644084-28644106 AAAGGAAGAAAGAAGAAGGAAGG + Intergenic
1155726495 18:29091831-29091853 ACAAGTAAAAAGAAGTAAGTTGG + Intergenic
1155799616 18:30084306-30084328 TTAGGTAAAAAGAAGGGAGTGGG - Intergenic
1155887783 18:31228871-31228893 AAAAAAAAAAAGAAGGAGGAAGG + Intergenic
1156091970 18:33482429-33482451 AGAGGAAAAAAAAAAGAGGTGGG - Intergenic
1156437429 18:37147616-37147638 AAATGTACAAAGAAGGAGTTTGG - Intronic
1156621542 18:38857497-38857519 AAAGGTGGAAAGAAGAAGATAGG + Intergenic
1156675882 18:39526723-39526745 AAAGGAAAAAAACTGGAGGTGGG + Intergenic
1156687219 18:39664713-39664735 AGAAGTAAAAAGGAGGATGTAGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156939617 18:42750920-42750942 AATTCTAATAAGAAGGAGGTAGG + Intronic
1156964114 18:43069546-43069568 AAGGACAAAAACAAGGAGGTTGG - Intronic
1157208823 18:45723496-45723518 AAATTTAAAAAGAAGGGGGAAGG + Intergenic
1157425520 18:47581015-47581037 AGAAATAAAAAGAAGGGGGTGGG + Intergenic
1157666959 18:49495361-49495383 AAAGGTAAAAAGGATCAGGTTGG - Intergenic
1157687431 18:49653639-49653661 AAAGGAAAAAACAAGAAGGAAGG + Intergenic
1158275297 18:55760519-55760541 AATGGAAAGAAGAAGGAGGAGGG - Intergenic
1158327793 18:56329195-56329217 AAAGGGAGATAGAAGGAGGTGGG - Intergenic
1158678704 18:59547080-59547102 AAAGGGAGAGAGAGGGAGGTAGG + Intronic
1158762290 18:60404156-60404178 AAAGGTAAAAACAAAAATGTTGG - Intergenic
1159064798 18:63557884-63557906 AAAAGTAAAAAGAAACAGGTGGG + Intronic
1160228854 18:77031458-77031480 AAAGCTAAGAAAAAGGAGGCAGG + Intronic
1160402487 18:78621089-78621111 AAAAGTAAAAAAAAAGAGGCAGG - Intergenic
1160700337 19:503597-503619 AAAAGTAAAAATAATGTGGTCGG + Intronic
1161195145 19:2982544-2982566 AAAAAAAAAAAAAAGGAGGTGGG + Intronic
1161451756 19:4350255-4350277 TAAGGGAGAGAGAAGGAGGTGGG + Intronic
1161527100 19:4763105-4763127 AAAGGGAAGAAGACAGAGGTTGG - Intergenic
1162014327 19:7836240-7836262 AAAGAAAAAAAGAAGGAAATGGG + Intronic
1162188541 19:8926618-8926640 AAAAAAAAAAAGACGGAGGTCGG - Intronic
1162215046 19:9127223-9127245 AAAGAGAAAAAGAAAGAGGAGGG - Intergenic
1162545738 19:11328343-11328365 AAAAAAAAAAAGAAGAAGGTTGG + Intronic
1162604165 19:11694419-11694441 AAAGGAATAAAGAAGGAACTGGG + Intergenic
1162730547 19:12715861-12715883 AAAGAAAAAAAAAAGGAGGGGGG - Intronic
1163005310 19:14393688-14393710 AGAGGGATAAAGAGGGAGGTGGG + Intronic
1163176474 19:15567088-15567110 AAAGGAAGAAAGAAAGAGGAAGG - Intergenic
1163200933 19:15768583-15768605 AAAGGGAGAAAGAAGGAAGAGGG - Intergenic
1163760805 19:19135436-19135458 AAAGGGAAGAAGAGGGAGGAGGG - Intronic
1164092144 19:21966258-21966280 AATTCTAAAAAGAAGGAGGAAGG - Intronic
1164498891 19:28795095-28795117 AAAGGAAAAAAAAGGAAGGTAGG - Intergenic
1164573473 19:29390966-29390988 AAAGGAAGAAAGAGGGAGGGAGG + Intergenic
1164680427 19:30130827-30130849 AAAGGGAGAAGGAAGGAGGAGGG - Intergenic
1164694950 19:30236443-30236465 AAAGCCAAAAAGAAGGAAATGGG - Intronic
1164938584 19:32233559-32233581 AAAGGAAAAAAGAAGGGGTGAGG + Intergenic
1165527050 19:36364949-36364971 AAAGAAAGAAAGAAGGAGGAAGG - Intronic
1165586251 19:36918371-36918393 TAATGTATAAAGAAGGATGTAGG - Intronic
1165730465 19:38141586-38141608 AAAGCTGAAACGAAGGAGGGAGG - Intronic
1166611129 19:44198243-44198265 AAAAGAAAATAGAAAGAGGTGGG - Intergenic
1166675525 19:44738500-44738522 AAAGGAAAAAAAAATGGGGTGGG - Intergenic
1166845759 19:45727260-45727282 AAAGAAAAAAAAAAAGAGGTCGG + Intronic
1167028606 19:46941043-46941065 AGAGGGAAAAAAAAGGAGGGTGG - Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167136472 19:47619226-47619248 AAAGGAAAAAAAAAAGGGGTTGG - Intronic
1167393621 19:49212656-49212678 AAAGGAAGGAAGAAGGAGGGAGG - Intergenic
1167429123 19:49444154-49444176 AAAAGAAAAAGGAAGGAGGAAGG - Intergenic
1168091643 19:54089411-54089433 AAAGAGAAAAGGAAGGAGGGAGG + Intergenic
1168304469 19:55427995-55428017 AAAGGTAAAAAGGAGGTGGCAGG - Intergenic
1168578762 19:57535767-57535789 TAAGGGAAAAACAGGGAGGTGGG - Intronic
1202641677 1_KI270706v1_random:97306-97328 AATAGTAAAAAGAATGAGGTAGG - Intergenic
925507696 2:4586744-4586766 AAAGGAGAAAGGAAGGAGGAAGG - Intergenic
925580908 2:5409591-5409613 TAAGGTCAAAAGGAGCAGGTTGG - Intergenic
925749494 2:7074821-7074843 AAGGGAAGAAAGAAGGAGGGGGG + Intergenic
925910245 2:8569251-8569273 AAAGGGAAAGAGAAGGAGGGAGG + Intergenic
926517861 2:13871858-13871880 AAGGGTCAAAAGAAGGATTTTGG + Intergenic
927056793 2:19372992-19373014 AAGGGGAAGAAGAAGGTGGTTGG - Intergenic
927162980 2:20286988-20287010 AAAGGAAAAAAAAACGACGTAGG + Intronic
927313190 2:21653134-21653156 AAAAAAAAAAAGAGGGAGGTGGG + Intergenic
927342375 2:21996870-21996892 AAAAAAAAAAAAAAGGAGGTGGG + Intergenic
928517342 2:32056103-32056125 AAGGACAAAAAGAAGGAGCTAGG - Intergenic
929037678 2:37710342-37710364 AAAAGTAAAAACAATGAGGGAGG + Intronic
929394443 2:41506833-41506855 AGAGATAAAAAGAAGGAAGAGGG + Intergenic
929943015 2:46349165-46349187 AAAGGTCAACAGAAGCAGCTGGG + Intronic
930001787 2:46866593-46866615 AAAGATAAGAAGCTGGAGGTTGG + Intergenic
930175042 2:48292966-48292988 AGGGGCAAAAAGAAGGAGGCTGG + Intergenic
930208183 2:48609138-48609160 TAAGACAAAAAGAAGGAGGCAGG - Intronic
930502814 2:52244190-52244212 AAAGGAACAAAGTAAGAGGTGGG + Intergenic
930686071 2:54309487-54309509 AAACTTAAAAAGAAGTAGGCTGG - Intergenic
930793069 2:55355443-55355465 AATGAGAAAAATAAGGAGGTTGG - Intronic
931975414 2:67638654-67638676 AAAGCTAAAAACAAGGAGGAAGG - Intergenic
932168282 2:69528650-69528672 GAGGGTAAAAAGAAGGAAGGAGG + Intronic
932531537 2:72539196-72539218 AAAGGAAAAAAGAAGGGGGAGGG + Intronic
932790830 2:74653478-74653500 AAAAAAAAAAAGAAGGAGCTAGG + Intergenic
932822585 2:74914220-74914242 AAAAGGAAAAAAAAGGAGGAAGG + Intergenic
932934750 2:76089437-76089459 AAAGGTGAAAAGAATGAGTCAGG - Intergenic
933367014 2:81365657-81365679 AGAGTAAAAAAGAAAGAGGTGGG + Intergenic
933576276 2:84072119-84072141 AAGGAAAAAAAGAGGGAGGTAGG + Intergenic
933740853 2:85532800-85532822 AAAGATAAAGAGAGGGAGGGAGG - Intergenic
934189312 2:89771658-89771680 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934303943 2:91805369-91805391 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
934329311 2:92047381-92047403 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934467530 2:94277302-94277324 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
934859457 2:97751802-97751824 AAAGGGAGGAAGAGGGAGGTGGG + Intergenic
935263436 2:101374817-101374839 ATAGTTAAAAAGATGGAGGCTGG + Intronic
935267300 2:101405832-101405854 AAAGGTTAAAAGAAGACGGCTGG + Intronic
935607870 2:104988665-104988687 AAAGGTAAAAAAAATTAGTTGGG + Intergenic
935829082 2:106980724-106980746 AAAGGTAAAAGAAAAGAGTTTGG - Intergenic
936527130 2:113248969-113248991 AAAAGAAAAAAAAGGGAGGTGGG + Intronic
936527977 2:113255083-113255105 GAAGGAAAAAAGAAGGAAGGAGG + Intronic
936664521 2:114578959-114578981 AAAGGTCAAAAAAAGGAGGCTGG - Intronic
936704803 2:115059178-115059200 AAAGATAAAAAGAAAGAAGAGGG + Intronic
936740947 2:115507895-115507917 GAAGGTAAAAAGTAGGTGGGTGG + Intronic
936816888 2:116471058-116471080 AGAGGTTAAAAGAAGGATGATGG + Intergenic
