ID: 1081885238

View in Genome Browser
Species Human (GRCh38)
Location 11:46489743-46489765
Sequence GACAGCTTCCTGGTAATTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 103}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081885238_1081885241 10 Left 1081885238 11:46489743-46489765 CCAGTAATTACCAGGAAGCTGTC 0: 1
1: 0
2: 1
3: 9
4: 103
Right 1081885241 11:46489776-46489798 CTTCTTATTTCACTTTTATGAGG 0: 1
1: 0
2: 1
3: 41
4: 553

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081885238 Original CRISPR GACAGCTTCCTGGTAATTAC TGG (reversed) Intronic
903816417 1:26067325-26067347 GACATCTTCCAGGTAAGTGCCGG - Exonic
906795505 1:48693559-48693581 GAGAGCTTCCTGCTGATTCCAGG - Intronic
908531990 1:65042634-65042656 GACAGGTACCTAGTACTTACTGG - Intergenic
912374339 1:109198239-109198261 CCCAGCTTCCTGGATATTACTGG + Intronic
917459237 1:175214834-175214856 AAGAGCTTCCTGGTAACTGCTGG + Intergenic
918103003 1:181392785-181392807 TCCAGCTTCCTGTTAATTAGGGG - Intergenic
919881884 1:201906390-201906412 GACAGCTTCATGGGAAATGCAGG - Intronic
922353692 1:224756509-224756531 GACAGATTCCTGGTCATAGCTGG + Intergenic
923073842 1:230591675-230591697 GACAACTTCCTGCAAATTTCTGG - Intergenic
1063610263 10:7555915-7555937 GATGGCTTCCTGGGAATTTCTGG - Intergenic
1067126993 10:43527025-43527047 GTCAGCCTCCAGATAATTACAGG - Intergenic
1072432825 10:95388681-95388703 TACAGCTTCCTGCAAATCACTGG - Intronic
1072724777 10:97805789-97805811 GACAGCTTCCTGGGAAGCACAGG - Intergenic
1076711305 10:132336348-132336370 GAAAGCATCCTGGCAATCACAGG - Intronic
1081885238 11:46489743-46489765 GACAGCTTCCTGGTAATTACTGG - Intronic
1088478860 11:110273093-110273115 CTCAGCTTCCTGGAAATAACAGG - Intronic
1089364089 11:117910465-117910487 GACAGCTTCCTTGGAATAAAAGG + Intronic
1092228166 12:6762380-6762402 GACATCTTCCCAGTAGTTACTGG + Intronic
1095932933 12:47647367-47647389 GACAGCTTCTTGGGAATAAGAGG + Intergenic
1100502846 12:95191134-95191156 GACAGTTTCTTGGTTAGTACAGG - Intronic
1105469273 13:20677530-20677552 ATCAGCTTCCTGGTAATAAGAGG + Intronic
1113505167 13:110811742-110811764 GGGAGCTTCCTGGGAATTTCAGG - Intergenic
1115510558 14:34133901-34133923 GGCACCTTCCTGGTAATGATAGG + Intronic
1120106268 14:80498830-80498852 CACAGCCTCCTAGTAAATACTGG + Intronic
1125445183 15:39746636-39746658 AACAGCATCCTGGTAATCAATGG + Intronic
1125628228 15:41126641-41126663 GCCAGCTTCCTGGTAAGGGCAGG - Intergenic
1126061421 15:44786274-44786296 GACAGCTCCCTGGTAACATCTGG - Intergenic
1139135541 16:64199883-64199905 GTCAGTTTCCTGGTAGTTTCTGG - Intergenic
1139825420 16:69753389-69753411 GACATCTTTCTGTTAATTTCAGG - Intronic
1145405574 17:22587796-22587818 CACAGCTTTCTGGTAAGTTCAGG + Intergenic
1151364736 17:73609877-73609899 GACAGCTGCCTGTTGATTGCTGG - Intronic
1152902600 17:82952096-82952118 CACAGCTTTCTGGCAACTACTGG - Intronic
