ID: 1081906346

View in Genome Browser
Species Human (GRCh38)
Location 11:46672758-46672780
Sequence GTGGAGTCGCAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 378}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081906337_1081906346 20 Left 1081906337 11:46672715-46672737 CCATCCACTGTTTGACATTCCAG 0: 1
1: 0
2: 2
3: 13
4: 161
Right 1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG 0: 1
1: 0
2: 1
3: 33
4: 378
1081906338_1081906346 16 Left 1081906338 11:46672719-46672741 CCACTGTTTGACATTCCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 138
Right 1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG 0: 1
1: 0
2: 1
3: 33
4: 378
1081906336_1081906346 30 Left 1081906336 11:46672705-46672727 CCTGCTGTCACCATCCACTGTTT 0: 1
1: 0
2: 0
3: 18
4: 173
Right 1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG 0: 1
1: 0
2: 1
3: 33
4: 378
1081906341_1081906346 1 Left 1081906341 11:46672734-46672756 CCAGCTGGTGGCCAAGAGATTGG 0: 1
1: 0
2: 2
3: 11
4: 153
Right 1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG 0: 1
1: 0
2: 1
3: 33
4: 378
1081906344_1081906346 -10 Left 1081906344 11:46672745-46672767 CCAAGAGATTGGTGTGGAGTCGC 0: 1
1: 0
2: 0
3: 5
4: 105
Right 1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG 0: 1
1: 0
2: 1
3: 33
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081906346 Original CRISPR GTGGAGTCGCAGAAAGAGGA AGG Intronic
900482072 1:2904267-2904289 GTGGAGATGCAGACAGAGGCAGG + Intergenic
900614406 1:3558256-3558278 GTGGAGTGGGAGAGAGAGGAGGG - Intronic
901259070 1:7857948-7857970 ATGAAGTCTCACAAAGAGGAAGG + Intergenic
902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG + Exonic
902879950 1:19365420-19365442 GTGGATTTCCAGAAAGAGCACGG + Intronic
903424581 1:23244424-23244446 GTGGAGTCACAGCAAGTGGGAGG + Intergenic
903736046 1:25530467-25530489 GGGGAGTCGCAGACAGTGGCTGG - Intergenic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
904820182 1:33237652-33237674 GTGGAGTCGTTGGCAGAGGATGG + Intergenic
905120304 1:35676698-35676720 GTGGGGTCAGAGAAAGAGAAGGG + Intergenic
905980162 1:42218158-42218180 GTGGAGTCTGAGAAAGAGTGAGG - Intronic
906958408 1:50397160-50397182 CTGGTGTTGAAGAAAGAGGAAGG - Intergenic
907230084 1:52989452-52989474 GTGGAGCTGCAGAAAGAGGGAGG - Intronic
907594058 1:55703641-55703663 GAGGAGTGGAAGAGAGAGGAAGG + Intergenic
907898704 1:58717764-58717786 GTGGATTCTCAGAAAGAAAAAGG + Intergenic
908107993 1:60865625-60865647 GCAGAGTGGCAGAGAGAGGATGG - Intronic
909354378 1:74690613-74690635 GTGGACTCTGAGAAAGAAGAAGG + Intergenic
910073317 1:83245921-83245943 GTGGAATTTCAGGAAGAGGACGG - Intergenic
910943077 1:92558121-92558143 CAGGAGTCCCAGAAGGAGGAAGG - Intronic
911063414 1:93766635-93766657 GCGGACTCTAAGAAAGAGGAAGG - Intronic
911546319 1:99221967-99221989 ATGGACTCTTAGAAAGAGGAAGG + Intergenic
913462473 1:119102428-119102450 GTGAAGTCAAAGACAGAGGATGG - Intronic
914802526 1:150971995-150972017 CTGGAGTCGCAGAGGGAGGGTGG + Intronic
914825504 1:151135942-151135964 GTTGGGTCAAAGAAAGAGGAGGG + Intronic
915222438 1:154385695-154385717 GTGGAGCTCCAGGAAGAGGATGG + Intergenic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915514659 1:156405851-156405873 GAAGAGTTTCAGAAAGAGGAGGG + Intronic
918188141 1:182145593-182145615 GTGGGGAGACAGAAAGAGGAAGG + Intergenic
919058133 1:192596234-192596256 GTGAAGTGGCAGAAAGAAGTGGG + Intergenic
919846246 1:201644082-201644104 GGGGAGGTGCAGAAAGAGGCTGG - Intronic
920414736 1:205791423-205791445 GTGAAGTCCTAGAAAGAGGTGGG + Exonic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922183394 1:223253976-223253998 GTGGATTTGCAAAAATAGGAGGG + Intronic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