937072254 2:119073273-119073295 AAAGGTGGGAGGAAGGAGGTGGG + Intergenic
937169581 2:119852189-119852211 AGCGGAAAAAAGAAGGAGGTAGG - Intronic
937194234 2:120136073-120136095 AAAGTTAAAAAGCTGGGGGTGGG + Intronic
937781135 2:125838545-125838567 AAATGTAAAAGAAAGGTGGTGGG - Intergenic
937897799 2:126991566-126991588 AAAGGTGGAAAGAAGAAGGCAGG - Intergenic
937948886 2:127368324-127368346 AAAAATAAAAATAAGGCGGTCGG + Intronic
938042754 2:128089929-128089951 AAATGTAAAAAAAGGAAGGTTGG + Intergenic
938515871 2:132006800-132006822 ATAGGAACAAAGAAGGAGTTAGG - Intergenic
938518670 2:132042410-132042432 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
938609283 2:132930466-132930488 AAAGGTAAAAAGGTGGAAGAAGG + Intronic
938670384 2:133580976-133580998 AAGGGAAAGAGGAAGGAGGTTGG - Intergenic
939015117 2:136893682-136893704 TAAGGTACACAGAAGAAGGTGGG - Intronic
939101499 2:137899571-137899593 AAAGTTACAAAGAATGAAGTAGG + Intergenic
939191358 2:138920256-138920278 AAAAGAAAAAGGAAGGAGGCTGG - Intergenic
939201385 2:139039729-139039751 TTAGGTAAGAAGAAGGAGATAGG + Intergenic
939575835 2:143893549-143893571 AAAGATAAGAAGAAAGAAGTAGG + Intergenic
939603719 2:144226342-144226364 AAAGGTAAAAATAATGAGGGAGG + Intronic
939603882 2:144228556-144228578 AAAGGAGAAAAGAAGGAGAATGG + Intronic
939720598 2:145645497-145645519 AAAGGAAAAAAAAAGGAGAAAGG + Intergenic
939874296 2:147559159-147559181 AGAGAAAAAAAGAAGAAGGTGGG - Intergenic
939945831 2:148409432-148409454 AAAGGAAAAGGGAAGGAGGGAGG + Intronic
940263122 2:151805926-151805948 AAAGATAAAATAGAGGAGGTTGG - Intronic
940886203 2:158991360-158991382 AGATGTTAAAAGAATGAGGTAGG + Intronic
941042689 2:160641163-160641185 TAAGGTATAAAGAAGGTAGTTGG - Intergenic
941164449 2:162070591-162070613 GAAGGAAAAAGGAAGGAAGTAGG - Intronic
941317036 2:164006406-164006428 AATGGTAAAAAAAAATAGGTAGG - Intergenic
941471677 2:165896271-165896293 AAAGAGAAAAAGAAAGAGGTGGG - Intronic
941474873 2:165938711-165938733 AAAGGCAGGAAGAAGGAGGGAGG + Intronic
941539770 2:166767708-166767730 ACAGGAAAAAAGAATGTGGTAGG + Intergenic
942076596 2:172361935-172361957 AAAAGGAAAAAGAATGGGGTGGG + Intergenic
942103309 2:172607639-172607661 AATGGTACTAGGAAGGAGGTTGG + Intronic
942468811 2:176238430-176238452 AAGGGTAAATATAAGGAGGGGGG - Intergenic
942473411 2:176287122-176287144 AAAGGTACACATAAGGAGATAGG + Intronic
942594402 2:177579364-177579386 GAAGGAAAAAAGAAGGAGAAGGG - Intergenic
942602824 2:177658543-177658565 ACAGGAAGAAAGAAGGAGGGAGG - Intronic
942839497 2:180342077-180342099 AAAGGAAAATAGAAGGATGCTGG - Intergenic
943292712 2:186095162-186095184 AATGGTAAAAACATGGTGGTTGG + Intergenic
943772596 2:191734549-191734571 AAAGGTAACAAGGAGAATGTGGG - Intergenic
944197638 2:197072101-197072123 AAAGGAAGAAAGGAGGAGGGAGG + Intronic
944293357 2:198033650-198033672 AAAGGTAAACAAGATGAGGTTGG - Intronic
944807724 2:203298702-203298724 AAAAAAAAAAAAAAGGAGGTGGG + Intronic
944821292 2:203434572-203434594 AAAAAAAAAAAGTAGGAGGTGGG + Exonic
945064901 2:205940239-205940261 AATGGCAAAAAGAAGAGGGTGGG + Intergenic
945121428 2:206461509-206461531 AATTTTAAAAATAAGGAGGTTGG + Intronic
945180883 2:207089975-207089997 AAAGGTGGAAAGAAGAAAGTAGG - Intronic
945568067 2:211429050-211429072 AAAGGTAAAAATAATTAAGTGGG + Intronic
945656667 2:212632512-212632534 AAAGATAAAAATAAGGAGACAGG - Intergenic
945793396 2:214332717-214332739 AAAGATAAAAAGATGGAGCGTGG - Intronic
945895709 2:215479344-215479366 TAATGTAAAAAAAAGGGGGTGGG - Intergenic
946595750 2:221304103-221304125 AAAAGGAAAAAGAAAGAGTTAGG + Intergenic
946717655 2:222569670-222569692 AAAAGTCAAAAGCAGGTGGTCGG - Intergenic
946980158 2:225204413-225204435 AAAGGGAGAAGGAAGGAGGGTGG - Intergenic
947030129 2:225783266-225783288 AAAGGGGAAAGGAAGGAGGGAGG - Intergenic
947082030 2:226409700-226409722 GAAGGCAAAGAGAAGGAGGCAGG + Intergenic
947103209 2:226643686-226643708 AAAGGGAAAAAAAAGGAGGGGGG + Intergenic
947147019 2:227077700-227077722 AAAAAAAAAAAGAAGGAGGAGGG + Intronic
947235008 2:227932055-227932077 AAAGGCAAGGAGAAGAAGGTGGG - Intergenic
947477210 2:230461131-230461153 AAAAGGAAAAACACGGAGGTGGG + Intronic
947658894 2:231852100-231852122 AAAGAAAGAAAGAAGGAGGGAGG - Intergenic
947785896 2:232819803-232819825 TAAGGAAAAAAGATGGAGGGTGG - Intronic
948243089 2:236454985-236455007 AAAGAGAAAAAGATGGAGGAGGG - Intronic
948568891 2:238905014-238905036 GAAGGAAGAAAGAAGTAGGTAGG + Intronic
948729997 2:239956820-239956842 TAAGGAAAAAACAAGCAGGTAGG - Intronic
948810243 2:240471580-240471602 AAAAGAAAAAACAAGGAGATTGG + Intergenic
1168904404 20:1392212-1392234 AAAAGTAAAAAGACGGAAGAAGG + Intronic
1168924782 20:1570511-1570533 AAAGGAAAAAAGAGAGAGGGAGG - Intronic
1169228250 20:3869592-3869614 AAAGGAAAAAAAAAAGTGGTGGG - Exonic
1169385698 20:5147568-5147590 AAAAATAAAAAGAAAGAAGTGGG - Intronic
1169832727 20:9841749-9841771 GAAGGTAAAGAGAATGAGCTGGG - Intergenic
1169862824 20:10170828-10170850 ACCTGTAAAAAGAACGAGGTTGG - Intergenic
1169950433 20:11037649-11037671 ATAGGTTAAGAGAAGGAGGGAGG + Intergenic
1170458348 20:16554093-16554115 CTGGGTAGAAAGAAGGAGGTGGG + Intronic
1170550683 20:17473519-17473541 AAGGTTAAATAGGAGGAGGTTGG - Intronic
1170554806 20:17506273-17506295 AAAGGTAGAAAGAAAGATGTTGG - Intronic
1171979531 20:31617787-31617809 AAAAAAAAAAAGAAGGAGATGGG - Intergenic
1172171674 20:32939073-32939095 AAAAGAAAAAAGAAAGAAGTTGG - Intronic
1172783527 20:37451241-37451263 CAAGTTTAAAGGAAGGAGGTGGG - Intergenic
1172889043 20:38250869-38250891 AAGGGCAAGAAGAAGAAGGTAGG + Intronic
1173042220 20:39475191-39475213 AAGGGAAAAGGGAAGGAGGTTGG - Intergenic
1173102898 20:40104196-40104218 AATGGAAGGAAGAAGGAGGTGGG - Intergenic
1173206255 20:40996513-40996535 AAAAGAAAAAAGAAAGAGGAGGG + Intergenic
1173208779 20:41015690-41015712 AAAGAAAGAAAGAAGAAGGTCGG - Intergenic
1173363475 20:42365045-42365067 AAAGGCAAAGAGAAGCAGGTGGG + Intronic
1173443752 20:43099595-43099617 AAAGGTGGAAATTAGGAGGTAGG - Intronic
1173629029 20:44496174-44496196 ATACGTAAAAGGAAGGAGGGAGG + Intergenic
1173958418 20:47052607-47052629 AAAGATAAAAAGAAAGAAGCAGG - Intronic
1174079288 20:47959627-47959649 AAAAGTAAAATGAAGGAGAGGGG - Intergenic
1174434545 20:50496710-50496732 AAAAGGAAAAAGAAGGAAGGAGG - Intergenic
1174437219 20:50517858-50517880 AAAAGTAAAGAGAAGGAGACAGG - Intronic
1174730052 20:52907286-52907308 AATGATAAAAAGAAGGAGAGTGG + Intergenic
1174755119 20:53150676-53150698 AAAGGAAAAAGGAAGGAAGGAGG + Intronic
1175273990 20:57754904-57754926 GAAGGAAAAAAAAAGGAGGAAGG - Intergenic
1175293662 20:57894617-57894639 GAAGGAAGAAAGAAGGAGGGAGG + Intergenic
1175293681 20:57894689-57894711 GAAGGAAGAAAGAAGGAGGGAGG + Intergenic
1175582005 20:60107170-60107192 AAACTTAAAAAGAATGAGGTTGG - Intergenic
1175657846 20:60787159-60787181 GGAGGTAAGAAGAGGGAGGTGGG - Intergenic
1175817832 20:61892895-61892917 AAAGGTAGAAAGAGGGAGGGAGG + Intronic
1176610206 21:8875306-8875328 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1176743045 21:10623740-10623762 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1176777920 21:13156140-13156162 ATAGGAACAAAGAAGGAGTTAGG + Intergenic
