ID: 1081909835

View in Genome Browser
Species Human (GRCh38)
Location 11:46693897-46693919
Sequence TAAATGGCTCTCTGGAGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 215}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081909835_1081909849 30 Left 1081909835 11:46693897-46693919 CCCCCTCTCCAGAGAGCCATTTA 0: 1
1: 0
2: 0
3: 9
4: 215
Right 1081909849 11:46693950-46693972 ACTGAGCCAAATCTGACCCTGGG 0: 1
1: 0
2: 1
3: 13
4: 139
1081909835_1081909848 29 Left 1081909835 11:46693897-46693919 CCCCCTCTCCAGAGAGCCATTTA 0: 1
1: 0
2: 0
3: 9
4: 215
Right 1081909848 11:46693949-46693971 GACTGAGCCAAATCTGACCCTGG 0: 1
1: 0
2: 0
3: 12
4: 118
1081909835_1081909843 6 Left 1081909835 11:46693897-46693919 CCCCCTCTCCAGAGAGCCATTTA 0: 1
1: 0
2: 0
3: 9
4: 215
Right 1081909843 11:46693926-46693948 CACCACTGGAAAGAACCCACTGG 0: 1
1: 0
2: 1
3: 15
4: 141
1081909835_1081909844 7 Left 1081909835 11:46693897-46693919 CCCCCTCTCCAGAGAGCCATTTA 0: 1
1: 0
2: 0
3: 9
4: 215
Right 1081909844 11:46693927-46693949 ACCACTGGAAAGAACCCACTGGG 0: 1
1: 0
2: 0
3: 14
4: 153
1081909835_1081909840 -8 Left 1081909835 11:46693897-46693919 CCCCCTCTCCAGAGAGCCATTTA 0: 1
1: 0
2: 0
3: 9
4: 215
Right 1081909840 11:46693912-46693934 GCCATTTACCAGCACACCACTGG 0: 1
1: 3
2: 36
3: 107
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081909835 Original CRISPR TAAATGGCTCTCTGGAGAGG GGG (reversed) Intronic
900738051 1:4311662-4311684 TCAATGGCTGCCTGCAGAGGAGG - Intergenic
902995271 1:20220036-20220058 TAAATAGCTCTCTGGTTAAGAGG - Intergenic
903754383 1:25650734-25650756 TAAATGGCTATTAGGAGAGCTGG + Intronic
904401299 1:30258274-30258296 TAAAATGATCTCTGGAGAAGGGG - Intergenic
905305365 1:37014093-37014115 GAAGGGCCTCTCTGGAGAGGTGG - Intronic
906238896 1:44229483-44229505 TAATTGGCTCTCTGGGGCAGCGG - Intronic
907512760 1:54974012-54974034 TAAATGAATATCTTGAGAGGTGG + Intergenic
907694412 1:56707565-56707587 TGAATGGCTCTCTGCAGTTGTGG - Exonic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
909580570 1:77228870-77228892 TAAATGGCTCACTGGAAGGAGGG - Intergenic
910006999 1:82410089-82410111 TAAATGTTTTTTTGGAGAGGAGG - Intergenic
913171140 1:116233490-116233512 CACATGGCTCTCAGGAGAGAGGG - Intergenic
914757477 1:150572123-150572145 TAAATACCTCTCTAGTGAGGTGG - Intergenic
916246302 1:162691612-162691634 CAACTGGCTCTGTGGGGAGGCGG + Intronic
917926814 1:179796105-179796127 TGAATGTTTCTCTGGAGAAGGGG - Intronic
919867460 1:201793158-201793180 CAAAGGGCTCTCTGGATAAGAGG - Intronic
920384681 1:205562520-205562542 TGAATGGCTCTCTGTAGAATGGG + Intergenic
1062905643 10:1177977-1177999 TAAATAGATCTCTAGAGATGTGG + Exonic
1064429783 10:15260864-15260886 TAAATGTCTCTGGGGAGGGGGGG + Intronic
1067120938 10:43471608-43471630 AAAATGGCTCTCAGCAGAGAGGG + Intronic