924433069 1:244013955-244013977 GTGGAATGGGAGAAAGAAGAAGG - Intergenic
924583912 1:245345297-245345319 GTGAAGTCGCAGAAGGAGGGAGG - Intronic
1063017777 10:2095704-2095726 GTGGAGGGACAGAGAGAGGATGG + Intergenic
1063928286 10:11002517-11002539 GTGGTGTCGTAGAAAGGGGCAGG + Intergenic
1064245457 10:13664353-13664375 ATGGAGTGTCAGAAAGAGGTTGG + Intronic
1065540705 10:26763925-26763947 GTGGAGCTCCAGAAGGAGGAGGG + Exonic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070589681 10:77792914-77792936 GGAGAGTCACAGAAAGATGATGG + Intronic
1070751193 10:78965031-78965053 GTCGAGTCTCAGAGAGGGGAAGG - Intergenic
1070809455 10:79290336-79290358 GAGGAGTGGAAGAGAGAGGAAGG - Intronic
1071284124 10:84128661-84128683 CTGGGGTTGTAGAAAGAGGAAGG - Intergenic
1071598226 10:86943123-86943145 GTGGACGCGCACAAAGCGGAGGG - Exonic
1074084067 10:110194217-110194239 GGGGATTTGGAGAAAGAGGATGG + Intergenic
1075349801 10:121713583-121713605 GTGGTGGCGCAGAAAGATGATGG - Intergenic
1075810667 10:125222519-125222541 GTGGACTCCCAGTAAGTGGATGG + Intergenic
1076221947 10:128740889-128740911 GTGGGGTGGCAGAAGGAGGCTGG + Intergenic
1076305013 10:129460038-129460060 GTGAGGATGCAGAAAGAGGATGG + Intergenic
1076672137 10:132128504-132128526 TTGGAATCCCAGAAAGAGAAAGG - Intronic
1077230529 11:1456474-1456496 GGGGAGGCGCAGAAGGAGAACGG + Exonic
1078092648 11:8276856-8276878 GTGGACATGCAGAGAGAGGATGG - Intergenic
1079047341 11:17117515-17117537 GAGGAGTAGCAGAAAAAGTAAGG - Exonic
1079100112 11:17535908-17535930 GTGGCGTAGCAGAAAGAACATGG - Intronic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1080863144 11:36167996-36168018 CGGGAGTCTAAGAAAGAGGAGGG - Intronic
1081155908 11:39690144-39690166 TTGGAGACTCAGAAAGGGGAAGG - Intergenic
1081773941 11:45665334-45665356 GCGGAGTCGGAGGAAGAGGAGGG - Exonic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1082767187 11:57179580-57179602 CTGGAATCGGAGACAGAGGAGGG - Intergenic
1083489201 11:63002648-63002670 GTGGAGTAGGAGAGGGAGGAAGG - Intronic
1083514790 11:63246810-63246832 GTGCAGTTGGAGACAGAGGAGGG - Intronic
1085012097 11:73148274-73148296 GTGGTGCCGCAGACAGGGGAAGG - Intergenic
1085916848 11:80900461-80900483 ATGGAGTTGCAGAGAGAGCAGGG + Intergenic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087304157 11:96469488-96469510 GTGGAGTAGAAAGAAGAGGAGGG + Intronic
1088418105 11:109612151-109612173 GGGGAATCCCAGAAATAGGAAGG + Intergenic
1089102325 11:115973952-115973974 CTGGAGTCACAGAAACTGGATGG - Intergenic
1089141601 11:116289128-116289150 GTGGTGTGGCAGAGAGGGGAGGG + Intergenic
1089945804 11:122472009-122472031 GTGAAGATGCAGAAAGAGAAAGG - Intergenic
1090266168 11:125354223-125354245 GTGGAGTCTCAGAGAGCGGCTGG - Intronic
1090269615 11:125376962-125376984 ATAGAGGCCCAGAAAGAGGAGGG - Intronic
1091134508 11:133176628-133176650 GTGAAGTGGGAGCAAGAGGAAGG - Intronic
1092141145 12:6184330-6184352 GTGGCTTTGCAGACAGAGGAGGG - Intergenic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1093987306 12:25550501-25550523 GTGGACCCCCAGAAAGGGGATGG - Intronic
1095339359 12:41070106-41070128 ATGGAGCCGCAGAAATTGGAAGG - Exonic
1095949586 12:47774635-47774657 GTAGAGTCGCAGCATGAGGTGGG + Intronic
1096004556 12:48158431-48158453 GTGCAGTGGCAGGAAGTGGAGGG - Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096732472 12:53625827-53625849 GTGGAATGGGAGAAAGAGGAGGG - Intronic
1096777756 12:53974323-53974345 GTGGAGGGGGAGAAAGGGGAGGG + Intronic
1096915961 12:55034168-55034190 GTGGAGGCAGAGAAACAGGAAGG + Intergenic
1097564258 12:61248717-61248739 GTGGAGGAGAAGGAAGAGGAGGG - Intergenic
