ID: 1081907897

View in Genome Browser
Species Human (GRCh38)
Location 11:46680748-46680770
Sequence CTGTAGGAGTAGAGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 407}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081907897 Original CRISPR CTGTAGGAGTAGAGGGAGGT GGG Intronic
901002316 1:6154899-6154921 CTGTAGGGGGAGAGGCAGGAGGG + Intronic
903468856 1:23570900-23570922 TTGCAGAAGTAGATGGAGGTGGG + Intergenic
904808903 1:33150750-33150772 CTGTAGGAGGAGTGTGTGGTAGG + Intronic
904960452 1:34328537-34328559 CTGAAGCAGAACAGGGAGGTGGG - Intergenic
905011245 1:34748302-34748324 CTGTGGGAGGAGAGTGAGGAGGG - Intronic
905418845 1:37825025-37825047 CTGTAGGGGTAGAGGTGGATTGG - Intronic
905929421 1:41776840-41776862 CTGTAAGAGTGAAGGGAGGGAGG - Intronic
906346713 1:45020035-45020057 CCCTGGGGGTAGAGGGAGGTGGG + Intronic
907081245 1:51624343-51624365 CTTTGGGAGTCGAGGCAGGTGGG + Intronic
908003727 1:59707391-59707413 CTGTAGGAGGAGGGGGAGAGAGG + Intronic
908007312 1:59740074-59740096 CTGAAGGAGGACAGGGAGGGAGG - Intronic
908389090 1:63669349-63669371 CTGTGGGAATAGAGGGATGAAGG + Intergenic
909245354 1:73274146-73274168 CTGTAGGAGCAGAGGTGGGAAGG + Intergenic
911315730 1:96354586-96354608 AGGTAGGAGTAGAGGGAGGATGG - Intergenic
913283726 1:117209229-117209251 CTGGAGGATTAGCAGGAGGTGGG - Intronic
913553088 1:119936069-119936091 GCTTAGGGGTAGAGGGAGGTGGG + Intronic
913650904 1:120913165-120913187 GTGGAGGAGGAGGGGGAGGTCGG - Intergenic
914170209 1:145215902-145215924 GTGGAGGAGGAGGGGGAGGTCGG + Intergenic
914200564 1:145480948-145480970 TTATAGGGGGAGAGGGAGGTAGG - Intergenic
914479678 1:148054075-148054097 TTATAGGGGGAGAGGGAGGTAGG - Intergenic
914525326 1:148459868-148459890 GTGGAGGAGGAGGGGGAGGTCGG + Intergenic
914598347 1:149175962-149175984 GTGGAGGAGGAGGGGGAGGTCGG - Intergenic
914641074 1:149607260-149607282 GTGGAGGAGGAGGGGGAGGTCGG - Intergenic
914973097 1:152329296-152329318 CTGTAGGAGTGAAGGGGAGTTGG + Intergenic
914984143 1:152441899-152441921 TGGTAGGAGTACAGGGAGGCAGG + Intergenic
915729174 1:158040952-158040974 CTCTAGGGGTAGGGGGAGCTGGG + Intronic
915940980 1:160117945-160117967 AGGGAGGAGTGGAGGGAGGTTGG + Intronic
916376558 1:164160555-164160577 CTGTTGGAGGAGAGGGGGTTTGG - Intergenic
916488251 1:165278574-165278596 CTGCAGGTGAAGAGGGAGGATGG - Intronic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
918105967 1:181415489-181415511 GAGAAGGAGTAGAAGGAGGTGGG + Intronic
919924102 1:202183378-202183400 CTGCAGGAGCTGAAGGAGGTGGG + Intergenic
920185101 1:204154589-204154611 CTGAGGGACTAGAGGGAGCTTGG + Intergenic
920534694 1:206729872-206729894 CTGGATGAGTAGAGGAAGGGAGG + Intronic
922177248 1:223206229-223206251 CACTAGGAGTGGAGGGAGCTTGG + Intergenic
922343621 1:224677736-224677758 CTGTCTGAGTGCAGGGAGGTGGG - Intronic
923988894 1:239412337-239412359 CTGGAGGAAAAGAGGGAGGGAGG - Intronic
924291126 1:242537559-242537581 CTGGAGGAGTAGGAGGAGATAGG - Intergenic
1063159963 10:3412039-3412061 CAGGAGGAGAGGAGGGAGGTGGG + Intergenic
1063651802 10:7945590-7945612 CTGTAGGGGTGGGAGGAGGTAGG - Intronic
1065114803 10:22475088-22475110 CAGTAGGAGAAACGGGAGGTGGG + Intergenic
1065497274 10:26342062-26342084 GGGAAGGAGTAGAGGGAGGGAGG + Intergenic
1066538959 10:36423216-36423238 ATGCAGGAGTGGAAGGAGGTAGG - Intergenic
1067306278 10:45067104-45067126 ATGTAGCAGTATTGGGAGGTGGG - Intergenic
1068143903 10:53040885-53040907 CTCCAGGAGTAGAGTGAGGAGGG + Intergenic
1069480640 10:68778593-68778615 GTGTAGGGGTAGAGGGAGACAGG - Intronic
1070433079 10:76360769-76360791 CTGTAGCAGGTGAGGGAGGGAGG - Intronic
1071526531 10:86362865-86362887 CAGTGGGTGTAGTGGGAGGTGGG - Intronic
1071552965 10:86581501-86581523 CTCTGTGAGTAGAGGGAGGTTGG - Intergenic
1071827860 10:89343049-89343071 ATGTAGGGGTAAAAGGAGGTAGG + Intronic
1072167875 10:92831207-92831229 GGGTGGGAGTAGAGGGAGGGTGG + Intergenic