1177233524 21:18355218-18355240 AAAGGAAAAAAGAGGCAGATAGG - Intronic
1177624256 21:23639205-23639227 AAAGGCAAAAAAAATCAGGTGGG - Intergenic
1178323317 21:31622783-31622805 AAAGAAAAAAAGAAAGAGGAAGG - Intergenic
1178471001 21:32892805-32892827 AAAGGAAGAAAGAAGGAAGGAGG - Intergenic
1178514099 21:33230985-33231007 AATGTTAAAAGAAAGGAGGTGGG - Intronic
1178570190 21:33728718-33728740 CAAGGTAAAGGGAAAGAGGTGGG - Intronic
1178757319 21:35363950-35363972 AAAAAAAAAAAAAAGGAGGTGGG - Intronic
1178857426 21:36261913-36261935 AAAGGAAAAAAAATGGGGGTGGG + Intronic
1179188768 21:39106268-39106290 AAAGGGAGAAAGGAGGGGGTGGG - Intergenic
1180280979 22:10695173-10695195 AAAAGTAAAAAGGTGGAGGAGGG - Intergenic
1180280989 22:10695208-10695230 AAAAGTAAAAAGGTGGAGGAGGG - Intergenic
1180285073 22:10737965-10737987 AAAGGTAATAAGGAGGATTTGGG - Intergenic
1180360267 22:11884552-11884574 AATAGTAAAAAGAATAAGGTAGG + Intergenic
1180525697 22:16257566-16257588 ATAGGAACAAAGAAGGAGTTGGG + Intergenic
1180534277 22:16383083-16383105 AAAAGTAAAAAGGAGGAGGAGGG - Intergenic
1181869877 22:25889544-25889566 AAAAAAAAAAAGAAAGAGGTAGG - Intronic
1181907315 22:26209691-26209713 GAAGGAAAAAAGAAAGAGGAAGG + Intronic
1181907342 22:26209822-26209844 AAAGGAAAAAAGTAGGAGGAAGG + Intronic
1181920513 22:26316945-26316967 AAAGGAAGAAAGAAGGAGGGAGG + Intronic
1182015442 22:27035418-27035440 AAAGAAAAAAAGAAGGAAGAGGG - Intergenic
1182262141 22:29081142-29081164 AACAGTAAAAAGAAGGACGGGGG - Intronic
1182411232 22:30188734-30188756 AAAGGAAAAAATAAGGAGGTGGG - Intergenic
1182488372 22:30653363-30653385 AAAAAAAAAAAGAAGGAGGAAGG - Intronic
1183091095 22:35522726-35522748 GAAGGAAAAAAGAAAGAGGAAGG - Intergenic
1183226804 22:36556032-36556054 AAAAAAAAAAAGAAGAAGGTGGG - Intergenic
1183311162 22:37110126-37110148 AAAAAAAAAAAGAACGAGGTAGG - Intergenic
1183644839 22:39118976-39118998 AAAGTTTAAAAGAAGGAAGGGGG - Intergenic
1184327465 22:43800032-43800054 AGAGGTAAAGAGGGGGAGGTGGG + Intronic
1184381502 22:44147592-44147614 GAAGGTAAAAAGCAGGTGGAAGG + Intronic
1184583638 22:45433454-45433476 AAGGCAAAAAAGAAGGGGGTCGG + Intergenic
1184777862 22:46632267-46632289 AGAGGTGGCAAGAAGGAGGTGGG + Intronic
1184883681 22:47328824-47328846 AAAAGGAAAAGGAAAGAGGTAGG - Intergenic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
1203237524 22_KI270732v1_random:19688-19710 AAAGTTAAAAAAAAAAAGGTGGG - Intergenic
1203238073 22_KI270732v1_random:26673-26695 AAAAGTAAAAAGATGGAGGAGGG - Intergenic
1203289589 22_KI270735v1_random:21714-21736 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1203315366 22_KI270737v1_random:2713-2735 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1203322673 22_KI270737v1_random:83347-83369 ATAGGAACAAAGAAGGAGTTAGG - Intergenic
949113442 3:291166-291188 CAAGGTAAAGAGGAAGAGGTTGG + Intronic
949123287 3:413851-413873 AAAGGAAAAAAGAAAGGGCTTGG - Intergenic
949160449 3:875865-875887 AAATGTAAAAACAAATAGGTTGG - Intergenic
949460806 3:4291442-4291464 AGTGGTAAAAAGAAGGAGAGAGG - Intronic
949752555 3:7371481-7371503 AAAGGCAACAAAATGGAGGTTGG + Intronic
949908284 3:8877817-8877839 AAAGAGAAAAAAAAGGGGGTGGG + Exonic
949920033 3:8993279-8993301 AAGAGAAAAAAGGAGGAGGTAGG - Intronic
950071665 3:10157538-10157560 AAAGGTAAAAAGAATAGGATAGG + Intergenic
950311261 3:11960061-11960083 GAAGGAAAGAGGAAGGAGGTAGG + Intergenic
950403878 3:12792452-12792474 AAAAGAAAAAAGAATGAGGGTGG - Intergenic
950498667 3:13349865-13349887 AAACGGAAAAAGAGAGAGGTAGG + Intronic
951490392 3:23264367-23264389 AAAGGAAAAAAAAAAAAGGTGGG + Intronic
951801466 3:26601241-26601263 AAAGGTCAAATGAAGTATGTTGG + Intergenic
951875319 3:27418366-27418388 GAAGGTAAACAGGACGAGGTGGG + Intronic
951972974 3:28469057-28469079 AAAGTTAAAAAGAGGGAGGAAGG + Intronic
952001698 3:28793452-28793474 TAAGATAAGAAGAAAGAGGTAGG + Intergenic
952442029 3:33340589-33340611 AAAAAAAAAAAGAAGGAAGTAGG + Intronic
953367190 3:42354850-42354872 AAGGATGAAAAGGAGGAGGTGGG - Intergenic
953368860 3:42370306-42370328 AGAAGGAAAAATAAGGAGGTGGG - Intergenic
953599740 3:44350410-44350432 AAAATGAAAAAGAAGGAAGTGGG - Intronic
953965304 3:47300182-47300204 AAGGAGGAAAAGAAGGAGGTGGG - Intronic
954338977 3:49938315-49938337 AAAAAGAAAAAGAAAGAGGTTGG - Intergenic
954365194 3:50142077-50142099 AAAAGAAAAAAGAAAGAGGAAGG - Intergenic
954981420 3:54749223-54749245 AAAGGTAAAAAGCAAGTTGTGGG - Intronic
955019914 3:55109989-55110011 AAAGCCAAAAAGATGTAGGTAGG - Intergenic
955033862 3:55247612-55247634 CAAGGTAAAGAGAAGGAGAAAGG - Intergenic
955402590 3:58603848-58603870 ATCTGTAAAAAGCAGGAGGTTGG - Intronic
955407729 3:58636019-58636041 AAAGGAGAAAAGAAGGATGATGG - Intronic
955671810 3:61410274-61410296 AAAAGGAGAAAGAAGGAGGGAGG + Intergenic
955731872 3:61995760-61995782 AAAAAGAAAAAGAAGGAGGGAGG - Intronic
956004499 3:64763966-64763988 AAAGGTAGAAGGAAAGAGGGGGG - Intergenic
956303045 3:67793359-67793381 AAATGTACAGAGAATGAGGTGGG - Intergenic
956360596 3:68442608-68442630 GAAGGAAAAAAGAAAGAGGGAGG + Intronic
956451944 3:69383930-69383952 AAAGTTAAAAATAAGGAGTGGGG + Intronic
956828757 3:73024654-73024676 AAAGGAAAGGAGAAGGAGGGAGG - Intronic
957200217 3:77124832-77124854 AAAGGTAAAGGGAAGAAGGGAGG - Intronic
957220168 3:77372137-77372159 AAAGGGAAAGAGAAGGAAGGAGG + Intronic
957364573 3:79205842-79205864 AAAGTTAAAAAAAAGAAGTTGGG + Intronic
957478646 3:80760745-80760767 AAATCTATAAAGAAGGAAGTAGG - Intergenic
957764872 3:84610526-84610548 AAGGGGAAAAAGAAGGAAGAGGG + Intergenic
958626977 3:96638984-96639006 AAAGGAAAAATGGAAGAGGTGGG + Intergenic
958852606 3:99347142-99347164 AAAGAAAAAAAGAAAGTGGTAGG + Intergenic
958858462 3:99416250-99416272 AGAAGAAAAAAAAAGGAGGTGGG + Intergenic
958904335 3:99925384-99925406 AAATAAAAAAAGAAGGATGTAGG - Intronic
959833662 3:110893272-110893294 AAGGACAAAAAGAAGGAGGAAGG - Exonic
960060214 3:113312735-113312757 AAAGGGAAAAACATAGAGGTGGG + Intronic
960246226 3:115403308-115403330 AAAGGGAAAAAAAGGGAGGGTGG + Intergenic
960782799 3:121338661-121338683 AAAGAAAAAAAGAAAGAGGAAGG + Intronic
961049741 3:123736389-123736411 AGAGGGACAAAGAAGGAGGAAGG + Intronic
961347750 3:126275037-126275059 AAAGGGAAAAAGAAGAATGAAGG - Intergenic
961471962 3:127120838-127120860 AAAAGAAAAAAAATGGAGGTAGG - Intergenic
962297516 3:134205118-134205140 AAAGATAAAAATAAGCAGGTTGG + Intronic
962604791 3:137024185-137024207 ATAAATAAAAAGAAGGAGGAAGG - Intergenic
962614152 3:137107758-137107780 AAAGGAGAAAGGAAGGAGGGAGG - Intergenic
963093743 3:141512764-141512786 AAAAGTCAAAATAAGGAGGCCGG + Intronic
963431287 3:145207688-145207710 AAAAAGAAAAAGAAGGAGGGAGG + Intergenic
963764688 3:149322699-149322721 AGAGTAAAAAAGAAGGAAGTAGG - Intronic
963994590 3:151693203-151693225 AATGGTAACCAGAAGGAGGAAGG - Intergenic
964077468 3:152708859-152708881 AAAGGCATAAAGGAGAAGGTTGG - Intergenic
964357184 3:155861612-155861634 GGAGAAAAAAAGAAGGAGGTGGG - Intergenic
964404716 3:156337387-156337409 AAAGGAAAAAAGAAGACAGTGGG - Intronic