1068015915 10:51516159-51516181 AAAGTGGCTCTCAGGAGAGAAGG + Intronic
1069087503 10:64158478-64158500 AAAATGTTTCACTGGAGAGGTGG + Intergenic
1069279223 10:66633086-66633108 TAAATTGCTCTCTGAAAAGTTGG - Intronic
1069513229 10:69057446-69057468 TTATTGTCTCCCTGGAGAGGAGG + Intergenic
1071149768 10:82620385-82620407 GAAATGGCTCTCGGCAGAGAGGG + Intronic
1077549382 11:3193320-3193342 CAAGGGGCTCTATGGAGAGGAGG - Intergenic
1077881666 11:6355183-6355205 AAAATGGCTCTGGGAAGAGGGGG - Intergenic
1078566192 11:12416532-12416554 TATATGGCTCTCTGTACAGCTGG + Intronic
1078658055 11:13260807-13260829 TCAAAGGCTTTCAGGAGAGGAGG + Intergenic
1079341914 11:19618475-19618497 TATATGGCTGTCTGGATAGATGG + Intronic
1079361801 11:19776441-19776463 TTCAAGGCCCTCTGGAGAGGAGG - Intronic
1081909835 11:46693897-46693919 TAAATGGCTCTCTGGAGAGGGGG - Intronic
1082663828 11:55949357-55949379 AAAATGGCTCTCAGGGGAGAGGG - Intergenic
1084403648 11:68959046-68959068 CAAAGGCCTCTCTGAAGAGGTGG + Intergenic
1087953868 11:104259208-104259230 TAAATGGGTCTCTGTTGTGGAGG + Intergenic
1089089863 11:115862527-115862549 TATATGCCACTCTGGAGAGAAGG + Intergenic
1090091891 11:123705331-123705353 TAGATGGCTCTAGGGAGTGGAGG - Intergenic
1091536712 12:1417164-1417186 TAAATTTCTTTGTGGAGAGGAGG - Intronic
1091857851 12:3753368-3753390 TCGCTGGCTCACTGGAGAGGTGG + Intronic
1091927701 12:4369418-4369440 TAAATGCCTCTTAGGAGAGTTGG + Exonic
1092240759 12:6834988-6835010 TAGAAGGCTTGCTGGAGAGGTGG + Intronic
1093406403 12:18810052-18810074 TGACTGGCTCTGTGGAGACGCGG + Intergenic
1094809516 12:34123991-34124013 CAATTGCCTCTCTGGGGAGGGGG + Intergenic
1096756559 12:53804434-53804456 TAATTGGCTCTCAGTTGAGGTGG + Intergenic
1097477489 12:60076358-60076380 TCAATGACTCTTTGAAGAGGGGG - Intergenic
1097686480 12:62695809-62695831 TACATGGCTCAAGGGAGAGGAGG + Intronic
1098192505 12:67965131-67965153 TACATGGCTCTCTGGAAAGCAGG + Intergenic
1101727977 12:107403778-107403800 TATGTGGCCCTTTGGAGAGGTGG - Intronic
1111705589 13:91745211-91745233 TAAATCACTCTTTGTAGAGGAGG + Intronic
1111726248 13:92013269-92013291 GAAATGGCTCTCAGCAGAGAGGG + Intronic
1113717722 13:112525016-112525038 GACTTGGCTCTCTGGACAGGAGG - Intronic
1115937111 14:38564355-38564377 TAAATGTCTCTCTAGAGATAAGG - Intergenic
1116683241 14:48004191-48004213 AAATTGGCTTTCTGGAGAGCTGG - Intergenic
1122958561 14:105083994-105084016 TAAATGGATGGATGGAGAGGTGG - Intergenic
1123883659 15:24700704-24700726 TATATGACACTCTGGAAAGGTGG - Intergenic
1124343670 15:28906564-28906586 CAAGTTGCTCTCTGGACAGGTGG + Intronic
1124981513 15:34572230-34572252 CAAATTGCTCTCTTGACAGGTGG - Intronic
1126965176 15:54043808-54043830 TAGATGGCTCTATTGACAGGTGG + Intronic
1128118050 15:65124716-65124738 CAAATGGGTCTCTGGGGAGAAGG - Intronic