1073439267 10:103543152-103543174 CTGCAGGACTACAGGGAGGAGGG - Intronic
1074192608 10:111150733-111150755 CTGCAGGAGTAGAAGAGGGTTGG - Intergenic
1074412461 10:113240137-113240159 CTGCAGGAGGAGTGGGAGGGAGG - Intergenic
1074569968 10:114615364-114615386 CAGAAGGAGGAGAGGGAGCTGGG - Intronic
1075809645 10:125215633-125215655 CTGGAGGAGCAGAGGGAAGAAGG + Intergenic
1076352262 10:129825369-129825391 CTGCAGCAGCAGAGGGAGGGAGG + Intergenic
1076422448 10:130340902-130340924 ATGTAGAAGCAGAGGGCGGTGGG - Intergenic
1077562435 11:3272282-3272304 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077568329 11:3318102-3318124 CAGGAGGAGAGGAGGGAGGTGGG - Intergenic
1077673511 11:4178918-4178940 CTGTGGTGGTAGAGGCAGGTTGG + Intergenic
1077957091 11:7031958-7031980 CTGCTGGAGTAGAGGGAGTGGGG - Intronic
1078016784 11:7621740-7621762 CTTTGGGAGTATGGGGAGGTGGG + Intronic
1078997123 11:16713785-16713807 CTGCAGGAGTGGAAGGAGCTGGG - Intronic
1079166084 11:18044727-18044749 CTGAAAGAGTAGGAGGAGGTGGG - Intergenic
1079298033 11:19252116-19252138 CAGTAGGGGCAGTGGGAGGTCGG - Intergenic
1079636124 11:22743611-22743633 TTGTAGCAGTGGAGGGAGGGAGG - Intronic
1080431317 11:32202660-32202682 CTGTAGGAGGAGAGTGAGAGGGG + Intergenic
1080931932 11:36819953-36819975 CTGCTGGAGTAGAGGTGGGTTGG + Intergenic
1081387757 11:42492288-42492310 CTGAAGGAGTACAGGGAAGACGG - Intergenic
1081670781 11:44941324-44941346 CTGTAGGGGAAAAGTGAGGTTGG - Intronic
1081907897 11:46680748-46680770 CTGTAGGAGTAGAGGGAGGTGGG + Intronic
1082794417 11:57369338-57369360 CTGGAGGAGGAGAGGCAGGGCGG - Intronic
1083785088 11:64940357-64940379 CAGAAGGAGTGAAGGGAGGTAGG - Intronic
1084006188 11:66324897-66324919 ATTTAGGCGTGGAGGGAGGTGGG - Intergenic
1085346456 11:75771181-75771203 CTGTGGGAGTATGGGTAGGTGGG + Intronic
1085623691 11:78056143-78056165 TTATAGGAGTAGAGGGTGGCAGG - Intronic
1087245423 11:95829985-95830007 ATGTAGAAGGAGAGGGAGTTAGG + Intronic
1089466999 11:118691897-118691919 TTGGAGGAGGAGAGGGAGGGAGG + Intergenic
1090542368 11:127722392-127722414 CAGGAGGAGAAGAGTGAGGTGGG - Intergenic
1091408678 12:224750-224772 CGGTAGGTGTAGAGGGCTGTGGG + Intronic
1092171426 12:6375948-6375970 CTGAGTGAGTAGAGGCAGGTGGG + Intronic
1092260697 12:6951930-6951952 GTGCAGGAGTAGAGGCAGGAGGG - Intronic
1092712343 12:11352533-11352555 CTGAAGGAGGGGAGGCAGGTAGG + Intronic
1092716079 12:11392253-11392275 CTGAAGGAGGGGAGGCAGGTAGG + Intronic
1092905288 12:13095706-13095728 GGGTAGGAGGAGAGGGAGGAGGG - Intronic
1093756919 12:22863047-22863069 CTGTTGGAGTAAGGGGAGGCAGG - Intergenic
1093917660 12:24823686-24823708 CAGGAGGAGGAGAGGGAGGGTGG - Intronic
1093957014 12:25232003-25232025 CTGTAGGACTAGAGGCTGGGGGG - Intronic
1095203322 12:39410899-39410921 CTGGAGGAATGGAGGGAGGGAGG + Intronic
1096059595 12:48685579-48685601 CTACGGGAGTAGCGGGAGGTTGG - Intergenic
1096224051 12:49853311-49853333 GGGTAGGAGTGGCGGGAGGTGGG + Intergenic
1096501347 12:52065574-52065596 CTGTAAGAATTCAGGGAGGTAGG + Intergenic
1096683509 12:53272658-53272680 CTCCAGGAGGAGAGGGTGGTGGG + Intronic
1096798421 12:54093065-54093087 CTTTAGTGGTAGAGGGTGGTAGG + Intergenic
1098227368 12:68338629-68338651 CTGCAGTAGGAGAAGGAGGTTGG - Intergenic
1098444240 12:70550087-70550109 ATGTAGGATTAGAGGAATGTAGG + Intronic
1099654165 12:85468421-85468443 AAGTAGGAGTTGAGGGGGGTTGG - Intergenic
1099853437 12:88134259-88134281 TTGTTGGAGGAGAGGGAGGATGG - Intronic
1100980146 12:100157124-100157146 CTGTAGGGGTGGAGGGTGGAGGG - Intergenic
1101423708 12:104570159-104570181 CTTTAGGAGTAGAGGTGGGGTGG - Intronic
1101846160 12:108364808-108364830 CTGTGGGAGTTAAGAGAGGTAGG - Intergenic
1101860947 12:108481973-108481995 CCCAAGGAGAAGAGGGAGGTGGG + Intergenic
1102177453 12:110886635-110886657 GGGTGGGAGGAGAGGGAGGTTGG - Intronic
1102261820 12:111447633-111447655 CTGTGGGAGGAGAGGATGGTGGG - Intronic