964684173 3:159376691-159376713 AGAGGTAAAAAGAAGGGAGAAGG - Intronic
965325581 3:167299939-167299961 AAAGGTGAAAAGCAGGTGGAGGG - Intronic
965329155 3:167348379-167348401 AAAGAAAAGAAGAAGGAGGGAGG + Intronic
965489069 3:169314755-169314777 AAAGGCAAAAAGAAGAATATAGG + Intronic
965491073 3:169337463-169337485 TGAGTTAAAAAGATGGAGGTTGG - Intronic
965496010 3:169400193-169400215 TTAGGTTAAAAAAAGGAGGTGGG - Intronic
965547117 3:169927262-169927284 AAAGATAAAAAGAGGCAGGATGG - Intronic
965863692 3:173178789-173178811 GAAGGTAAAGGGAAAGAGGTTGG - Intergenic
966030745 3:175344489-175344511 AAAGGCAAAGGGAAAGAGGTTGG - Intronic
966697317 3:182803978-182804000 AAAAGAAAAAAAAAGAAGGTGGG - Intronic
966697830 3:182810566-182810588 AAAGGTAGAAAAAAGTAGGGTGG - Intronic
967232689 3:187355259-187355281 GAAGGTAGAAGGAAGGAGGAAGG - Intergenic
967471248 3:189864679-189864701 AAAAATAAAAAGAAGGAAGCAGG - Intronic
967563251 3:190942754-190942776 AAGGGAAATAAGAAGGAGGGAGG - Intergenic
967607324 3:191462980-191463002 AAAAGAAAAAAGAGGGAGGGAGG - Intergenic
967691083 3:192474583-192474605 AAAGGTATAAAGAAAAAGGAAGG + Intronic
967839034 3:193989511-193989533 TAATGTAAAAAGGAGGAGATAGG - Intergenic
968257306 3:197287622-197287644 AAAAGGAAAAAGGAGGAGGAAGG + Intronic
1202736888 3_GL000221v1_random:10092-10114 AATAGTAAAAAGAATGAGGTAGG + Intergenic
968811488 4:2801425-2801447 AGAGGCAAAAAGAAGGAAGAAGG - Intronic
969353866 4:6613825-6613847 GAAGGAAAAAAGAGGGAGGGAGG + Intronic
969961923 4:10953215-10953237 AAAGAAAGAAAGAGGGAGGTAGG - Intergenic
970432848 4:16004926-16004948 AAAGAAAAAAAGAAAGAGGAAGG - Intronic
970447524 4:16136554-16136576 AAAGGTCAGAAGACTGAGGTTGG + Intergenic
970556042 4:17233423-17233445 AAAGCTAATAAAAAGGAGCTGGG + Intergenic
970620654 4:17814404-17814426 AAAAAGAAAAAGAAGGAAGTTGG + Intronic
970627245 4:17900759-17900781 AAATGTGAAAAGGAAGAGGTAGG + Intronic
971007802 4:22394640-22394662 AAAGGTCAAAAGAATGAGGTAGG + Intronic
971172795 4:24250572-24250594 CACAATAAAAAGAAGGAGGTGGG + Intergenic
971172980 4:24252531-24252553 AAAGCTAAAAAGAAATAGTTTGG - Intergenic
971490816 4:27210219-27210241 AAAGGCAAAAAGACAGAGATTGG + Intergenic
971645075 4:29189019-29189041 AAAAGTAAAAAGAAGGGAGCCGG - Intergenic
971932386 4:33101806-33101828 GAAGGAAAAAAGAAGGAAGGAGG - Intergenic
972520583 4:39851634-39851656 AGAGATAAAAAGATGGAGCTAGG + Intronic
972627870 4:40818870-40818892 AAATGTTAAAAGGATGAGGTGGG - Intronic
973051251 4:45600999-45601021 AAAGGCAAAGAGAAAGACGTAGG + Intergenic
973385188 4:49507822-49507844 AATAGTAAAAAGAATGAGGTAGG - Intergenic
974137067 4:57832223-57832245 AATAGTAAAAAGGAGGAGGCAGG - Intergenic
974466438 4:62262686-62262708 AAAGGCAAAAAAAAAAAGGTGGG + Intergenic
974802489 4:66836226-66836248 AAAGGGATAGAGAAGGAGGTTGG + Intergenic
974924299 4:68278306-68278328 GAAGGAAAAAAAAGGGAGGTAGG - Intergenic
974938084 4:68431627-68431649 AAAAAAAAAAAGAAGGAGGTGGG + Intergenic
975109502 4:70607960-70607982 GAAGGTGAAGAGAAGGGGGTAGG - Intergenic
975336142 4:73177543-73177565 AAATGCAAAAAGAGGGAGGAAGG + Intronic
975662241 4:76699363-76699385 AAAGGTAAAAAGCAGGGGGAGGG - Intronic
975667733 4:76749936-76749958 AAACGTAGAAAGGAGTAGGTAGG - Intronic
976205233 4:82617877-82617899 ATAGGTAAAAAGATGGGGGAAGG - Intergenic
976389020 4:84490764-84490786 AAAGGAAAAAAGGAAGAGGAAGG + Intergenic
976885540 4:89979463-89979485 AAAAGAAAAAAGAAGGAAGAAGG - Intergenic
976897000 4:90125396-90125418 CATTGTAAAAAGAAGGAGGGAGG + Intergenic
977004463 4:91547530-91547552 AAAAGTAAACAGAAGGAAGAAGG - Intronic
977620357 4:99129162-99129184 AAAGATAAAAAAAAGTAAGTAGG + Intronic
978285994 4:107077270-107077292 GAAGGTCAAAAGTAGGAGATTGG + Intronic
978389338 4:108207833-108207855 AAAGAAAAAAAAAAGGTGGTTGG + Intergenic
978468721 4:109037976-109037998 AATGGATAAAAGAAGGAGGAAGG + Intronic
978600569 4:110423295-110423317 AAAAATAAAAAGAAGAAGGCTGG + Intronic
978622005 4:110641862-110641884 ATAAGCAAAAGGAAGGAGGTCGG - Intronic
978685251 4:111434706-111434728 GAAGGGAAAATGAAGCAGGTGGG + Intergenic
978712946 4:111807655-111807677 AAGAGAAAAAAGCAGGAGGTCGG + Intergenic
978776795 4:112513803-112513825 AAAGGGAAAAATCAGGAGGGAGG - Exonic
978862349 4:113465607-113465629 AAAGGCAAAAATATGGAGTTGGG + Intronic
978965732 4:114738848-114738870 ACAGGTACAAAGAAGAAGATTGG + Intergenic
979069771 4:116187133-116187155 AAGGGGAAAGAGAAGAAGGTAGG + Intergenic
979092385 4:116501663-116501685 AAAGAAAGAAAGAAAGAGGTAGG - Intergenic
979281762 4:118876608-118876630 AAAAGAGAAAAGAAGGAGGAGGG - Intronic
979823253 4:125200666-125200688 AAAGCTAAAAAGGATGAGGAAGG + Intergenic
979956887 4:126964541-126964563 AAAGGAGAAAGGAAGGAGGGAGG + Intergenic
979993162 4:127399827-127399849 AAAGAGAAAAAGGAAGAGGTTGG + Intergenic
980011869 4:127604929-127604951 AAAGAAATAAAGAAGGAGCTAGG + Intergenic
980159914 4:129148272-129148294 AAAGGGAGGAAGAAGGAAGTGGG + Intergenic
980244853 4:130225533-130225555 AAAATTAAAAAGAAATAGGTTGG + Intergenic
980253789 4:130350193-130350215 GAAGGAAAAAGGAAGGAGGGAGG - Intergenic
980276854 4:130664176-130664198 AAATGAAAAAACAAGGAGGGGGG - Intergenic
980302884 4:131016338-131016360 AAAGGAAGAAAGAAGGAATTTGG + Intergenic
980583830 4:134787958-134787980 AAAGAAAAAAAGAATGAGGCTGG - Intergenic
980795164 4:137673305-137673327 GAAGGAAAAAAAAAGGAGGGTGG - Intergenic
980896494 4:138865591-138865613 AATGATAAAGAGAAGGAGGAAGG + Intergenic
980903216 4:138924626-138924648 AAAAGAAAAAAGAAGGAGGTGGG + Intergenic
980998825 4:139808567-139808589 AAAGGCAAAAAGGAGGAAGCAGG + Intronic
981016111 4:139976083-139976105 AAACTAAAAAAGAAGGAAGTGGG + Intronic
981324013 4:143426092-143426114 AAAGATAAAAAGTTAGAGGTTGG + Intronic
981562288 4:146061255-146061277 AAAGGAAGGAAGAAGGAGGAAGG - Intergenic
981601251 4:146491526-146491548 AAAAGGAAAAAGATGGAGGGAGG + Intronic
981881963 4:149624929-149624951 AAAGGGAAACAGAACGAGCTTGG - Intergenic
982662001 4:158218488-158218510 AAAAGAAAATAGCAGGAGGTGGG - Intronic
982811515 4:159831443-159831465 AAAGGAATAAAGATGGAGATGGG - Intergenic
983094922 4:163550312-163550334 AAAAGAAAAAAGCAGGAGGTAGG + Intronic
983201659 4:164867131-164867153 AAAGCTATAAAGAGGGAGCTTGG - Intergenic
983580279 4:169302987-169303009 GAAGGTAAAAAAGAGGAGGCAGG + Intergenic
983658767 4:170110753-170110775 AAAGAAAAAAAGAGGGAGGAAGG - Intergenic
983708798 4:170689500-170689522 ACAGGTAACAAGAAAGAGGATGG - Intergenic
984039959 4:174719257-174719279 AAAGGTTAAAAGCACGAGGCCGG - Intronic
984086738 4:175322906-175322928 GAAGGTAGAAAGTAGGAGGAGGG + Intergenic
984207147 4:176798930-176798952 AAAGGGGAAAAAAAGGAAGTAGG + Intergenic
984951393 4:185010457-185010479 GAAGGGACAAAGAAGGAGATGGG + Intergenic
1202769050 4_GL000008v2_random:183180-183202 AATAGTAAAAAGAATGAGGTAGG - Intergenic
985559566 5:576424-576446 AAAGAAAAAAAGAGGGGGGTGGG - Intergenic
986573689 5:9191175-9191197 AAAGGAATAAAGAAGGAAGAAGG + Intronic
987182174 5:15379643-15379665 AAAGGCAGAAAGAAGAAGGAAGG + Intergenic
987445737 5:18017101-18017123 AAAGTTAGAAAGAAGGAGGCAGG + Intergenic
988055739 5:26093223-26093245 AGAGGAAGAAAGAAGGAGGAAGG + Intergenic