1153924522 18:9824113-9824135 TACAGTTTTCTGGGAATTACAGG - Intronic
1158422777 18:57310908-57310930 GACTGCTTCCTGGAAGTTACTGG + Intergenic
1161738309 19:6005307-6005329 GAGAGCTGCCTGGTACTAACGGG + Intronic
1164453266 19:28384916-28384938 GAAAGCTTCCTGCTAAGTAAGGG - Intergenic
1164511547 19:28901217-28901239 ATCAGATTCCTGGAAATTACTGG - Intergenic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
1166733784 19:45072694-45072716 GTCAGCTTCCTGGTCCTTCCAGG - Intronic
929693801 2:44097251-44097273 GGCAGCTTCTTGGTGATAACTGG + Intergenic
933260831 2:80129429-80129451 GACACCTTCATGGTCATCACGGG + Intronic
933968771 2:87452773-87452795 GACAGCTTCATGGTACTTTCTGG + Intergenic
935900688 2:107788939-107788961 GACATCTTCCTGGTAAATGCAGG - Intergenic
936325022 2:111497732-111497754 GACAGCTTCATGGTACTTTCTGG - Intergenic
939326636 2:140698967-140698989 GACAGCTTCCCAGTACTTACAGG - Intronic
941454388 2:165697857-165697879 GACAGGGTGCTGGTAATCACGGG - Intergenic
944107814 2:196098348-196098370 GAGAAATTCCTAGTAATTACAGG - Intergenic
1169394372 20:5216636-5216658 GACAGCAACCTGCTCATTACAGG - Intergenic
1172965267 20:38829858-38829880 GACAGCTCCCTCTTGATTACTGG - Intronic
1178760338 21:35396190-35396212 AAAAGCTTCCTGGTCATTGCTGG - Intronic
1179455743 21:41498610-41498632 CACAGCTTCCTGGTGAGAACTGG - Intronic
1179580693 21:42341992-42342014 GACAGCTTCCTGCGTGTTACTGG - Intergenic
1182292773 22:29294280-29294302 GACACTTTTCTGGTTATTACTGG + Intronic
1182456028 22:30451040-30451062 GACAGCTTGCAGGTGATTAGTGG + Intronic
950388110 3:12675601-12675623 GACACCCTCCTGGGATTTACTGG - Intergenic
952274717 3:31866241-31866263 GACTGCTTCCGGGGAATTAAAGG - Intronic
952385963 3:32841783-32841805 GGAAGCTTCCTGGTAAGTCCTGG - Intronic
956615621 3:71169067-71169089 GCCAGCATCCTGGAAGTTACTGG + Intronic
957975803 3:87443376-87443398 GACTGCTTCCTAGTAATTTGGGG + Intergenic
964829015 3:160862332-160862354 GATAGCTTCCTGGAAACTTCTGG + Intronic
966181844 3:177196329-177196351 GCCAGCTTCCTGGTAAGTTTTGG - Exonic
966649226 3:182280736-182280758 GACATTTTCCTGTTAAGTACAGG - Intergenic
966706381 3:182920462-182920484 GACACTTTCCTTGTGATTACTGG - Exonic
966937597 3:184722709-184722731 GAGAGCTTCCTGGTATTTCATGG + Intergenic
969226774 4:5803743-5803765 GAGAGCTTGCTGGCACTTACAGG - Intronic
969304081 4:6315398-6315420 GACCGCTTTCTGGTAACAACTGG + Intergenic
970435394 4:16029253-16029275 GCCAGCTTCCTGAAAATGACTGG + Intronic
970605023 4:17671448-17671470 CACAGCTTCCTGCTTCTTACTGG + Intronic
971997925 4:33991401-33991423 GACAGCTTCCTGGTAAATTCAGG - Intergenic
972655837 4:41062866-41062888 AAGAGCTTCCTTGCAATTACTGG + Intronic
974077374 4:57179712-57179734 AAAAGCTTCCCGGTAATCACGGG + Intergenic
974626670 4:64434476-64434498 GACACCTTCCTGGTCAATATGGG + Intergenic
975622082 4:76306267-76306289 GAGAGCTTCCTGGAACTTAGAGG - Intronic