1103454642 12:121055396-121055418 ATGGAGGAGGGGAGGGAGGTGGG - Intergenic
1103620816 12:122186140-122186162 CTGTAGCAGGAGAGGGAGCACGG - Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1107649643 13:42531688-42531710 CTTTAGAAGAAGAGGGAGATGGG - Intergenic
1109835562 13:67852073-67852095 CTATAGTAGTAGTGGGAAGTGGG + Intergenic
1110716763 13:78714527-78714549 AAGTGGTAGTAGAGGGAGGTGGG + Intergenic
1111726432 13:92015446-92015468 TTGTAGGAGAAGAGGGACCTGGG - Intronic
1112036387 13:95500478-95500500 GTGTTGGAGTAGAGTGAGGGTGG + Intronic
1116475344 14:45332794-45332816 CAGGAGCAGTAGAGGGAGATTGG + Intergenic
1116767604 14:49091683-49091705 CTGAAGGAGTAGAGGCAAGAAGG - Intergenic
1117807550 14:59509988-59510010 ATGTGGGGGTAGAGGGAGCTTGG - Intronic
1118039066 14:61898238-61898260 AGGTAGGAGTGGGGGGAGGTGGG - Intergenic
1119102809 14:71895913-71895935 GAGTAGGAGGAGAGTGAGGTTGG - Intergenic
1119288627 14:73476425-73476447 CTGTAGGAGTTCAGGGAAGGGGG - Intergenic
1119930724 14:78543562-78543584 CTGTGGAGGTACAGGGAGGTTGG + Intronic
1120008864 14:79390422-79390444 CTGTAGCAGCAGAAAGAGGTAGG - Intronic
1120668981 14:87342115-87342137 GTGGAGGTGTAGGGGGAGGTGGG + Intergenic
1120924212 14:89781868-89781890 ATGTAGGTGTGGAGGGAGGAGGG + Intergenic
1120953726 14:90063526-90063548 CTGGAGCAGGGGAGGGAGGTTGG + Intronic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1122308250 14:100779021-100779043 CTGTGGTAGGAGAGGGAGGGAGG - Intergenic
1122899628 14:104777023-104777045 CTGTAGGAGTGGACGATGGTGGG - Intronic
1123021371 14:105399275-105399297 GGGTAGGAGCAGGGGGAGGTGGG - Intronic
1123813910 15:23957067-23957089 CTGCAGTAGTTGAGGGAAGTAGG + Intergenic
1124420511 15:29517076-29517098 CAGGAGGAGGAGAGGCAGGTTGG + Intronic
1125297378 15:38217829-38217851 CTTTGGGAGTAGGGAGAGGTGGG - Intergenic
1126302575 15:47214886-47214908 CTGTTGGAGAAGAGTGAGTTTGG + Intronic
1126568860 15:50128529-50128551 CTGTGACAGTAGAGGGAAGTGGG - Intronic
1129110254 15:73333104-73333126 CTGCAGGAGTAGAGAGGGGCTGG - Intronic
1129152444 15:73697359-73697381 GTGTAGGAGTGGAGGGTGGCGGG + Intronic
1131153541 15:90061657-90061679 CTCTAGGAGCAGAGGAGGGTCGG - Intronic
1131312560 15:91304207-91304229 CTGCAGGAGGAGAGAGAGGGGGG + Intergenic
1131578268 15:93614031-93614053 CTGGAGGAGAGGAGGGAGGTGGG + Intergenic
1131853403 15:96566534-96566556 CTGTAGAAGGAGAGGGGGCTGGG - Intergenic
1132102542 15:99034804-99034826 GAGTAGGAGAAGAGAGAGGTGGG + Intergenic
1132344037 15:101096841-101096863 GGGTAGGAGGAGAGGGAGGATGG + Intergenic
1132375345 15:101325047-101325069 CTGTAGGAGCAAAGGCAGGAGGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133978510 16:10617246-10617268 AAGTAGGAGGAGTGGGAGGTAGG - Intergenic
1134685763 16:16157043-16157065 CTGTAGGTTCAGAGGGAGGGAGG + Intronic
1136124278 16:28166186-28166208 CTGTAGGGGTGGCAGGAGGTGGG - Intronic
1136220391 16:28824055-28824077 CAGTAGGAGGGGAGCGAGGTGGG + Intronic
1136450941 16:30353980-30354002 CTGCAGGAGGAGATGGAGGAAGG - Exonic
1136477303 16:30521513-30521535 CTGAAGGAGAAGATGGAGGCTGG + Exonic
1137293163 16:47065974-47065996 CTGGAGGAGGAGAGGGAGAAAGG + Intergenic
1137526318 16:49239517-49239539 TAGTAGGAACAGAGGGAGGTGGG - Intergenic
1137942990 16:52707263-52707285 CTGAAGGAGGAGCAGGAGGTAGG - Intergenic
1138188559 16:54995898-54995920 CTGTGGGAGAAGTAGGAGGTGGG + Intergenic
1138443140 16:57047045-57047067 CTGGAGGCCTAGAGAGAGGTGGG - Intronic
1138551882 16:57752946-57752968 CTGTGGGAGTGGGGGGCGGTGGG - Intronic
1139329380 16:66175695-66175717 CTGGGGGAGAAGAGGGAGGCCGG + Intergenic
1139672119 16:68499087-68499109 CAGTAGGGGAAGAGGGAGGGAGG - Intergenic
1140264411 16:73408047-73408069 CTGCAGGAGTGGATGGGGGTGGG + Intergenic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142560891 17:808189-808211 CCCCAGGAGCAGAGGGAGGTGGG - Intronic