1097620952 12:61938893-61938915 TTGGAGACTCAGAAGGAGGAGGG + Intronic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1099384002 12:81992000-81992022 GTGTATTCACAGAAAGTGGATGG + Intergenic
1100216889 12:92459983-92460005 GTGTAGTTGGAGAAAGGGGAAGG - Intergenic
1101195781 12:102380702-102380724 GTGGATGTGGAGAAAGAGGATGG + Intergenic
1101214464 12:102566764-102566786 GTGAAGACACAGGAAGAGGATGG - Intergenic
1102115787 12:110402255-110402277 ATGAAGTCGCAGAGAGTGGAGGG + Intronic
1102356292 12:112239051-112239073 GTTGAGTGGGAAAAAGAGGAAGG - Exonic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103445847 12:120994648-120994670 GTGGAGTCGAAGGTAGTGGATGG - Intronic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106979919 13:35267107-35267129 GTGGAGGAGAAGAAAGAAGAGGG + Intronic
1107748905 13:43543214-43543236 GTTGAGTGGTAAAAAGAGGAAGG + Intronic
1108493832 13:51005489-51005511 ATGGAGCCTGAGAAAGAGGAGGG - Intergenic
1109129068 13:58557641-58557663 GTGGAGTAACAGAAAGAAAATGG - Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1109943635 13:69404518-69404540 GTGGGGAGCCAGAAAGAGGATGG - Intergenic
1111244583 13:85519031-85519053 GTGGAGTTTGAGAAAGAGGCAGG + Intergenic
1111863469 13:93738657-93738679 TTGGAGTAGGAGAGAGAGGAGGG + Intronic
1112662241 13:101523337-101523359 GCGGACTCTCACAAAGAGGATGG - Intronic
1112753829 13:102608789-102608811 GAGGAGGCAGAGAAAGAGGAAGG - Intronic
1112998604 13:105604585-105604607 GTGAAGGCCCAGCAAGAGGAAGG - Intergenic
1113696720 13:112351714-112351736 GTGGAGGGGCAGAAAGAAGAGGG - Intergenic
1114788554 14:25629247-25629269 GTGGAGTGGCAGGAAGCAGATGG + Intergenic
1115740382 14:36381550-36381572 TTGGAGACTCAGAAAGAGGGAGG + Intergenic
1115775573 14:36711125-36711147 GTGGAGTCTTAGAAAGATCAAGG - Intronic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1115947592 14:38679674-38679696 ATGGAGACTCAGAAGGAGGAGGG - Intergenic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116601820 14:46935577-46935599 GGGGATTCCCAGAAAGAGGCAGG - Intronic
1116808391 14:49515770-49515792 ATGGAGTGGGAGAGAGAGGAGGG + Intergenic
1117581048 14:57152086-57152108 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
1118433557 14:65747739-65747761 TTAGAGACTCAGAAAGAGGAGGG + Intergenic
1118500882 14:66361597-66361619 GTGGATTAGGAGAGAGAGGAAGG - Intergenic
1118593378 14:67418290-67418312 GTGGAGTAGTGGAAAGAGCAAGG - Intergenic
1120404165 14:84073296-84073318 GTGGAGAGGCAGAAAGACAAGGG + Intergenic
1121286900 14:92743097-92743119 GTGAAGGCCCAGAGAGAGGAAGG - Intronic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121564130 14:94895977-94895999 ATGGAGTTGCAGAGAGAGGCAGG + Intergenic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121692725 14:95889468-95889490 GTGGAGGCGGAGGAGGAGGAGGG - Intergenic
1122267260 14:100552526-100552548 GGGGAGTCCAAGAAAGGGGAGGG - Intronic
1123991091 15:25683882-25683904 CTGGGGTCACAGACAGAGGAGGG - Intronic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1125881708 15:43201223-43201245 GTGGAGTGGTAGAAAGTGGTGGG + Intronic
1126413821 15:48397714-48397736 GTGGTGGCTCAGAAAGTGGAAGG - Intergenic
1126475250 15:49058954-49058976 ATGGAGACTCAGAAGGAGGAAGG + Intergenic
1126598476 15:50405165-50405187 GTGGAGTCCTTGAAGGAGGAAGG - Intergenic
1127151856 15:56083850-56083872 GTGGGGTGGCAGAAGGAGGGAGG + Intergenic
1127525462 15:59788041-59788063 GTGGGTTAGCAGCAAGAGGAGGG + Intergenic
1127723486 15:61725566-61725588 CTGGGGTCGCAGAAAGAGAAGGG + Intergenic
1127931555 15:63600502-63600524 GTGCAGGGGCAGAAAGAGGAGGG + Intronic
1128130257 15:65222544-65222566 GTGAAGTAGCAGAAAGATGAAGG - Intergenic