988263458 5:28921281-28921303 AAAAGTAAAAGGAAAGAGGTAGG + Intergenic
988476153 5:31587851-31587873 AAAGGAAAAAAAAAAAAGGTAGG - Intergenic
988922205 5:35953945-35953967 AAAGGGAGAAAGGAGGAGGCAGG + Exonic
988937656 5:36104335-36104357 AGATGTAAAAAGAAGGGGGCAGG + Intronic
989079707 5:37605009-37605031 AAAAAAAAAAAGAAGGAGGGGGG - Intronic
989290594 5:39760634-39760656 AGAGGTAAACAGAAGGAAGTGGG + Intergenic
989305044 5:39945204-39945226 TAAGGTAACAAGAATGAAGTGGG - Intergenic
989435613 5:41410122-41410144 AAAGATAAATAAAAGGAGGGGGG - Intronic
989494620 5:42098064-42098086 AGCAGTAAAAAGAAGGAAGTTGG - Intergenic
989756219 5:44958781-44958803 AGAAGGAAAAAGAAGGAGGAAGG - Intergenic
989844540 5:46124651-46124673 CAAGGTAAAAACAAGAAGGAAGG - Intergenic
990244066 5:53845469-53845491 AAAGGAAAAAAGAACAAGGGTGG + Intergenic
990555823 5:56934720-56934742 AAAGGAAAAAAGAAGGACTCAGG + Intronic
990800584 5:59598352-59598374 AAAAATAAAAAGCAGGAAGTGGG + Intronic
990828184 5:59925194-59925216 AAAGTTAAAAAGTAGAAAGTAGG + Intronic
991094238 5:62722401-62722423 AAAAGTAAAAAGAAATGGGTGGG - Intergenic
991100702 5:62789347-62789369 AAGGGTACAAAGCAGGAGGCAGG + Intergenic
991332678 5:65509339-65509361 AAAGGCAAAACTATGGAGGTGGG - Intergenic
991344306 5:65646512-65646534 AAAGGTACAAATAAGGAAGGGGG - Intronic
991452966 5:66772200-66772222 AAAGGTAAGAAGATGGTGGGTGG + Intronic
991596688 5:68313952-68313974 AAGGGTAAAAAGAAGCACCTAGG + Intergenic
991974780 5:72175044-72175066 AAAGATAGAAGGAAGGAGGGAGG - Intronic
992081020 5:73234294-73234316 GAAGGGAAAAAGATGGAGGTGGG - Intergenic
992184010 5:74225981-74226003 AAAGAAAAAAGGAAGGAGGAAGG - Intergenic
992952356 5:81872855-81872877 AGAGGGAAAGAGAAGGAGGGTGG - Intergenic
993323908 5:86510606-86510628 AAAGATGAAATGATGGAGGTCGG + Intergenic
993397475 5:87408189-87408211 AGAGGAAAAAATAAGGAGGCAGG + Intronic
993652415 5:90537800-90537822 ACATGCAAAAAGAAGGAGGTAGG + Intronic
993697715 5:91081486-91081508 AAAGGAAAAAATCAGGAGCTGGG + Intronic
993887034 5:93426754-93426776 AAAGGTAAAAGGAAGAAGAGTGG + Intergenic
994042346 5:95273446-95273468 ATAGTTATAATGAAGGAGGTTGG - Intronic
994164854 5:96597925-96597947 AAATGGAAAAAGAAGGGGGGAGG + Intronic
994229115 5:97293426-97293448 AAAGTCAAAAAGCAGGAGGATGG - Intergenic
994284352 5:97946923-97946945 AAAAGAAAAAAGAACAAGGTAGG - Intergenic
994324380 5:98432404-98432426 AAAGGTCAAAAGAAGGGGAAAGG + Intergenic
994346042 5:98687467-98687489 AAAGGGAAGCAGAAGGAGGAAGG + Intergenic
994591727 5:101782668-101782690 AAAGGTAAGAAACAGGAGGAAGG + Intergenic
994756943 5:103805459-103805481 AAAGAATAAAAGAAGGAGGAAGG - Intergenic
994886481 5:105568928-105568950 AAATGTAAAAAGCAAGAGCTAGG + Intergenic
994912764 5:105933941-105933963 ATGAGTAAAAAGAAGCAGGTGGG + Intergenic
995082267 5:108066070-108066092 AAAGCTAAGAAGAAGAAGGAGGG + Intronic
995219013 5:109627230-109627252 AAAGAAAAAAAAAAGGAGGGAGG - Intergenic
995484374 5:112625014-112625036 AAAGTTAAAAAGCAGAAGCTAGG - Intergenic
995818917 5:116204423-116204445 AAAAGAAAAAAAAAGGAGGATGG - Intronic
995891186 5:116953704-116953726 AAAGGGATAAAGAAGGAAGGGGG + Intergenic
995957180 5:117791652-117791674 ACATGTACAAAGAAGGTGGTAGG + Intergenic
996413037 5:123179874-123179896 AAAGATAAAAATAAGAAAGTAGG + Intronic
996742419 5:126813056-126813078 AATGGTAAAAAGAAAAAGGAAGG - Intronic
996855505 5:128001649-128001671 AAAAATAAAAAGGAGGAGGAAGG + Intergenic
997098024 5:130935718-130935740 AAAGAAAAAAAAAAGGAGGGTGG + Intergenic
997665654 5:135627852-135627874 AAATGTTAAAGGAGGGAGGTGGG - Intergenic
998120417 5:139571806-139571828 AAAGGAAAAAGGAAGGAAGGAGG - Intronic
998364127 5:141618214-141618236 AAACGTCCAAAGAAGGAGTTGGG + Intronic
998447258 5:142207945-142207967 AAAAGAAAAAAGAAAAAGGTCGG - Intergenic
998549486 5:143063663-143063685 AAAGGTAAAAGGATGGAGCAGGG - Intronic
999402214 5:151273938-151273960 AAAGGGAAGAAAAAGGGGGTGGG - Intergenic
999404880 5:151298140-151298162 ACAGGAAAAGAGAAAGAGGTAGG + Intronic
999796978 5:154998020-154998042 AACGATAAAAACAAGGAGGGAGG - Intergenic
1000075513 5:157781423-157781445 AAAGGTCAACAGCAGGAGATGGG - Intergenic
1000839088 5:166194133-166194155 AAAGGAAAAAATTAGGAGGGAGG - Intergenic
1000918949 5:167116164-167116186 AAGGATAAACAGAAGGAAGTAGG + Intergenic
1001079411 5:168656115-168656137 AAAAATAAAAAGGAGGAGGAGGG - Intergenic
1001093676 5:168760233-168760255 AAAGGTAATGAGAATGATGTTGG - Intronic
1001129993 5:169055849-169055871 AAAAAGAAAAAGAAGGAAGTTGG + Intronic
1001215120 5:169848805-169848827 AAAAGAAAAAAGAAGGAAATTGG + Intronic
1001303775 5:170556594-170556616 AGAGGAAGAAAGAAGGAGGTGGG + Intronic
1001330210 5:170756672-170756694 AAGGGTAAGGAAAAGGAGGTTGG + Intergenic
1001458354 5:171885615-171885637 AAAGATTAAAAGAAGGGAGTGGG - Intronic
1002278321 5:178116961-178116983 AAAGGAAAAAAAAATGAAGTGGG - Intronic
1002516381 5:179761979-179762001 AGAGGTAAAAAAGAGGAGGCAGG + Intronic
1002680238 5:180956300-180956322 AAAGGTAAAAAGTTTGAGTTAGG - Intergenic
1002683057 5:180983750-180983772 AAAGGGAAAAAGCAGGTGGCAGG - Intergenic
1002851742 6:1003081-1003103 AAAGGGAGAGAGAGGGAGGTGGG - Intergenic
1002941442 6:1720152-1720174 CAAGGAAAAAAGGAGGAAGTTGG + Intronic
1003287229 6:4745322-4745344 AAAGGGGGAAAGAAAGAGGTTGG + Intronic
1003759687 6:9162752-9162774 AAAGGAAGAAAGAGGGAGGGAGG + Intergenic
1004872457 6:19920678-19920700 ACAGGCAAAAGGAATGAGGTGGG - Intergenic
1005080108 6:21948147-21948169 ATAGGAAAAAAGAAGTAGGTTGG + Intergenic
1005219455 6:23570268-23570290 AAACCAAAAGAGAAGGAGGTAGG + Intergenic
1005286487 6:24333084-24333106 AAAGGCAAAAAGAAGAATGAGGG + Intronic
1005369922 6:25121791-25121813 AAAGAGAAAAGGAAGGAGGAAGG + Intergenic
1005498553 6:26410216-26410238 AAAGGAAAAAAGAAAGAGTGTGG + Intronic
1005525757 6:26646341-26646363 CAGGCTAAAAATAAGGAGGTGGG + Intronic
1005578789 6:27214159-27214181 AAAGAAAAAAAGAAAGAAGTGGG - Intergenic
1005927842 6:30458949-30458971 AAAGTTAAAAAGAAAGAGGATGG + Intergenic
1006651850 6:35558066-35558088 GACGGTAAAAGGAAGGATGTGGG + Intergenic
1007266813 6:40602529-40602551 AATGGGAAAAAGAAAGAGGCAGG - Intergenic
1007559022 6:42790528-42790550 AAAGGGGAAAAGAAGGTGGGGGG - Intronic
1007797705 6:44363703-44363725 AAAGGAAAAAGGAAGGAAGGAGG - Intronic
1007950277 6:45866062-45866084 AGAGGTAAAAAGAAAGAGGGAGG - Intergenic
1008246763 6:49184690-49184712 AAAAAGAAGAAGAAGGAGGTGGG - Intergenic
1008372064 6:50744189-50744211 GAGGGTAAAAAGTAGGAGGGTGG - Intronic
1008389288 6:50930950-50930972 ACAAGTAAAAAGAAAGAAGTAGG - Intergenic
1009026380 6:58005268-58005290 AAGGGAAAAAGGAAAGAGGTGGG + Intergenic
1009201930 6:60756741-60756763 AAGGGAAAAAGGAAAGAGGTGGG + Intergenic
1009699128 6:67153438-67153460 AAAGGTAAAAACATGGATATAGG + Intergenic
1009758186 6:67968353-67968375 AGAGGGACAAAGAAGGATGTAGG + Intergenic
1009957004 6:70467700-70467722 AAAGGAGAAAAGAAGGAGAAAGG - Intronic
1010174236 6:73007885-73007907 AAAAGAAAAATGAAGGATGTGGG - Intronic
1010289879 6:74123070-74123092 AAAAGCACAAAGAAGGAGGTGGG - Intergenic
1010394117 6:75370875-75370897 AAACTTAAAAAGAAGAAAGTGGG - Intronic