1143141982 17:4745906-4745928 CAGGAGGAGCAGAGGGAGTTGGG - Exonic
1143442794 17:6988549-6988571 GTGTAGCAGTATTGGGAGGTAGG + Intronic
1144215953 17:13055747-13055769 CTCTAGGGTTAGAGGGAGCTTGG + Intergenic
1144499156 17:15770285-15770307 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1144584608 17:16480731-16480753 CTGTAGCAGGAGAAGGAGATGGG - Intronic
1145162538 17:20585321-20585343 CCGTGGGAGTAGAGGGAGGTGGG + Intergenic
1146127631 17:30241277-30241299 CTGTATGTGTACAGGGCGGTGGG - Intergenic
1146943103 17:36857421-36857443 CTGTAAGAATAGATGGAGATGGG - Intergenic
1147138761 17:38449984-38450006 CTGGAGGAGTAGAAGCAAGTAGG - Intronic
1147211560 17:38875141-38875163 CTGTGGGGGTAGGGGGAGGCAGG + Intronic
1148483798 17:47977628-47977650 GTGTAGGGGTAAAGGCAGGTGGG + Intronic
1149867891 17:60160896-60160918 AGGGAGGAGTAGAGGGAGGGAGG + Intronic
1150130731 17:62667290-62667312 CCGAGGGAGCAGAGGGAGGTAGG + Intronic
1150250852 17:63703752-63703774 CTGGGGGAGAAGAGAGAGGTGGG + Intronic
1150456527 17:65310881-65310903 CTGAAGGAGGAGAAGGAGCTAGG + Intergenic
1150612472 17:66744965-66744987 TTGTAGGAGAAGAGGGAGGCTGG - Intronic
1151356139 17:73559739-73559761 CTCTAGCAGGACAGGGAGGTAGG - Intronic
1151376352 17:73691488-73691510 CTGTAGGAGAAGGGGGAAGCTGG - Intergenic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152655248 17:81516438-81516460 GTGTGGGAGAAGAGGGAGGTGGG - Intronic
1154485930 18:14871223-14871245 CAGTAGGTTTAGAGGGAGGGTGG - Intergenic
1157135226 18:45047624-45047646 CTGCAGGAGTAGGGGGTGGCAGG + Intronic
1159024103 18:63167035-63167057 GTGCTGGAGTAGAGGGATGTGGG + Intronic
1160066433 18:75578885-75578907 CTGTAGAAGGGGAGGGAGTTAGG - Intergenic
1160318200 18:77867316-77867338 CTGCAGGTGGAGAGGAAGGTGGG - Intergenic
1161663797 19:5562986-5563008 CTGCAGGAAGAGAGGGAGTTGGG + Intergenic
1162076525 19:8191578-8191600 CTGTAGGAGAGGGGGCAGGTAGG - Intronic
1163612291 19:18307873-18307895 CTGGAGGAGGAGGAGGAGGTAGG + Intronic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165794672 19:38511920-38511942 CTGTAGGAGTCTGGGGGGGTGGG + Intronic
1165866578 19:38943038-38943060 CTGAAGGAGGAGAGGGAGCCGGG + Intronic
1165949909 19:39468557-39468579 GTGGAGGAGTGCAGGGAGGTGGG + Intronic
1166580661 19:43895805-43895827 GTGGAGGAGGAGAGGGAGGGAGG + Intronic
1166686661 19:44800528-44800550 CTGTAGGCGGAGAGAGGGGTGGG - Intronic
1167144603 19:47674139-47674161 CTGAAGGATCACAGGGAGGTAGG + Intronic
1167574856 19:50313036-50313058 CCGTGGGAGCAGAGGGAGGGAGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167642119 19:50687709-50687731 CTGTGGTGGTAGAGGGTGGTGGG - Intronic
1168196557 19:54778781-54778803 CTGTAGGAGTATCTGGAGTTCGG - Intronic
1168421077 19:56204155-56204177 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168424367 19:56226765-56226787 CTGGAGGGATAGAGGGAGGGAGG + Intronic
1168426305 19:56241978-56242000 CTGGAGGGATAGAGGGAGGGAGG - Intronic
1168695604 19:58402301-58402323 CAGAAGGAGCAGAGGGTGGTGGG + Intronic
925173721 2:1767940-1767962 GGGTGGGGGTAGAGGGAGGTGGG + Intergenic
925387443 2:3472040-3472062 CTGCAGGAGTGGTGGGAAGTTGG + Intronic
925407139 2:3613161-3613183 CTGCAGGCGGGGAGGGAGGTAGG + Intronic
925551030 2:5074663-5074685 CTGTGTCAGTAGATGGAGGTTGG - Intergenic
925661519 2:6208316-6208338 CCCTGGGAGTAGAGGGAGGGAGG + Intergenic
927877188 2:26665736-26665758 AGGTAGGAGGAGAGGGAGGAAGG - Intergenic
928165132 2:28965717-28965739 CTCTTAGAGAAGAGGGAGGTAGG - Intronic
928572396 2:32622566-32622588 CCAGAGGAGTACAGGGAGGTGGG - Intergenic
929325635 2:40607409-40607431 CTGTAGAAGAAGGGGCAGGTGGG - Intronic
931228866 2:60357139-60357161 CTGAAGGAATAGCGAGAGGTGGG - Intergenic
931251052 2:60530817-60530839 CAGGAGGGGTAGTGGGAGGTGGG - Intronic
932968874 2:76514091-76514113 CAGTAGGAGTTGTGGGAGGAAGG - Intergenic
934078430 2:88447776-88447798 CTGAAGCAGTAGAGGGTAGTTGG - Exonic