1128305053 15:66592955-66592977 TTGGAGTAGCAGGAAGAGAAAGG - Intronic
1128734705 15:70046684-70046706 GGGGAGACGCAGCAGGAGGAAGG + Intergenic
1129191818 15:73941913-73941935 GTGGAGGGGCAGGAACAGGACGG + Intronic
1130306265 15:82713995-82714017 GTTGAGGCCCAGAGAGAGGAAGG - Intergenic
1133504395 16:6397093-6397115 TTGGAGTCCCAGAAAGAGGAAGG + Intronic
1134250108 16:12568492-12568514 GTGATGTCGCTGAAAGAGCAGGG - Exonic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135218560 16:20593564-20593586 TTGGAGACTCAGAAGGAGGAAGG - Intergenic
1136013973 16:27383250-27383272 GTAGAGGCTCAGAGAGAGGAAGG + Intergenic
1136076343 16:27819951-27819973 GTGGAGGCAGAGAAAAAGGAAGG + Intronic
1136507317 16:30713060-30713082 ATGGAGCGACAGAAAGAGGAGGG - Intronic
1139282645 16:65783907-65783929 GTGGAGGCCCGGAGAGAGGAAGG - Intergenic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141393203 16:83681596-83681618 GTGGAGGGGAAGAAAGAGAAAGG - Intronic
1141514578 16:84535154-84535176 GAGGAGTGGGAGAAGGAGGAGGG - Intronic
1141604434 16:85144862-85144884 ATGGATTTGGAGAAAGAGGAAGG - Intergenic
1141858340 16:86700352-86700374 GTGGAATGGAAGAAAAAGGATGG - Intergenic
1143304820 17:5938041-5938063 GTATAGTGGCAGAAAGAGGGGGG - Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144152333 17:12461514-12461536 GGGGAGAGGCAGGAAGAGGATGG + Intergenic
1144229351 17:13184785-13184807 GAGGAGGGGGAGAAAGAGGAGGG + Intergenic
1146193802 17:30793941-30793963 GTGGGGTGGAAGGAAGAGGATGG - Intronic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1148382029 17:47206898-47206920 GTGGAGGTGGAGAAGGAGGAGGG + Intronic
1148462197 17:47845285-47845307 GTGGAGAGGGGGAAAGAGGAAGG - Exonic
1148573060 17:48685968-48685990 GTGGAGGAGGAGGAAGAGGATGG + Intergenic
1149160007 17:53681177-53681199 TGGGAGTCCCAGAAAGAGAAAGG - Intergenic
1149450778 17:56748361-56748383 GTGGGGTGGCAGGAAGATGAGGG - Intergenic
1149983301 17:61328842-61328864 GTGAAGGCACAGAAAGACGATGG - Intronic
1151518853 17:74614356-74614378 GTGGAGTTCCAGGAGGAGGAGGG + Intronic
1153361463 18:4202340-4202362 CTGGAGCCTCAGAATGAGGAAGG + Intronic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1155092857 18:22528145-22528167 GTGGAGACAGAGGAAGAGGATGG - Intergenic
1155759054 18:29541369-29541391 GAGGAGAGGGAGAAAGAGGAAGG - Intergenic
1156020120 18:32589943-32589965 AAGGAGTCTCAGAAAGAGGGTGG + Intergenic
1156040147 18:32811269-32811291 ATGGAATTGCAGAAAGAGCAGGG - Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1158059581 18:53323221-53323243 GAGGAGTTCAAGAAAGAGGAAGG - Intronic
1158580228 18:58674324-58674346 GTGGAGTCACACAGAGAGAAGGG + Intronic
1158787630 18:60734895-60734917 GTGAAGACACAGAAAGAAGATGG - Intergenic
1158901327 18:61964521-61964543 TTGAAGTCGCAAAAAGAGGTTGG + Intergenic
1158948070 18:62464961-62464983 GTGAAGTCACAGCAAGAAGATGG - Intergenic
1159959064 18:74541485-74541507 GAGGAGTCACAGAAGGAGAAGGG + Intronic
1160242899 18:77135913-77135935 GTGGAGGGAGAGAAAGAGGAAGG + Intergenic
1160312473 18:77808809-77808831 GTGGTGTCACAGAAAGAGTGAGG + Intergenic
1160533351 18:79577958-79577980 GTGAAGTCCCAGCAAGAGAAGGG - Intergenic
1160923225 19:1530191-1530213 GTGGAGGCTCAGGGAGAGGAGGG - Intronic
1161221193 19:3119036-3119058 GTGGAGTCGGACAACGAGGTGGG + Exonic
1161847287 19:6719037-6719059 GTGGAGTCTCAGAGAAGGGAGGG + Intronic
1162472647 19:10881663-10881685 GTGGAGCTGCAGAGAGAGCAGGG + Intronic
1165300016 19:34962941-34962963 GTGGAGGGTGAGAAAGAGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166147399 19:40847052-40847074 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166151548 19:40878937-40878959 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166170420 19:41024441-41024463 CTGGGGTTGCAGAGAGAGGATGG + Intergenic