975747503 4:77489127-77489149 GTCAGCTTCCTGGGAAGCACAGG - Intergenic
976274962 4:83266788-83266810 GACAGCTTCCTGCTCTCTACTGG + Intronic
980088778 4:128419586-128419608 GAGAGCTTCCTGTTTCTTACTGG + Intergenic
981551145 4:145942537-145942559 AACAGCTTCCTGATACTTATAGG + Intergenic
983646413 4:169996156-169996178 GACAGGTCCCTGGCAATTTCTGG - Intronic
984674336 4:182529629-182529651 GAGTGCTCCCTGGTTATTACAGG - Intronic
990121520 5:52460033-52460055 GACAGCTTCGTTGTTATTATGGG + Intergenic
992058083 5:73012964-73012986 GACAGTTTCCTCGGAATTAAGGG + Intronic
994147727 5:96413353-96413375 GGCAGCTACCTGGTTATTTCTGG + Intronic
996193693 5:120577513-120577535 GACACCTTCCTGATATTTTCAGG + Intronic
996562828 5:124849213-124849235 TTCAGCTTCCTGTTACTTACAGG + Intergenic
999596806 5:153214398-153214420 GCCAGCTTCCTGGTCAGTTCTGG - Intergenic
1003560573 6:7176520-7176542 GGCAGCTTGCTTGTAATTGCAGG + Intronic
1005075760 6:21905185-21905207 GGCATTTTCCTAGTAATTACAGG + Intergenic
1006142989 6:31942203-31942225 CACCGCCTCCTGGTGATTACAGG + Intronic
1007870331 6:45028578-45028600 GTCAGCTTCCTGTTAAATACGGG - Intronic
1016714280 6:147204973-147204995 AAAAGCTTCCAGGTTATTACTGG - Intronic
1019902100 7:4028972-4028994 GATGGCTTCCTGGGAATTACAGG - Intronic
1023821662 7:43984017-43984039 GACAGCCTCCTGGTAACCAAAGG - Intergenic
1023822604 7:43988377-43988399 GAAAGCTTCCTGGTTCATACCGG - Intergenic
1029749922 7:102537436-102537458 GACAGCCTCCTGGTAACCAAAGG - Intergenic
1029750866 7:102541792-102541814 GAAAGCTTCCTGGTTCATACCGG - Intronic
1029767872 7:102636542-102636564 GACAGCCTCCTGGTAACCAAAGG - Intronic
1029768820 7:102640903-102640925 GAAAGCTTCCTGGTTCATACCGG - Intronic
1031308308 7:120161795-120161817 GACAGCTTCTAGGTAGCTACAGG - Intergenic
1032512072 7:132480416-132480438 GACAGCTTCTTCCTAATCACGGG - Intronic
1036084350 8:5597712-5597734 CAAAGTTTCCTGGGAATTACCGG + Intergenic
1036441873 8:8788968-8788990 GATGGCTTCCTGGTGATCACAGG - Intronic
1039260693 8:35767933-35767955 GTCAGTTTCCAGGTCATTACAGG + Intronic
1039654861 8:39393029-39393051 GACAGGTTACTGGTAATTTGAGG + Intergenic
1041748462 8:61234115-61234137 GCCAGCTTCCTGGTAAATCCTGG + Intronic
1042652097 8:71054166-71054188 GAAAGCCTCCTGATATTTACTGG - Intergenic
1046750658 8:117923199-117923221 GCCAGCTACCTGGGGATTACAGG - Intronic
1049105271 8:140608822-140608844 AACAGCATCCTGGTAATGTCTGG + Intronic
1050037623 9:1454023-1454045 GAGAGCTTGCCGGTAATAACTGG - Intergenic
1055961523 9:81825114-81825136 GACAGCTTTCTTGTAGTTTCAGG + Intergenic
1058300194 9:103362068-103362090 GACAGCTGCCTGGGTATGACAGG - Intergenic
1194286565 X:92018556-92018578 GACAGCTATCTGGAAATTAATGG + Intronic
1197119644 X:122875261-122875283 GACAGCTTCCTTGTGAATTCAGG - Intergenic
1200604110 Y:5243113-5243135 GACAGCTATCTGGAAATTAATGG + Intronic
1201505542 Y:14695517-14695539 GACAGCTTGCTGGTACTGTCTGG + Intronic