935261576 2:101360215-101360237 ATGTAGGAAGAGAGGCAGGTAGG - Intronic
935956856 2:108385562-108385584 CTCTAGGAGCAGAGGGCGGGTGG - Intronic
936780898 2:116030794-116030816 CTGAAAGAGGGGAGGGAGGTAGG - Intergenic
939692756 2:145285986-145286008 CTGGAAGAGAAGAGGGAGGCTGG - Intergenic
941208848 2:162609982-162610004 CTTTAGGAGAATAGGGAGCTTGG + Intronic
942400617 2:175598273-175598295 CTGTAGGTGTTGTGGGTGGTAGG + Intergenic
944763613 2:202841787-202841809 ATGCAGGAGTGGAGGCAGGTGGG + Intronic
945000229 2:205342117-205342139 CTGTATGACTAAAGGGAGGAAGG + Intronic
945746604 2:213726032-213726054 CTGTAGGAGTAAGGGAACGTGGG - Intronic
945753215 2:213813998-213814020 GGGTAGGAGGAGACGGAGGTAGG + Intronic
947128648 2:226898130-226898152 TTGTAGGAGTATAGGGAGGTAGG - Intronic
947574699 2:231263552-231263574 ATGTAGTAGTACAGGGAGGTGGG - Intronic
947650143 2:231780458-231780480 CTGGAGTAGTTGGGGGAGGTGGG - Intronic
948505027 2:238422668-238422690 CTGGAGGAGGGGAGGGAGGTTGG + Intergenic
948995467 2:241576129-241576151 CGGGAGGAGGAGAGGGAGGAAGG - Intergenic
1168854746 20:1000881-1000903 CTGTGGGAGAATTGGGAGGTGGG - Intronic
1168928795 20:1604668-1604690 CTGGATGAGTGGAGGGTGGTGGG + Intronic
1168969584 20:1921764-1921786 CTGGATGAGTGGAGGGTGGTGGG - Intronic
1170417394 20:16159075-16159097 CTGTAGGGGGAGAAGGAAGTGGG - Intergenic
1171077462 20:22143093-22143115 GTGAAGGAGGAGAGGGAGGAAGG - Intergenic
1171405237 20:24908336-24908358 CTGTTGGAGGGGTGGGAGGTGGG + Intergenic
1171491754 20:25524400-25524422 CTGTAGGAGGGGATGGAGCTGGG + Intronic
1171797990 20:29581275-29581297 CTTTAGTGGTAGAGGGTGGTAGG - Intergenic
1171850250 20:30302885-30302907 CTTTAGTGGTAGAGGGTGGTAGG + Intergenic
1172358249 20:34294531-34294553 TTGTTGGAGTAAAGGGAGTTGGG + Intronic
1173648056 20:44645999-44646021 CTGTGGGCGCAGAGTGAGGTTGG - Intronic
1173826538 20:46051421-46051443 CTGTATGAGCAGTGGGAGGGTGG + Intronic
1174083409 20:47987154-47987176 CATTAGGAGTAGAGGAAGGAAGG - Intergenic
1174416182 20:50368726-50368748 CTAAAGGAGTAGAGGGTGGCTGG - Intergenic
1175368080 20:58469009-58469031 CTCTGGGAGAACAGGGAGGTTGG - Intronic
1175409146 20:58754518-58754540 CTGTAGGGGGAGAGGTTGGTGGG + Intergenic
1175711629 20:61225923-61225945 GTGTCGGAGGAGAGGGAGGGAGG + Intergenic
1175888797 20:62306985-62307007 CTGGAGGACTGGAGGGAGCTGGG + Intronic
1175934626 20:62509265-62509287 GTGGAGGAGTAGAGGGATGGAGG - Intergenic
1176795374 21:13368155-13368177 CAGTAGGTTTAGAGGGAGGGTGG + Intergenic
1178056369 21:28803470-28803492 CTGTAGCAGTAGATTGAGATTGG - Intergenic
1178563822 21:33664512-33664534 CTGTGGCAGTGTAGGGAGGTGGG - Intronic
1178806704 21:35845472-35845494 GGGTTGGAGTAGGGGGAGGTGGG - Intronic
1179629053 21:42665579-42665601 CTGTAGGAGCAGAGCAAGGTCGG - Intronic
1180147000 21:45927309-45927331 ATGTAGGGGGAGAGGGAGGAAGG - Intronic
1180802197 22:18637146-18637168 CTGTGGGAGGATAGGGCGGTGGG - Intergenic
1181219525 22:21358113-21358135 CTGTAGGAGGATAGGGCGGTGGG + Intergenic
1183059371 22:35326801-35326823 CTCTAGGAGGAGAGAGAGGGGGG + Intronic
1183485382 22:38085376-38085398 CTGTAGGAGGAGAGAGAGAATGG + Intronic
1184636132 22:45833270-45833292 CTGAAGGCGTCGGGGGAGGTGGG + Intronic
1184951209 22:47843724-47843746 CTGGAGGAGTACAGGGAGGCAGG + Intergenic
1185074059 22:48673711-48673733 ATGTAGGAGGTGAGGGAGGGTGG + Intronic
949588183 3:5464238-5464260 CTGGGGGAGTAGAAGGAAGTGGG + Intergenic
949931174 3:9079614-9079636 CTGTAGGACCATAGGCAGGTGGG - Intronic
951048600 3:18068668-18068690 CTGTAGGAGTAATGGGAGCTGGG + Intronic
951851719 3:27148730-27148752 TGGTAGGAGTAAAGGGAGGTAGG - Intronic
953020847 3:39112154-39112176 CTGTAGGGGTACAGGGAGGGAGG + Intronic
953120571 3:40037380-40037402 ATTTAGGAATAGAGGGAGGCAGG + Intronic
953661712 3:44895536-44895558 CTGCAGTTGGAGAGGGAGGTGGG + Intronic
955540738 3:59973402-59973424 CTGTGGCAGAAGAGAGAGGTTGG - Intronic