1166178639 19:41091709-41091731 CTGGGGTTGCAGAGAGAGGATGG - Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167723677 19:51196607-51196629 TTGGAGACTCAGAATGAGGAAGG - Intergenic
1168199442 19:54804270-54804292 GTGGTGTCACCGACAGAGGAGGG + Intronic
925133242 2:1509323-1509345 GTGGTGTCCCTGAAAGAAGAGGG - Intronic
925701808 2:6646423-6646445 ATGGAGTCCCAGAGAGGGGATGG - Intergenic
925820449 2:7794595-7794617 GGGGAGAGGGAGAAAGAGGAAGG + Intergenic
926401482 2:12501606-12501628 GTGGAGGGGCAGGAAGGGGAAGG - Intergenic
927144662 2:20154947-20154969 TTGGAGTCTCAGAAAGAGGTGGG + Intergenic
927869658 2:26615503-26615525 GTTGAGGCCCAGGAAGAGGAAGG + Intronic
931161734 2:59700244-59700266 GAGGAGGCAGAGAAAGAGGAGGG - Intergenic
932604807 2:73157846-73157868 GTGGAGTCTGAGGAAGAGGGGGG + Intergenic
933904903 2:86882292-86882314 TTGGAGACTCAGAAGGAGGAGGG + Intergenic
935147837 2:100408321-100408343 ATGGAGTGGCGGAAGGAGGAGGG - Intronic
935272649 2:101448434-101448456 GTGGTGTCGGAGAAGGAGGCAGG - Intronic
935643634 2:105314110-105314132 GTGAAGACACAGAAAGAGGAAGG + Intronic
936367325 2:111869870-111869892 TTGGAGACTCAGAAGGAGGAGGG - Intronic
940412114 2:153377167-153377189 GGGGAGAGGCAGCAAGAGGATGG + Intergenic
942413020 2:175731391-175731413 GTGAAGAGGCAGAAAGAGGGTGG + Intergenic
943762464 2:191624796-191624818 GTGAAGACACAGAAAGAAGATGG - Intergenic
943855318 2:192782987-192783009 GTGGAATGGAAGAAAAAGGAGGG + Intergenic
944469082 2:200033632-200033654 CTGGAGTCGGAGAAAGAACAGGG - Intergenic
944577886 2:201107160-201107182 GTGGCGTAGCAGAAAGAACATGG - Intergenic
946540395 2:220677981-220678003 GTGGAGTGGGTGAGAGAGGATGG - Intergenic
946859013 2:223982306-223982328 ATGGAGACTCAGAAGGAGGAGGG + Intronic
947985892 2:234447136-234447158 TTGGAGTAGAAGAATGAGGATGG + Intergenic
1169083255 20:2810604-2810626 TTGGAGACTCAGAAGGAGGAGGG - Intergenic
1169213433 20:3779891-3779913 GTGGAGATGCGGAAAGGGGAAGG + Intronic
1169870232 20:10241368-10241390 GGGGAGTGGCAGAAAGAGGGAGG - Intronic
1171369723 20:24653814-24653836 GTGAAGTCGCAGCAAGAAGGCGG - Intronic
1172773096 20:37392871-37392893 GGAGAGTGGCAGAAAGAGCAGGG - Intronic
1174386168 20:50189827-50189849 GTGGAGGCCCAGAGAGAGCATGG - Intergenic
1174478098 20:50811531-50811553 ATGGAGTGGCAGGGAGAGGAGGG - Intronic
1174852116 20:54005774-54005796 GTAGACTCGCAGAAACAGGGAGG + Intronic
1175369512 20:58478449-58478471 GTGGAGTCACAGGCAGAGGAAGG - Intronic
1176287088 21:5023901-5023923 GGGGAGTGGGAGAGAGAGGAAGG + Intronic
1176850387 21:13908258-13908280 GTGGGGATGCAGACAGAGGAGGG + Intergenic
1177838505 21:26211609-26211631 GTGGAGTCGGGGTAGGAGGAGGG + Intergenic
1177946407 21:27475305-27475327 GTGGGGAGGCAGAAAGAGCAGGG - Intergenic
1179870093 21:44239574-44239596 GGGGAGTGGGAGAGAGAGGAAGG - Intronic
1180225245 21:46388278-46388300 GTTGTGTGGCAGGAAGAGGATGG - Intronic
1180939215 22:19645932-19645954 GTTGAGTCTCAGCAAGAGTAAGG + Intergenic
1181839737 22:25646424-25646446 TTGGAGTTTCAGAAAGAGAAGGG + Intronic
1181915825 22:26279133-26279155 GTGCAGTCACAGACAGAGCATGG - Intronic
1183547664 22:38463503-38463525 GTGGAACCGCAGGGAGAGGAAGG + Intergenic
1203300222 22_KI270736v1_random:71971-71993 GTGGAGTGGAATGAAGAGGAGGG + Intergenic
949631019 3:5926628-5926650 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
952195211 3:31068303-31068325 GTGGAGTCACAGAGGGAGGGAGG - Intergenic
952879317 3:37973467-37973489 CTGGAGTAGCAGCAAGAGAAGGG - Intronic
953910316 3:46889515-46889537 CAAGAGTCACAGAAAGAGGAGGG - Intronic