1010723019 6:79305007-79305029 AAAGGTAAAGAAAGGCAGGTTGG + Intergenic
1011010727 6:82701231-82701253 AAAAGAAAAAAGAAGCAGGAAGG - Intergenic
1011017682 6:82775728-82775750 AAAGGTCAAAAGAAGGTGATAGG + Intergenic
1011199052 6:84814643-84814665 AAGTGTAAAAAAAAGGAGGGGGG - Intergenic
1011222789 6:85074152-85074174 AAAGGAAAAACAAAGTAGGTGGG + Intergenic
1011292580 6:85792058-85792080 AAAGAAAGAAAGAAGGAGGCTGG - Intergenic
1012056924 6:94424934-94424956 AAAGGAAAATGGAAGGAGGAAGG - Intergenic
1012555477 6:100506112-100506134 AAATGTAACAAGAAAGAGGAAGG + Intergenic
1012604886 6:101145493-101145515 AAAGGAAAAAAACAGGAGGATGG - Intergenic
1012660673 6:101886801-101886823 AAAGGTAGAAAGAAGAATGGTGG - Intronic
1012848262 6:104417219-104417241 AAAGGAAAAGAGATGGAGGTAGG - Intergenic
1013444813 6:110213787-110213809 AAAGGTGAAAAGAAGGGGCTGGG - Intronic
1013533376 6:111040726-111040748 AAATGAAAAAAGAAGGAGGAAGG + Intergenic
1013554319 6:111240874-111240896 AAAAAAAAAAAAAAGGAGGTGGG - Intergenic
1013564993 6:111349502-111349524 AAATATAGAAAGAAGGAGGGAGG - Intronic
1013591929 6:111626097-111626119 AAAAGAAAAAAAAAGAAGGTTGG + Intergenic
1013599645 6:111692267-111692289 AAAGGCTAAAAGAACAAGGTTGG + Intronic
1013623881 6:111918300-111918322 GAAGGAAAAAAGAAAGAGGAAGG - Intergenic
1013828367 6:114242866-114242888 AAAAAAAAAAAGAAGAAGGTGGG + Intronic
1013956615 6:115849324-115849346 AAAGGTGCAAAGAAGCAGGTTGG - Intergenic
1014092958 6:117426258-117426280 AGAGTTAAAAACAAGGAAGTTGG + Intronic
1014370222 6:120597409-120597431 AAAGGTTAAAAGAATGATGAGGG + Intergenic
1014545698 6:122733045-122733067 CAGGGAAAAAAGAAGGTGGTGGG - Intergenic
1014748460 6:125228218-125228240 AAAGGAAAGAAGAGGGAGGGAGG + Intronic
1014896476 6:126906186-126906208 AAAGGCAATAAGAAAGTGGTGGG - Intergenic
1015144686 6:129972399-129972421 AAAGGTAGAAAGGAGGAGTTTGG + Intergenic
1015261772 6:131246253-131246275 AAAACTAAAAAGTATGAGGTGGG - Intronic
1015304956 6:131697106-131697128 AAGGGTAAAGAGAAGGAGGCAGG + Intronic
1015308796 6:131741700-131741722 AAAGGCAGAAAGAGGAAGGTTGG + Intronic
1015562357 6:134530276-134530298 AAAAGTAAAATGGAGGAGATGGG + Intergenic
1016321866 6:142855073-142855095 AAAGGTAAAGAGAAGGGAATTGG + Intronic
1016959361 6:149656756-149656778 AGAGGTAAAAAGCAAGTGGTGGG + Intergenic
1017142533 6:151204744-151204766 AAAGGTAAGAGAAAGGAGGAGGG - Intergenic
1017200469 6:151748416-151748438 AAGAGTAAAAAGAATGAGGCAGG - Intronic
1017567097 6:155699258-155699280 AAAGAGAAAAAGAAGAAGGAAGG - Intergenic
1017924492 6:158899041-158899063 AAAGTTAAAAAGCAGGGGGATGG - Intronic
1017999099 6:159562982-159563004 CAAAATAAAAAGAAAGAGGTTGG + Intergenic
1018825147 6:167403317-167403339 AAAGGAAAGAAGAAGGAAGGAGG + Intergenic
1019231810 6:170572290-170572312 AAAAAAAAAAAGAAGGGGGTGGG - Exonic
1019325084 7:434012-434034 AAAGGAAAAAGGAAGGAAGGGGG + Intergenic
1021139367 7:17004808-17004830 AAAGTCAGAGAGAAGGAGGTTGG - Intergenic
1021184683 7:17550028-17550050 AAAGGTAAAAATAAGTATATGGG + Intergenic
1021348771 7:19562159-19562181 AAAGGGAACAAAAAGTAGGTGGG + Intergenic
1021352276 7:19609880-19609902 AAAGAAAAAAGGAAGGAGGAAGG - Intergenic
1021962348 7:25885402-25885424 GAAGGAAAAAAAAAGGAGGGAGG - Intergenic
1022028493 7:26470024-26470046 AAAGGAAGAAAGAAAGAGGAAGG + Intergenic
1022317465 7:29258857-29258879 AAAGATAGAAAGATGGAAGTGGG - Intronic
1022426718 7:30276319-30276341 AAAGGCAAGAAGGCGGAGGTTGG - Intergenic
1022618795 7:31960459-31960481 AAAGGTGAAAAGGAGAAGGGAGG + Intronic
1023178073 7:37452937-37452959 AAAGACAAAAGGAAGTAGGTTGG + Intergenic
1023224633 7:37956314-37956336 AGAAGAAAAAAGAAGGATGTAGG + Intronic
1023577814 7:41648254-41648276 TAAGGGAAATGGAAGGAGGTGGG - Intergenic
1024125738 7:46292765-46292787 AAAGGTACAAAGAAAGCGGGAGG - Intergenic
1024236254 7:47401450-47401472 AGAGATACAAAGAAGGAGGAAGG + Intronic
1024283188 7:47736233-47736255 AAAGAAAGAAAGAAGGAGGGAGG - Intronic
1024360925 7:48467338-48467360 AAAGCTGAAAAGAATGAAGTAGG + Intronic
1025263638 7:57438874-57438896 AAAGAAAAAAAAAAGGAGGCAGG - Intergenic
1025264918 7:57448956-57448978 AAAAGTAAAAAGAAAAAGGTGGG - Intergenic
1025280086 7:57620551-57620573 AAAGGAAAAGTGAAGGAGGATGG - Intergenic
1025304647 7:57844950-57844972 AAAGGAAAAGTGAAGGAGGATGG + Intergenic
1025307290 7:57873029-57873051 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1025475024 7:60908470-60908492 ATAGGAAAAAAGAAGGAGTTAGG + Intergenic
1025481393 7:60988141-60988163 AAAAGAAAAAAGGAGGAGGGGGG - Intergenic
1025742073 7:64205919-64205941 AAAAGTAAAAAGAAAAAGGTGGG - Intronic
1026149200 7:67773729-67773751 AAAGGGAGAAAGAGGGAGGGAGG - Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026264682 7:68785869-68785891 AAAAAAAAAAAGAAGAAGGTTGG + Intergenic
1026638887 7:72107031-72107053 AAAGAAAGAAAGAAGGAGGAAGG + Intronic
1026821520 7:73552786-73552808 AAAGAAAAAAAAAAGGATGTGGG + Intronic
1026875677 7:73877784-73877806 AAAAAGAAAAAGAAAGAGGTCGG - Intergenic
1026915342 7:74116695-74116717 AAAGAAAAAAAAAAGGAGGAAGG - Intronic
1027357407 7:77371413-77371435 AAAAGAAAAAAGATGGAGGACGG - Intronic
1027412522 7:77936121-77936143 TAATGTAAAAAAAAAGAGGTGGG - Intronic
1027454952 7:78378226-78378248 AAAGGTAAAAAGAATCAGAGAGG + Intronic
1027463001 7:78478715-78478737 AAAGGTGGAAAGAAGAAGGCAGG + Intronic
1027925615 7:84459060-84459082 AAAATTAAAAAGCAGGAGCTGGG - Intronic
1028262785 7:88685654-88685676 AAAGAAAGAAAGAAGGAGGATGG - Intergenic
1028344759 7:89765691-89765713 AAAAGCAAAAATAAGGAAGTGGG - Intergenic
1028881119 7:95880956-95880978 AAAGATAAAAAAATGGAGGGAGG - Intronic
1029910835 7:104145714-104145736 AAAGGTAGAAAGAGGTAGGTGGG + Intronic
1029912620 7:104170889-104170911 AGAGGTAAAAATAATCAGGTAGG - Intronic
1030178137 7:106676019-106676041 AAAGTTAAAAAAAAGGGGGCTGG + Intergenic
1030874202 7:114793177-114793199 AAAAGTAAAAAGAAGAAGAAAGG + Intergenic
1030977524 7:116145093-116145115 TAAGGTAAAAGGAAAAAGGTGGG - Intronic
1031007990 7:116496618-116496640 AAAGGGAAAAGAAAGGGGGTGGG - Intronic
1031050608 7:116941265-116941287 AAAAAGAAAAAAAAGGAGGTGGG - Intergenic
1031317334 7:120273574-120273596 GAAGGTGAAAAGGAGGAGGGAGG + Intergenic
1031680852 7:124673063-124673085 AAAGGTACAAGGAAGGAGGCAGG - Intergenic
1031705258 7:124972945-124972967 ACAGGCAAAAAAAATGAGGTCGG + Intergenic
1031834546 7:126667649-126667671 AAAAGGAAAAAGAATGATGTAGG + Intronic
1031926751 7:127646254-127646276 AAAGAAAAAAAAAAGGAGGAGGG + Intergenic
1032186220 7:129728968-129728990 AAAGGTAAAAAAATAGAAGTAGG - Intronic
1032429404 7:131848730-131848752 AAAGGGAAATAGCAGGAGGAAGG - Intergenic
1032432697 7:131874736-131874758 ATAGGTTAAAAGAAGGATGTGGG + Intergenic
1032813010 7:135441976-135441998 AATGGTAAAAGGTAGGAGGAGGG + Intronic
1033039071 7:137901890-137901912 AAAGAAAAATAGAAGGAGCTGGG + Intronic
1033263662 7:139865837-139865859 AAAGGAAGAAGGAAGGAGGGAGG + Intronic
1033321094 7:140340282-140340304 AAAAAAAAAAAGAATGAGGTTGG - Intronic
1033858670 7:145597553-145597575 AAAGGAAAAAAGAATAAGGATGG - Intergenic
1033920977 7:146391363-146391385 AAAGATAAAAAGCAGATGGTTGG - Intronic