956779953 3:72595967-72595989 CTGTGGGAGTCGAGGGATGGAGG - Intergenic
958989990 3:100831705-100831727 CTGGATGAGTAGAGGGATGAGGG - Intronic
959991761 3:112638858-112638880 CTCTGGGGGTTGAGGGAGGTTGG + Exonic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
962051558 3:131821095-131821117 CTGAAGGAGGAGGAGGAGGTTGG + Intronic
964174128 3:153805010-153805032 ATGAAGGATTAGAGGAAGGTAGG - Intergenic
966815458 3:183886311-183886333 CTGTAGGAGTCTAGAGAGGGGGG + Intergenic
967016805 3:185489676-185489698 CTGTCGGGGTGGAGGGAGGGAGG + Exonic
967326079 3:188241162-188241184 CTCTAGGAGCAGAAGGTGGTGGG + Intronic
967331154 3:188290986-188291008 CTGTAGCATCAGAAGGAGGTGGG + Intronic
967549634 3:190775595-190775617 ATGAAGGAGCAGACGGAGGTGGG - Intergenic
968889196 4:3358969-3358991 GTGTAGGAGGAGAGGGAGGAGGG - Intronic
969082734 4:4632340-4632362 CTGTAGGAGAAGAGGGAAAAGGG - Intergenic
969533371 4:7741432-7741454 CTATAGGAATATAGGGGGGTGGG + Exonic
969608205 4:8212678-8212700 CTGGAGGGGCAGACGGAGGTTGG - Intronic
969910710 4:10442960-10442982 CTGTAGGAATATTGGGAGCTAGG - Exonic
971409485 4:26355168-26355190 CTGGGGGATTAGGGGGAGGTGGG - Intronic
971455061 4:26836415-26836437 TTGGAGGGGCAGAGGGAGGTGGG + Intergenic
972142024 4:35972824-35972846 CTGTAGGATTGGAGGTAGGAGGG - Intronic
972639391 4:40911886-40911908 GTGTAGGGGCAGAGGGAGGAGGG - Intronic
974087802 4:57279668-57279690 CTGGTGGAGGAGAGGGAGGATGG + Intergenic
975528136 4:75373654-75373676 CTGTAGGGGAGGAGGGAGGGAGG - Intergenic
977956322 4:103031119-103031141 CAGAAGGAGTAGCGGGAGATGGG + Intronic
979568409 4:122183818-122183840 CTGTAGGGGGACAGTGAGGTTGG - Intronic
979723728 4:123934757-123934779 ATGAAAGAGTTGAGGGAGGTAGG - Intergenic
980459101 4:133082030-133082052 TATCAGGAGTAGAGGGAGGTTGG - Intergenic
980605877 4:135088079-135088101 CTGAAGGAGTAAAGGGAGACGGG + Intergenic
980716819 4:136638563-136638585 CTGAAGCAGGATAGGGAGGTGGG - Intergenic
981902092 4:149878731-149878753 ATAGAGGAGTAGAGGTAGGTAGG - Intergenic
984223028 4:177001370-177001392 CTGTAGGAGTAAAAGGAGGGTGG + Intergenic
984822837 4:183898160-183898182 CTGGAGAAGGAGAGGGAGGGCGG - Intronic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985818492 5:2144391-2144413 CTGTTGAGGGAGAGGGAGGTGGG - Intergenic
986175391 5:5348068-5348090 CTCTAGGAGCTCAGGGAGGTAGG + Intergenic
986409932 5:7467317-7467339 GTGTAGGAGAAGAGGGAGCTTGG - Intronic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
989746391 5:44835133-44835155 CTGGAGGAGTAGGGAAAGGTGGG + Intergenic
990147273 5:52776202-52776224 GTGTAGGGTTAGAGGGAGCTAGG - Intergenic
991747892 5:69765785-69765807 CTATAGGACTAGAGCGAGGAAGG + Intergenic
991749838 5:69789548-69789570 CTATAGGACTAGAGCGAGGAAGG - Intergenic
991799469 5:70345633-70345655 CTATAGGACTAGAGCGAGGAAGG + Intergenic
991801412 5:70369356-70369378 CTATAGGACTAGAGCGAGGAAGG - Intergenic
991827185 5:70640664-70640686 CTATAGGACTAGAGCGAGGAAGG + Intergenic
991829128 5:70664405-70664427 CTATAGGACTAGAGCGAGGAAGG - Intergenic
991891828 5:71345062-71345084 CTATAGGACTAGAGCGAGGAAGG + Intergenic
991986152 5:72288919-72288941 CTGTAGGAAAAGGGGAAGGTGGG - Intronic
993548566 5:89244454-89244476 CTGTAGGAGCACATGGAGTTTGG + Intergenic
993846682 5:92953280-92953302 CTGTGGTAGTAGAGGTAGGTTGG + Intergenic
993903353 5:93598696-93598718 CTGTACGAGGAGGGGGTGGTGGG + Intergenic
994092154 5:95818973-95818995 CTATAGGAGCTGAGGGAGATGGG - Intronic
994430914 5:99660152-99660174 ATGAAGGAGTAGATGGGGGTAGG - Intergenic
996000917 5:118362461-118362483 CTGTCGGTGTAGGGGGAGGAGGG + Intergenic
997280708 5:132642971-132642993 ATGTAGGAGAAGAAGGTGGTGGG - Exonic
997792464 5:136772915-136772937 CTGGAGGAGAAAAGGGAGGAGGG + Intergenic
998130449 5:139648909-139648931 CCGGGGGAGGAGAGGGAGGTAGG - Intronic
1001588644 5:172850485-172850507 TCGGGGGAGTAGAGGGAGGTGGG + Intronic