954266220 3:49472172-49472194 GTGGAGTGGCAGGAAGAGGGAGG + Intronic
954834695 3:53455602-53455624 GTGGAGCTGCATAATGAGGATGG - Intergenic
955931976 3:64066495-64066517 GTAGAGTGGCAGAAAGAGCAGGG + Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
958506397 3:94984249-94984271 GTGGAGTGGGGGAAAGGGGAAGG - Intergenic
959029311 3:101279527-101279549 GTAAGGTCCCAGAAAGAGGAAGG + Intronic
959646946 3:108713928-108713950 GTCGTGTAGCAGAAAGAGCATGG - Intergenic
960019194 3:112930870-112930892 GTGGAGTGGCGGAAGGAGCATGG - Intronic
960600607 3:119454369-119454391 GAGGAGTCCCAAAAATAGGAGGG - Intronic
962473749 3:135737699-135737721 GTGGAGTCTAAGACATAGGAAGG - Intergenic
962920527 3:139946453-139946475 GTGGAGTAGCAGCAAGACCAAGG - Intronic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
967188817 3:186967764-186967786 ATGGAGGCCCAGAAAGGGGAAGG + Intronic
967330823 3:188287454-188287476 GTGAAGTGTCAGAAAGAGCAGGG - Intronic
967702209 3:192606359-192606381 GAGGACTACCAGAAAGAGGAGGG + Intronic
968036583 3:195553055-195553077 CTGGAGTCTCAGAGGGAGGATGG - Intergenic
968067129 3:195764886-195764908 GTGGAGGCCCAGAGAGGGGAAGG + Intronic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
969255285 4:5997108-5997130 GAGAAGTCGAAGGAAGAGGAAGG + Intergenic
972651273 4:41019945-41019967 AAGGAGTCGAAGAGAGAGGAGGG + Intronic
973658860 4:53081401-53081423 GTGGACTAGTAGAAAGTGGAGGG - Intronic
974088863 4:57289642-57289664 GTGGAAACGCAGAGAGAAGATGG + Intergenic
975244703 4:72106618-72106640 TTAGAGTGGCAGAAAGAGGCAGG - Intronic
975953222 4:79800730-79800752 GTGAAGACACAGAAAGAAGATGG + Intergenic
976370073 4:84277761-84277783 GTGAAGTCATGGAAAGAGGATGG - Intergenic
976593308 4:86870851-86870873 GTGGAAGCCCAGAAACAGGAAGG + Intergenic
976855880 4:89604890-89604912 CAGGAGTCCCAGAAAGAGGGAGG + Intergenic
977241877 4:94581303-94581325 GTGGAGCGGCAGCAAGTGGAGGG - Intronic
977292905 4:95182436-95182458 GTGGAGTGGAAGAAAGGAGAGGG - Intronic
979400789 4:120247038-120247060 GTGGATTTGCAGAAGGAAGAGGG + Intergenic
979585526 4:122410980-122411002 GTGGAGTAGTAGAGAAAGGATGG + Intronic
980579171 4:134727461-134727483 ATGGAGTCAAAGGAAGAGGAAGG + Intergenic
982709287 4:158744100-158744122 TTGTAGTTGCAGGAAGAGGAAGG + Intergenic
982873877 4:160620001-160620023 GTGCAGATGCAGAAAGAGGGTGG - Intergenic
984156291 4:176199202-176199224 GAGGAGACGGAGGAAGAGGAGGG - Intergenic
984561798 4:181279890-181279912 GTGGGGTCCCAGAAAGATTAAGG + Intergenic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
985935041 5:3091127-3091149 GTGGGGTGGCAGGAAGGGGAGGG - Intergenic
986717288 5:10533459-10533481 GTGGAGACGCTGGCAGAGGAGGG - Intergenic
988224079 5:28389700-28389722 GTGGAGTCGGGGGAGGAGGACGG - Intergenic
988615108 5:32767954-32767976 GTGGAGGCAGGGAAAGAGGAGGG - Intronic
988774390 5:34464082-34464104 GTGGAGTCACAGAGGGTGGAAGG + Intergenic
989425579 5:41291699-41291721 GAGCAGTTGCAGAAAGAGGGTGG + Intergenic
990000116 5:50882877-50882899 ATGGAGTGGCAAGAAGAGGAAGG - Intergenic
990054796 5:51559573-51559595 GTGGAGTGGCAGACAGAGTAGGG + Intergenic
990140319 5:52695598-52695620 GTGGGTTGGCAAAAAGAGGAAGG - Intergenic
990709972 5:58569709-58569731 TTGGAGGCGCAGGAAGATGAAGG - Intergenic
991063706 5:62403983-62404005 TTGGAGTCACAGAGGGAGGAAGG + Intronic
992092040 5:73326036-73326058 GTGGAGAGGCAGCAAGAGGGTGG - Intergenic
992162412 5:74016139-74016161 GTGGAGTTTCAGACTGAGGAGGG - Intergenic
992232566 5:74677857-74677879 GTGGAGACTCAGAAAGGGGAGGG - Intronic
992403615 5:76434347-76434369 TTGGAGACTCAGAAAGAGGAGGG - Intronic
994066228 5:95545682-95545704 GTGGGGTTGCTGAAGGAGGAAGG - Intronic