1033982610 7:147184702-147184724 AAAGGGAAAAAGAGAGAAGTTGG + Intronic
1034042505 7:147894327-147894349 AAAGGAAGAGAGAAGGAAGTAGG + Intronic
1034657346 7:152740130-152740152 AAAGAAGAAAAGAAGGAGGGAGG - Intergenic
1034713840 7:153220941-153220963 CAAGAAAAAAAGGAGGAGGTAGG - Intergenic
1035480761 7:159181210-159181232 AAAGGAGAAAAGAAAGAGATTGG - Intergenic
1035823747 8:2622260-2622282 AAAGGAAGAAAGAGGGAGGGAGG - Intergenic
1035853664 8:2948440-2948462 AAAGCTATAAAGAAGGAAGGAGG + Intronic
1036197729 8:6735262-6735284 AAAGGTAGAAAGAAGGATGTGGG + Intronic
1036449482 8:8853303-8853325 AAAGGTAGAAAGGGGCAGGTAGG - Intronic
1037091698 8:14927589-14927611 AAAGGAAAAACCAAGGAGGAAGG + Intronic
1037458573 8:19086360-19086382 AAAGGAAGAAAGAAGGAAGGAGG + Intergenic
1037614316 8:20503829-20503851 AAAGTTAAAAGCAAGGAGTTAGG + Intergenic
1037714915 8:21389148-21389170 AAAAATAAAAAGAATGAGGGGGG - Intergenic
1037754682 8:21703249-21703271 AAGGAGAAAAAGAAGGGGGTGGG + Intronic
1038981171 8:32761108-32761130 AAAGGTAAAATGAAGAATGGAGG + Intronic
1039023612 8:33233946-33233968 AAAGGAAAAAACAAGGATTTCGG + Intergenic
1039212568 8:35234531-35234553 AAAGGCAAAAAAAAGGGGGATGG - Intergenic
1039456797 8:37712596-37712618 ACAGGGAAACAGAAGGAGGTGGG - Intergenic
1039867910 8:41521764-41521786 AATTGTAAAAAGAAGGAAGGAGG + Intergenic
1040026156 8:42784710-42784732 AAAGGAAAAAGGAAAGAGGAGGG + Intronic
1040450831 8:47545051-47545073 AAAGATAAAAAGAAAGACTTTGG - Intronic
1040618471 8:49063422-49063444 AAAGATATAAAGAATGAGCTGGG + Intronic
1040662580 8:49593308-49593330 AAATTTAAAAAGAAGCAAGTTGG + Intergenic
1040700898 8:50064388-50064410 CAAGGTAAGCAGAAGGAGATGGG - Intronic
1041131424 8:54706261-54706283 AAAAGTAAACAAAAGGAGGTTGG - Intergenic
1041440980 8:57896754-57896776 AAAGGTAAAGAGAAGTAGCCAGG - Intergenic
1041626495 8:60034778-60034800 AGAGATAAAGAGAAGGAGGTAGG - Intergenic
1042108981 8:65358951-65358973 AAAATTCAAAAGAATGAGGTGGG - Intergenic
1042456607 8:69012347-69012369 AAAGCTAAAAAGAAAGGGATGGG - Intergenic
1042522277 8:69726488-69726510 AAAAAAAAAAAAAAGGAGGTAGG - Intronic
1042536115 8:69860426-69860448 AAGGGTATAAAGGTGGAGGTGGG + Intergenic
1042590419 8:70392983-70393005 AAAGGAAATAGGAAGGAGATGGG + Intronic
1042676690 8:71329258-71329280 ACGGGTAGAAAGAAGAAGGTAGG - Intronic
1043882501 8:85561340-85561362 AAAAGTAAAAAGAAACAGGTAGG - Intergenic
1044044371 8:87412795-87412817 AGAGGAGAAAAGAGGGAGGTAGG + Intronic
1044365384 8:91339255-91339277 AATGGTAAACTTAAGGAGGTGGG + Intronic
1044644538 8:94424517-94424539 AAAGGTAAAAACAAGATCGTTGG + Intronic
1044826783 8:96206028-96206050 AAAGGAAAAATTAAGTAGGTAGG - Intergenic
1044833864 8:96277067-96277089 GAAGGTATAAACAAGGAGGATGG + Intronic
1044955336 8:97474378-97474400 AAATATAAAAAGGAGGAGGGTGG - Intergenic
1044968686 8:97598516-97598538 CAATGAAAAAGGAAGGAGGTTGG - Intergenic
1045682732 8:104679944-104679966 AAAGAAAAAAAGAAGGAGGAAGG - Intronic
1045748289 8:105450982-105451004 AAAGAAAAAAAAAAGTAGGTTGG + Intronic
1045975604 8:108127846-108127868 AAAACAAAAAAGAAGGAGGAAGG + Intergenic
1046027564 8:108744008-108744030 AGAGAATAAAAGAAGGAGGTGGG + Intronic
1046420613 8:113979093-113979115 GAAAGTAAACAGAAGGAAGTAGG - Intergenic
1047132332 8:122035439-122035461 AATGGGAAAAAGAGGGAGGGAGG + Intergenic
1047186245 8:122635963-122635985 TAAGGGAAAAAGAAAGAGGGAGG + Intergenic
1047319361 8:123765068-123765090 AAGGGTAAAAACTGGGAGGTGGG + Intergenic
1047517097 8:125564430-125564452 CCAGGTAGCAAGAAGGAGGTGGG + Intergenic
1047744889 8:127837319-127837341 AAAGGAAAAAAGAAGGCCGGGGG + Intergenic
1048072515 8:131037651-131037673 AGAAGGAAAAAGAAGGAGGAAGG + Intronic
1048081256 8:131130244-131130266 AAATGTATATGGAAGGAGGTTGG - Intergenic
1048220440 8:132536282-132536304 AGACGTAATAAGTAGGAGGTTGG - Intergenic
1048580660 8:135727725-135727747 AAAGGAAGAGAGAAGGAGGGAGG + Intergenic
1049210764 8:141385445-141385467 GAAGGGAAAAAGAGGGAGGGAGG - Intergenic
1049470157 8:142771689-142771711 AAAGGTCAAAAGAAGCAGAGAGG - Intronic
1049470426 8:142772883-142772905 AAAGGTGGACAGAAGGAGGCAGG + Intronic
1049558301 8:143294780-143294802 CAAGGTAAAAGGAATGAGCTGGG + Intronic
1050250920 9:3744017-3744039 AGAGGACAAAAGAAGGAAGTAGG - Intergenic
1050737321 9:8779041-8779063 AAAGGGAAAAAGAAGGTGGAGGG + Intronic
1050759144 9:9044751-9044773 AAAGGTAAAAGGGAAGAAGTTGG - Intronic
1051040089 9:12798481-12798503 AAAGGTGAAAAGAATGAAGAAGG - Intronic
1051059383 9:13028508-13028530 AAAGGTATAATGAAGGAGTTAGG - Intergenic
1051113292 9:13664834-13664856 AAAAGAACAAAGCAGGAGGTGGG + Intergenic
1052425580 9:28300618-28300640 AAAGGTAGAAAGAAGAAAGCAGG - Intronic
1052958132 9:34270753-34270775 AAAGGTAAAAATTAAGTGGTAGG - Intronic
1052994482 9:34543683-34543705 AAAAGAAAAGAAAAGGAGGTTGG + Intergenic
1053512221 9:38697435-38697457 AAGGAGAAAAAGAAGGAGTTAGG - Intergenic
1053943951 9:43285582-43285604 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1053946612 9:43315593-43315615 ATAGGAACAAAGAAGGAGTTAGG + Intergenic
1054360655 9:64112465-64112487 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1055095257 9:72406629-72406651 AAAGTTTTAAAGAAGCAGGTAGG - Intergenic
1055261817 9:74445748-74445770 AAATGTAAATAGAATAAGGTTGG + Intergenic
1055327605 9:75147864-75147886 AAATGTATGAAGAAGGAAGTGGG + Intergenic
1055442605 9:76351664-76351686 AAAGAAAGAAAGAAAGAGGTAGG + Intronic
1055703454 9:78971818-78971840 AATGGAGAAAAGAAGGAGGGAGG + Intergenic
1055723135 9:79197979-79198001 AAGGGGAAAAGAAAGGAGGTAGG - Intergenic
1055849243 9:80605762-80605784 AAAAATGAAAAGGAGGAGGTTGG - Intergenic
1055972971 9:81930190-81930212 AAAAAAAAAAAGAAGGCGGTGGG - Intergenic
1055974724 9:81945262-81945284 AAAAAAAAAAAGAAGGCGGTGGG - Intergenic
1056165547 9:83937409-83937431 GAAGGGAAGAAGAAGGAGGAGGG + Intergenic
1056467546 9:86872770-86872792 AAAGGTAAAGGGAAGCAGCTGGG - Intergenic
1056490973 9:87106840-87106862 ATAGACAAAAAGAAGGAGGGAGG + Intergenic
1056525232 9:87437190-87437212 AAAGGTAAAAAGATCCAGGACGG + Intergenic
1056691300 9:88810863-88810885 AAAGAAAAAAACAAGGAGGAAGG - Intergenic
1056783506 9:89570353-89570375 GAAGGTAAAAAAAACTAGGTTGG - Intergenic
1057065428 9:92045265-92045287 AAAGGCAAAAAGAAAGACCTCGG + Intronic
1057113222 9:92494369-92494391 ACAGGTAAAAACAAGAAGATAGG - Intronic
1057169088 9:92950114-92950136 AAGGATAAAAAGAAGCAGGTGGG + Intronic
1057223678 9:93273012-93273034 AAAGGTCAAAAGAAAAAGGATGG + Intronic
1057752370 9:97803313-97803335 AAAATTAAAAGGAAGGAGATGGG + Intergenic
1058354759 9:104071204-104071226 AATGACAAAAAGAGGGAGGTAGG + Intergenic
1058914200 9:109549951-109549973 AAAGGGAAAAAGGTGGATGTAGG + Intergenic
1059302556 9:113326462-113326484 AAAGAAAGAAAGAAGGAGGGAGG - Intronic
1060091579 9:120747914-120747936 AAAGGGAAGAAGTAGGAAGTAGG - Intergenic
1060675433 9:125510167-125510189 AAAGGTAAAAAGTAGGAAGGGGG + Intronic
1060938934 9:127532305-127532327 AAAAGTAAAAAGATGGAGGGGGG + Intronic
1061057155 9:128229913-128229935 AAAGGAAAAAAAAGGGAGGGTGG + Intronic