1002076690 5:176712639-176712661 CTGGGGCAGGAGAGGGAGGTGGG + Intergenic
1002275952 5:178104600-178104622 CAGTAGGTTTAGAGGGAGGGTGG + Intergenic
1002456908 5:179350505-179350527 CTGGAGGAGAAGTGGGAAGTGGG - Intergenic
1003034824 6:2633387-2633409 CTGCAGGAGCTGGGGGAGGTTGG - Intronic
1003156692 6:3603139-3603161 CTGTGGGGGTAGTGGCAGGTTGG + Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1005134852 6:22556318-22556340 CTGCTGGAGTAGAGGAAGGATGG - Intergenic
1006333927 6:33410879-33410901 CTGTTGGAGGTGAGGGAGGTGGG + Intronic
1007167468 6:39839025-39839047 CTGTGGGAGGAGAGAGAGGGGGG - Intronic
1007265743 6:40594580-40594602 ATGTAGGGTGAGAGGGAGGTGGG + Intergenic
1007373586 6:41442319-41442341 CTGTAGGAGGAGAGGAAGTAGGG + Intergenic
1007870683 6:45034145-45034167 CTGTTGGAGGAGGAGGAGGTAGG - Intronic
1012330010 6:97973617-97973639 AAGTAGAAGTTGAGGGAGGTTGG + Intergenic
1012743282 6:103048431-103048453 CTGTAGTAATAAAGGTAGGTTGG - Intergenic
1013317675 6:108957632-108957654 GTGCAGGGCTAGAGGGAGGTAGG - Intronic
1013463876 6:110400301-110400323 CTCTCGGAGTAGTGGGAGCTGGG + Intronic
1015099047 6:129452513-129452535 CTGTAAGAGTATAGGAGGGTTGG + Intronic
1016542052 6:145177587-145177609 TAGTGGGGGTAGAGGGAGGTGGG + Intergenic
1017689257 6:156946685-156946707 TTGTTGGAATAGAGGGAGGGAGG + Intronic
1018681087 6:166265944-166265966 CTTGAGGAGGACAGGGAGGTTGG + Intergenic
1018734216 6:166675312-166675334 CTGAAGGAGCAGGGGTAGGTGGG - Intronic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1019729545 7:2622670-2622692 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019729556 7:2622695-2622717 CAGGAGGAGCAGGGGGAGGTGGG - Intergenic
1019779239 7:2929857-2929879 CTGCAGGGGGAGAGGGTGGTGGG + Intronic
1021210187 7:17841243-17841265 CTGTAGGAGTCAAGGGAGAAAGG - Intronic
1022108973 7:27216321-27216343 AAGGAGGGGTAGAGGGAGGTGGG + Intergenic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022662376 7:32379066-32379088 CTGGAGCAGGAGAGGTAGGTAGG - Intergenic
1023061466 7:36331392-36331414 CGGTGGGAGTAGGGGAAGGTGGG - Intronic
1023295630 7:38712466-38712488 CTGGTGGCGTAGGGGGAGGTAGG + Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024232943 7:47376640-47376662 TTTTTGGAGTGGAGGGAGGTTGG - Intronic
1024621524 7:51161894-51161916 ATGTAGGAGTAAAGTGACGTGGG - Intronic
1025245289 7:57312496-57312518 CTGAAGGACGAGTGGGAGGTGGG + Intergenic
1026157663 7:67841331-67841353 GGGTAGGAGTTGATGGAGGTCGG - Intergenic
1026899001 7:74027147-74027169 CTGTGGGGGAACAGGGAGGTGGG - Intergenic
1028231807 7:88314633-88314655 CTTTAGAAGCAGGGGGAGGTAGG + Intergenic
1030444992 7:109638067-109638089 AGGTAGGAGTAGAGGGTGTTAGG + Intergenic
1031377816 7:121049423-121049445 GGGTAGCAGTAGAGAGAGGTGGG - Intronic
1031970098 7:128058538-128058560 ATGTTGGACTAGAGGCAGGTAGG + Intronic
1032234187 7:130105666-130105688 CTCTAGAAGTGAAGGGAGGTTGG + Intronic
1032516376 7:132509150-132509172 CTGGAGGAGAAGAGGGAGGGAGG + Intronic
1033007122 7:137578403-137578425 CTGTAGGATAGGAGGGAGCTGGG - Intronic
1033546387 7:142405200-142405222 CAGTAGGAATAGATGGAGTTGGG + Intergenic
1033662332 7:143410716-143410738 GTGTGGGAGTAGAGGGAGAGAGG - Intergenic
1034204845 7:149306403-149306425 CTGGAGGAGGAGAGGGAGCTGGG + Intergenic
1034280010 7:149846751-149846773 CTGTGGGAGAAGAGGGAGGTGGG + Intronic
1035060025 7:156062355-156062377 CTGCAGGAGCAGGGGGAGTTGGG - Intergenic
1036441298 8:8783226-8783248 CTGTTGGAGCTGTGGGAGGTGGG - Intergenic
1037510662 8:19578652-19578674 GTATAGGTCTAGAGGGAGGTGGG - Intronic
1037638175 8:20719361-20719383 CTCGAGGACTAGAGGGAGTTGGG + Intergenic
1038660209 8:29490636-29490658 CTGTTGGAGGAAAGGCAGGTGGG + Intergenic
1041367023 8:57117280-57117302 CTTTAGGAATAGAGCAAGGTAGG + Intergenic
1042732671 8:71954607-71954629 CTGAAAGAGTAGAGGTAGTTAGG + Intronic