994109653 5:95986945-95986967 TTGGAGTGGCAGAAAGGAGATGG + Intergenic
996643012 5:125780106-125780128 TTGGAGTAGGACAAAGAGGATGG - Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999149086 5:149414933-149414955 GCTGAGTCACAGAAAGAGCATGG + Intergenic
999279437 5:150355413-150355435 GTGGAGTTGAAGAGAGTGGAAGG - Intergenic
1000393489 5:160749085-160749107 CTGGAGTCGCAGAAAGAACATGG - Intronic
1001839137 5:174858675-174858697 TGGGAGTCCCAGAAAGAGAAAGG - Intergenic
1001880556 5:175240482-175240504 CTGGTGTCGCAGACTGAGGAGGG - Intergenic
1002559190 5:180070076-180070098 GTGGAAGGGTAGAAAGAGGAAGG - Intronic
1002716959 5:181233957-181233979 GTGGAGTGGCAGGAAGAGCCAGG + Intronic
1003350058 6:5308242-5308264 GTGAAGTCACAGAAGCAGGAAGG + Intronic
1003803544 6:9699785-9699807 ATGGAGTAGCAGAAAGACCACGG - Intronic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004558854 6:16728134-16728156 GTAGTGTGGCAGAAAGAGCAAGG - Intronic
1005994313 6:30922260-30922282 CTGGAGTCACAGAAAGCGGCAGG - Intronic
1006191248 6:32210861-32210883 GGGCAGTGGCAGAAATAGGAGGG + Exonic
1006815989 6:36850353-36850375 GTGGAGGCGCAGCAGGAGGAAGG - Intergenic
1007493223 6:42240576-42240598 GTTGAGACCCAGAGAGAGGAAGG - Intronic
1007610961 6:43148499-43148521 GTTGAATGGCAGAAAGGGGATGG + Intronic
1011745320 6:90402783-90402805 GTGGAGAGGCAGGAAGAGGGAGG + Intergenic
1011844183 6:91542396-91542418 GTAGAGTCCCAGAAAGAAAAAGG + Intergenic
1013105245 6:107021570-107021592 GTGGAATAGCAGAAAGTGAATGG + Intergenic
1013342839 6:109232105-109232127 GAGGAGTGGCAGAAGGAAGAGGG - Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1015874522 6:137809291-137809313 GTGGGCTGGCAGAGAGAGGAGGG - Intergenic
1016099771 6:140084878-140084900 GTGAAGACACAGAAAGAAGATGG + Intergenic
1016385971 6:143531243-143531265 TTGGAGACTCAGAAAGGGGAGGG + Intergenic
1018449192 6:163890891-163890913 GAGGAGTTGAAGAAGGAGGAGGG - Intergenic
1018683249 6:166282143-166282165 ATGGAGCTGAAGAAAGAGGAGGG + Intergenic
1018788516 6:167128012-167128034 CTGGAGTTGCAGACAGAAGAGGG - Intronic
1018812239 6:167306627-167306649 GTGGGGGCGCAGCCAGAGGAAGG + Intronic
1018861770 6:167715652-167715674 GTGGAGGAGGAGGAAGAGGAGGG + Intergenic
1019013341 6:168860923-168860945 GAGGAGAGGGAGAAAGAGGAAGG + Intergenic
1019332816 7:469253-469275 GCAGAGTCCCAGACAGAGGAAGG - Intergenic
1020167107 7:5816197-5816219 GTGGAGACGTGGAAACAGGATGG + Intergenic
1020587207 7:10083926-10083948 GGGGAGTCACACAAAAAGGAGGG + Intergenic
1020927825 7:14355093-14355115 GGTGAATGGCAGAAAGAGGATGG - Intronic
1020929201 7:14372056-14372078 TTGGAGGCGCTGAAAGAGAAAGG - Intronic
1021624147 7:22576170-22576192 GTGGAGTGTCACAAAGAGAAGGG + Intronic
1022030738 7:26489915-26489937 GGGCACTGGCAGAAAGAGGAAGG - Intergenic
1022339450 7:29454645-29454667 GCAGGGTCACAGAAAGAGGAGGG - Intronic
1022665930 7:32410442-32410464 GTGGAGGAGGAGGAAGAGGAAGG + Intergenic
1023761460 7:43468414-43468436 GTGGAGTCGCACAGAGAGGTGGG + Intronic
1025271208 7:57519148-57519170 GTGGAGGCGCTGAAAGAGGCAGG - Intergenic
1027137691 7:75636948-75636970 GGAGAATCGCAGGAAGAGGATGG - Intronic
1027290999 7:76710797-76710819 GTGGAATTTCAGGAAGAGGACGG - Intergenic
1029578307 7:101418845-101418867 GTGGAGAGGAGGAAAGAGGAAGG - Intronic
1029663387 7:101978634-101978656 GTGGGGTCACAGAATGTGGAAGG - Intronic
1029806854 7:103007137-103007159 CTGGAGTCCCAAAAAGAGGAAGG + Intronic
1031489181 7:122366759-122366781 CTGGATTCACAGAAAGAGGATGG - Intronic
1032456366 7:132076153-132076175 GTGGAGGGGCAGAAAGAGCATGG - Intergenic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1034055782 7:148033465-148033487 GTGGAGTGGCGGGTAGAGGAAGG - Intronic