1061082732 9:128381989-128382011 AAAGAGAAAGAGAAGGAGGGAGG + Intronic
1061751871 9:132784148-132784170 AAAGAGAAAGAGAAGGGGGTAGG + Intronic
1061758439 9:132832867-132832889 AAATCTAAAAGGAAGAAGGTGGG + Intronic
1062050638 9:134444754-134444776 GAAGGAGAAAAGAAGGAGGGAGG - Intergenic
1062515258 9:136930645-136930667 AAAGAAAAAAGGAAGGAGGGAGG - Intronic
1062705465 9:137937647-137937669 AAAGTTAAGATGAAGGAGGCTGG + Intronic
1203693930 Un_GL000214v1:76895-76917 AATAGTAAAAAGAATGAGGTAGG - Intergenic
1203731433 Un_GL000216v2:94994-95016 AAAGGTAATAAGGAGGATTTGGG - Intergenic
1203446734 Un_GL000219v1:63742-63764 AAAGGAAAAAAAAAGGAGGGAGG - Intergenic
1203705613 Un_KI270742v1:40536-40558 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1203558382 Un_KI270744v1:25275-25297 AATAGTAAAAAGAATGAGGTAGG - Intergenic
1203581542 Un_KI270746v1:10851-10873 AAAGTTAAAAAAAAAAAGGTGGG - Intergenic
1203582215 Un_KI270746v1:19454-19476 AAAAGTAAAAAGGTGGAGGAGGG - Intergenic
1203587086 Un_KI270747v1:14159-14181 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1203589742 Un_KI270747v1:44151-44173 ATAGGAACAAAGAAGGAGTTAGG + Intergenic
1203642343 Un_KI270751v1:27168-27190 AATAGTAAAAAGAATGAGGTAGG + Intergenic
1203652040 Un_KI270751v1:134584-134606 ATAAAAAAAAAGAAGGAGGTTGG + Intergenic
1185730202 X:2455449-2455471 AAAAGTAAAAACAAGTAGGCCGG + Intronic
1185773720 X:2785651-2785673 AAAGGAAAAATGAAGCTGGTTGG + Intronic
1185804516 X:3045146-3045168 AAAGAGAAAAATAAAGAGGTGGG + Intronic
1185943118 X:4343461-4343483 CAAGGTAAAAAGAAAGAAATTGG - Intergenic
1185966470 X:4610683-4610705 GAAAGGAAAAAGAAGGAGGAAGG + Intergenic
1186366851 X:8904537-8904559 GAAGGAAAAGAGGAGGAGGTTGG - Intergenic
1186601096 X:11038259-11038281 AAAGGGACAAAAAAGGAAGTGGG - Intergenic
1187138645 X:16572057-16572079 AAAAGTAAAAAGAAACAGGTGGG - Intergenic
1187362979 X:18645199-18645221 AAAGGAAAAAAGGAGGTGGCGGG - Intronic
1187687217 X:21827487-21827509 AAAAAAAAAAAAAAGGAGGTGGG + Intergenic
1187868748 X:23747129-23747151 AAAGGTAAAAAAAATGAGCAGGG + Intronic
1187993747 X:24903865-24903887 AAAAGTAAACAGTAGCAGGTAGG + Intronic
1188205908 X:27358317-27358339 AAAGGTGAAGAGAAGAAGGTAGG + Intergenic
1188286214 X:28328041-28328063 ATAGGTAAACAGTAGGGGGTGGG + Intergenic
1188574343 X:31628405-31628427 AAAGACAAAAAGAAGGGGATTGG + Intronic
1188851333 X:35136351-35136373 AATGGAAAAAAGAAAGAAGTAGG - Intergenic
1188919051 X:35948942-35948964 AGAATTAAAAAGATGGAGGTGGG + Intronic
1188995987 X:36886746-36886768 AAAGGTAACAAGAATTGGGTTGG - Intergenic
1189235458 X:39483671-39483693 AAAGGTGACGATAAGGAGGTGGG - Intergenic
1189444517 X:41068096-41068118 AAAGTTAAAAAGAAAGAGTTGGG - Intergenic
1189580664 X:42403106-42403128 TCAGGTTAAAACAAGGAGGTCGG - Intergenic
1189624627 X:42883232-42883254 AAAAGAAAAAAAAAGGTGGTGGG + Intergenic
1189644366 X:43110657-43110679 AAATATAAAAAGAAGAAAGTTGG + Intergenic
1189752594 X:44237782-44237804 AAAGGAGCAAACAAGGAGGTAGG - Intronic
1189864744 X:45314951-45314973 AAAGGCAAAAACAAACAGGTGGG + Intergenic
1189875835 X:45434790-45434812 AAAGGTAAAGAGGGGGAGGTGGG - Intergenic
1189956444 X:46279510-46279532 AATGGTGAAGAGATGGAGGTCGG + Intergenic
1190261980 X:48802934-48802956 AAAGGCAAAATGAAGAAGCTCGG + Exonic
1190689400 X:52900988-52901010 AAATGAAACAAGAAGGATGTGGG - Intronic
1190696583 X:52954804-52954826 AAATGAAACAAGAAGGATGTGGG + Intronic
1190825334 X:54012955-54012977 AAAGGTAAAAAAAATTAGCTGGG + Intronic
1190830679 X:54056566-54056588 AAATTTAAAATTAAGGAGGTTGG - Intergenic
1191062507 X:56314625-56314647 AAAAAAAAAAAAAAGGAGGTGGG - Intergenic
1191910789 X:66147221-66147243 AAAGATAGAAAGAAGAAGGTAGG - Intergenic
1193417289 X:81240259-81240281 AAAGTTAAAAAGCAGGTGGATGG + Intronic
1193450799 X:81662708-81662730 AAAGGGAAAAAGAAGAAATTAGG + Intergenic
1193701643 X:84769904-84769926 GAGGGTAAAAAGGAGGTGGTAGG - Intergenic
1193803133 X:85961429-85961451 AAAAAAAAAAAAAAGGAGGTAGG + Intronic
1194140506 X:90203448-90203470 AAAGGAAGAAAGAGGGAGGGAGG - Intergenic
1194268913 X:91785213-91785235 AAAGAAAAAAAGGAGGAGGGGGG - Intronic
1194358194 X:92915007-92915029 AAAGTTAAAAAGCTGGGGGTGGG - Intergenic
1195022689 X:100845774-100845796 AAAGGTGAAAAGAATTAGCTGGG - Intronic
1195548199 X:106137481-106137503 AAAAGTAAAAAATAGGAGCTGGG + Intergenic
1195745024 X:108108319-108108341 ACAGGTAAATAGAAGGAGGCAGG - Intronic
1195863517 X:109406348-109406370 AAGGGTGAAAACTAGGAGGTAGG + Intronic
1195922951 X:110001651-110001673 ATCGGTAAAAAGCAGCAGGTAGG + Intergenic
1195986580 X:110637123-110637145 AAAAGTAACAGGGAGGAGGTAGG + Intergenic
1196344735 X:114640931-114640953 AAAGAAAGAAAGAAGGAGGGAGG - Intronic
1196362839 X:114886877-114886899 ACAGCTAAAAAGATGTAGGTGGG - Intronic
1196821823 X:119707695-119707717 AAATGTAAAAAGAAGGGAGCAGG - Intergenic
1196834516 X:119802066-119802088 AAAGAGAAAAAGGAGGAGGAAGG - Intergenic
1197209438 X:123816792-123816814 AAAAAAAAAAAGAAGGAAGTTGG + Intergenic
1197249622 X:124201517-124201539 AAATGTCAGAATAAGGAGGTTGG + Intronic
1197372352 X:125640418-125640440 AAAGGTAAAAAGGCGGATGGCGG + Intergenic
1197457149 X:126691166-126691188 AAAGTAAAATAGGAGGAGGTTGG + Intergenic
1197849694 X:130844405-130844427 AAAGAGAAAGAGAAGGAGGAAGG + Intronic
1198019679 X:132645547-132645569 AATGTTAAATGGAAGGAGGTGGG - Intronic
1198209528 X:134504110-134504132 AAAGCTAAAAAGAAGAAGAGTGG - Intronic
1198394617 X:136208946-136208968 GAGGGTAGAAAGAAGGGGGTGGG + Intronic
1198432811 X:136584768-136584790 AGAGCTAAAAAGGAGGGGGTGGG - Intergenic
1198508117 X:137321528-137321550 CAAGGAAAAAAGAAGAAAGTAGG - Intergenic
1198520483 X:137447491-137447513 AGAGGAAAAAAGAAAGAGGCCGG + Intergenic
1198854278 X:140999962-140999984 AAAGGAATAAAGAAAGAGGAAGG + Intergenic
1198877736 X:141245167-141245189 AAAGGAATAAAGAAAGAGGAAGG - Intergenic
1198908369 X:141587031-141587053 AAAGGAATAAAGAAAGAGGAAGG + Intronic
1198921745 X:141736600-141736622 AAATGAAAAAAGAAGGAATTTGG - Intergenic
1199695735 X:150341705-150341727 AAAGGGAAAGAGAGGGAGGGGGG - Intergenic
1199912471 X:152302127-152302149 AAAGATAAATATAAGGATGTGGG + Intronic
1200009381 X:153109635-153109657 AAAGGGAAAAAGCCTGAGGTGGG + Intergenic
1200030219 X:153290287-153290309 AAAGGGAAAAAGCCTGAGGTGGG - Intergenic
1200312841 X:155097134-155097156 AAAGGAAAAAAGAAACGGGTGGG + Intronic
1200486252 Y:3772411-3772433 AAAGGAAGAAAGAGGGAGGGAGG - Intergenic
1200586128 Y:5006225-5006247 AAAGAAAAAAAGGAGGAGGGGGG - Intronic
1201171978 Y:11275858-11275880 AAAAAAAAAAAGAAGGAGGTTGG + Intergenic
1201195071 Y:11485296-11485318 AAAAGTAAAAAGGAGGAGGAGGG + Intergenic
1201235371 Y:11905147-11905169 AAAGGAAAAGGGAAGGAGGGAGG + Intergenic
1201547047 Y:15177112-15177134 AAATGAAAAAAGAAAAAGGTAGG - Intergenic
1201741302 Y:17326645-17326667 AAAGGAAGAAAGAAGAAGGAAGG + Intergenic
1202169699 Y:22030121-22030143 AAAGGAAAAAAGATGTGGGTAGG - Intergenic
1202221667 Y:22556252-22556274 AAAGGAAAAAAGATGTGGGTAGG + Intergenic
1202321452 Y:23639422-23639444 AAAGGAAAAAAGATGTGGGTAGG - Intergenic
1202549315 Y:26030634-26030656 AAAGGAAAAAAGATGTGGGTAGG + Intergenic