1042847319 8:73181399-73181421 CTGCAGGAGCAGATGGTGGTTGG + Intergenic
1043632398 8:82352627-82352649 CTCTATCAGTATAGGGAGGTGGG - Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1045203191 8:100008570-100008592 CTGAAGGAGAAGAGGGAAGAAGG + Intronic
1047345424 8:124023421-124023443 CTGTGGGAATAGAGGGAGTTGGG - Intronic
1048529416 8:135234082-135234104 CTGGAGGAGGAGAGGAAGGAAGG - Intergenic
1048605338 8:135962624-135962646 CTGTGGGAGGAGGGGGAGGCTGG - Intergenic
1048704156 8:137131661-137131683 CTGTAACACTAGAGGAAGGTAGG - Intergenic
1049035869 8:140075448-140075470 CTGGAGGAGGAGAGGGATGTGGG - Intronic
1049675830 8:143888608-143888630 CTGAAGGAGCAGGGAGAGGTCGG + Intergenic
1050297651 9:4222120-4222142 CTGGTGGAGAAGAGGGAGGGAGG - Intronic
1050308171 9:4327245-4327267 CTGAGAGAGCAGAGGGAGGTGGG + Intronic
1050774798 9:9246486-9246508 CTGTGGGAGTGGAGGCAGGAAGG - Intronic
1052778258 9:32754854-32754876 GTGGAGGAGGAGAGTGAGGTGGG - Intergenic
1052984784 9:34478964-34478986 AAGGAAGAGTAGAGGGAGGTAGG + Intronic
1053788029 9:41666177-41666199 CTTTAGTGGTAGAGGGTGGTAGG + Intergenic
1053886844 9:42650044-42650066 CAGTAGGTTTAGAGGGAGGGTGG - Intergenic
1054157104 9:61648591-61648613 CTTTAGTGGTAGAGGGTGGTAGG - Intergenic
1054176305 9:61877519-61877541 CTTTAGTGGTAGAGGGTGGTAGG + Intergenic
1054225863 9:62457494-62457516 CAGTAGGTTTAGAGGGAGGGTGG - Intergenic
1054476879 9:65579596-65579618 CTTTAGTGGTAGAGGGTGGTAGG - Intergenic
1054661234 9:67703289-67703311 CTTTAGTGGTAGAGGGTGGTAGG - Intergenic
1055435294 9:76286703-76286725 CTGTAGGAGCACTTGGAGGTAGG + Intronic
1056000704 9:82213392-82213414 CAGGAGGAATAGAGAGAGGTGGG - Intergenic
1056319133 9:85420146-85420168 ATGTAAGAGTAAGGGGAGGTGGG + Intergenic
1056577761 9:87869089-87869111 CTGTAGGAGAAGAGAGAAGATGG + Intergenic
1057171974 9:92968472-92968494 CTGTGGGAGTGGATGGAGGAGGG - Intronic
1058187429 9:101871419-101871441 CTGTGGGAGTCGGGGGTGGTGGG - Intergenic
1058537376 9:105976196-105976218 CTTCAGGAGTAAAGGGGGGTTGG - Intergenic
1058714740 9:107713605-107713627 GTGGAGGAGTAGAGGGAGGGAGG + Intergenic
1058987387 9:110220832-110220854 CTGGAGAAGTAGTGGGAGGGGGG + Intergenic
1060061675 9:120466310-120466332 CTGAGGGAGTAGATGGAGTTAGG - Intronic
1060673334 9:125490017-125490039 CTGTAGGAGTGTGGTGAGGTAGG - Intronic
1185663538 X:1745988-1746010 CTGTAGGAGCAGAGACATGTCGG + Intergenic
1185713026 X:2319245-2319267 CTGCAGGAGTAGGGAGAGGAGGG - Intronic
1185750479 X:2607060-2607082 CTGGAGGGGTAGAGAGAGATGGG - Intergenic
1187180185 X:16936574-16936596 TGGTAGTAGGAGAGGGAGGTAGG + Intergenic
1187418106 X:19111015-19111037 TAGTAGGAGTAGAGAGAAGTGGG + Intronic
1189386340 X:40539811-40539833 CTGTAGGAGGAGGAGGAAGTGGG - Intergenic
1189776484 X:44474484-44474506 CTGTGGGAGTAGAGTGTGGCTGG + Intergenic
1190578639 X:51868736-51868758 ATGTTGATGTAGAGGGAGGTTGG + Intronic
1192239528 X:69318424-69318446 CTGTGGAAGGAGTGGGAGGTTGG + Intergenic
1192617793 X:72646041-72646063 CTGCATGTATAGAGGGAGGTGGG + Intronic
1193904425 X:87225402-87225424 TTCTAGGAGTACAGGGATGTGGG + Intergenic
1194346422 X:92771790-92771812 CTGTAGGGGAAGGGGGTGGTAGG - Intergenic
1195298559 X:103504177-103504199 CTGGAGGAGTGGGGAGAGGTGGG + Intronic
1196059811 X:111395844-111395866 CACTAGGAGAAGAGAGAGGTTGG + Intronic
1196798761 X:119523613-119523635 CTATAGGAGGAGAGGGGGATAGG + Intergenic
1197339072 X:125243765-125243787 CTGTAGGTGTGGAAGTAGGTGGG + Intergenic
1197344633 X:125318041-125318063 CTGGAGGAGTAGGGGGATGTAGG - Intergenic
1197371749 X:125635441-125635463 ATGCAGGGGTTGAGGGAGGTTGG + Intergenic
1198270373 X:135051401-135051423 CTGGAGGAGTGGAGGTGGGTTGG + Exonic
1199858110 X:151776911-151776933 CTGTGGGAGCAGAGGGTGGGTGG - Intergenic
1200654759 Y:5888439-5888461 CTGTAGGGGAAGGGGGTGGTAGG - Intergenic
1201921027 Y:19233350-19233372 CTGAAGCTGTATAGGGAGGTTGG - Intergenic