1035015957 7:155766250-155766272 GTGTAGGCGGAGGAAGAGGAGGG - Intronic
1035238066 7:157512914-157512936 GTGGGGTGGGAGAAGGAGGAGGG + Intergenic
1035570170 8:667410-667432 GTGGAGGAGCGGGAAGAGGAGGG - Intronic
1036125976 8:6062270-6062292 CTGGAGACACAGAAAGAGAAAGG + Intergenic
1038399622 8:27273117-27273139 ATGGTGTCTCAGAAAGAGGAGGG + Intergenic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039585238 8:38701753-38701775 GTGGAGCAGCAGGAAGTGGACGG + Intergenic
1039769509 8:40669514-40669536 GTGGAGTAGGATGAAGAGGAGGG - Intronic
1040970397 8:53130002-53130024 TTGGAGACTCAGAAACAGGAGGG - Intergenic
1042148397 8:65756347-65756369 CTGGAGTCCCAGAAAGAAAAAGG - Intronic
1042160535 8:65889851-65889873 GTGGCGTGTCAGAAAGAAGACGG - Intergenic
1045065223 8:98438063-98438085 TTGGAGGCTCAGAAGGAGGATGG + Intronic
1045316984 8:101052058-101052080 GTGGAGCAGCATAAAGATGAAGG - Intergenic
1046096134 8:109563508-109563530 GTGGAGTTACGGAAAGAGTAAGG + Intronic
1047263302 8:123281532-123281554 GTGGAGACGCAGGGAGAAGATGG - Intergenic
1047906580 8:129479245-129479267 GTGGGGTCACAGATACAGGAGGG - Intergenic
1048418043 8:134249151-134249173 GAGGAGTGGGAGAAAGAGGGTGG - Intergenic
1048650203 8:136467689-136467711 GGGGAGTCGTAGAAACAGGCTGG + Intergenic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1049696064 8:143984878-143984900 GTGGGGTTGCAGGAACAGGAGGG - Exonic
1050500619 9:6294298-6294320 TTGGAGATTCAGAAAGAGGAAGG - Intergenic
1050683857 9:8145347-8145369 GTGGAGATGCAGAGAGAAGAGGG + Intergenic
1050903203 9:10971437-10971459 GAGGAGTCTTTGAAAGAGGAAGG - Intergenic
1056999286 9:91492750-91492772 ATGGAGTAGCTGAAAGATGAAGG + Intergenic
1057261569 9:93587517-93587539 GAGGAGTCCCAGATAGTGGATGG + Intronic
1057353903 9:94320278-94320300 GAGCAGCCGCAGGAAGAGGACGG - Exonic
1057653847 9:96937312-96937334 GAGCAGCCGCAGGAAGAGGACGG + Exonic
1058969390 9:110066198-110066220 GTGGAGTTTCTGGAAGAGGATGG + Intronic
1059258777 9:112955933-112955955 CTGGAGTCTCAGAGAGAGGCTGG - Intergenic
1059520770 9:114939788-114939810 TTGGAGTAGAAGAAAGTGGAAGG - Intergenic
1059636923 9:116180130-116180152 TTGGAGTCACAGAATGTGGATGG + Intronic
1060557184 9:124513957-124513979 GGGGAGTTGCAGAAAAAGCATGG + Intergenic
1061496798 9:130979612-130979634 GTGGTGTCACCGAAAGAGAAGGG + Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1061707189 9:132462169-132462191 TTGGAGTCGCAGAAAGGGAATGG + Intronic
1185506397 X:634650-634672 GTGAAGTCGGAGGACGAGGACGG + Exonic
1186431094 X:9504836-9504858 GTGGAGTACCAGAAGGAGGTGGG + Intronic
1186483435 X:9914028-9914050 GTGGAGGCGGAGAAACAGAAAGG - Intronic
1187320302 X:18231803-18231825 GTAGAATGGCAAAAAGAGGAGGG + Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1188158741 X:26774966-26774988 ATGGAGACTCAGAAAGGGGAAGG + Intergenic
1188507654 X:30899955-30899977 GTGAAGTTGCAGAAAGCAGATGG + Intronic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192362760 X:70449754-70449776 GTGGAGGCGCTGAAGGAGGCAGG + Exonic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1192438080 X:71154899-71154921 GGGGGGCAGCAGAAAGAGGAAGG - Intronic
1194903188 X:99540672-99540694 ATGGAGTCCCAGAAGGAGAAAGG + Intergenic
1195520404 X:105822689-105822711 GTGGCGTGGGAGATAGAGGAGGG - Exonic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196134126 X:112188650-112188672 TTGGAGTCACTGAAAGTGGAAGG - Intergenic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1197053375 X:122088259-122088281 GTGGAGTCTCAGAAGGAAAAGGG - Intergenic
1197618410 X:128719967-128719989 ATGGAGACTCAGAAGGAGGATGG - Intergenic
1199516987 X:148689146-148689168 GTGAAGACACAGAAAGAAGATGG - Intronic