1130461292 15:84159720-84159742 TAGAGGGCTCTCTGCAGCGGCGG - Intergenic
1130509801 15:84580218-84580240 CTAATGGCTTTCTGCAGAGGAGG - Intergenic
1130700994 15:86181487-86181509 TGAATGGCTGTCTGGAGATGGGG + Intronic
1132870461 16:2113466-2113488 TACATGGCTGGCTGGAGAGCCGG - Intronic
1132919301 16:2376638-2376660 GAACAGGCTCTCTGGAGAGAGGG - Intergenic
1134204887 16:12229054-12229076 GGAATGGCTCTCTGAGGAGGTGG - Intronic
1134522081 16:14923459-14923481 TACATGGCTGGCTGGAGAGCCGG + Intronic
1134709750 16:16322110-16322132 TACATGGCTGGCTGGAGAGCCGG + Intergenic
1134716963 16:16362140-16362162 TACATGGCTGGCTGGAGAGCCGG + Intergenic
1134949853 16:18346535-18346557 TACATGGCTGGCTGGAGAGCCGG - Intergenic
1134957788 16:18390019-18390041 TACATGGCTGGCTGGAGAGCCGG - Intergenic
1135142263 16:19931958-19931980 TAAATGTCACTCTGGTGTGGGGG + Intergenic
1138989239 16:62370976-62370998 TATATGGTTCTCGGGGGAGGGGG + Intergenic
1140159444 16:72471915-72471937 TAAACTGCTCTGTGGAAAGGGGG + Intergenic
1140915441 16:79489169-79489191 TAAATGGATGTGTGGATAGGTGG - Intergenic
1141137402 16:81475070-81475092 TGGCTGGCCCTCTGGAGAGGAGG + Intronic
1143751154 17:9028856-9028878 TAAATGGCTCTCTAGGGAACTGG + Intronic
1144682535 17:17205368-17205390 TGAAGGGCTCTGGGGAGAGGCGG - Intronic
1144769081 17:17749204-17749226 GCACTGGCTCTCTGGGGAGGCGG - Intronic
1144959124 17:19034938-19034960 GAAAGGGCTCTCTGAGGAGGTGG - Intronic
1144976035 17:19139586-19139608 GAAAGGGCTCTCTGAGGAGGTGG + Intronic
1147878258 17:43637089-43637111 TAAATGGCTTTGTAGAGATGGGG - Intergenic
1149644388 17:58229170-58229192 TTAATTGCTCTCTTGAGAGAGGG + Intronic
1150932086 17:69596019-69596041 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
1151198269 17:72447274-72447296 TGAATGGTGCTCTGGAGAGGGGG - Intergenic
1151528196 17:74685910-74685932 TAATTGGGTCTCAGGAGTGGAGG + Intronic
1155017865 18:21863449-21863471 GAAATGGCTCTCAGCAGAGAGGG + Intronic
1158140031 18:54245734-54245756 TCAGTGGCTCTCTGGAGAAGGGG - Intergenic
1161801549 19:6419069-6419091 AACATGGCTGTCTGGAGATGGGG + Intronic
1163833380 19:19558641-19558663 CAAATTGCTCTCTGCAGAGCAGG + Intergenic
1166959367 19:46488508-46488530 TTATTGGCTCTGTAGAGAGGAGG - Intronic
1168486638 19:56768160-56768182 AAAAAGGCTCTCTGAAGAGATGG - Intergenic
925311028 2:2881884-2881906 GAAGTGGCTCTCTGGAGGTGGGG - Intergenic
926542116 2:14193838-14193860 TAAATGGTTCTCTGCAGCCGAGG + Intergenic
928996975 2:37303218-37303240 GAAATGGCTCTCAGCAGAGTGGG - Intronic
929094787 2:38253067-38253089 AAATTGGCCCTCTGGATAGGTGG + Intergenic
933633259 2:84680466-84680488 GAAAGGCCTCTCTGGAGAGACGG + Intronic
933700915 2:85254973-85254995 CAACTGGCTGTCTTGAGAGGTGG + Intronic
937143910 2:119626260-119626282 TAAAAGGCACTCTGCAGATGGGG - Intronic
937716791 2:125040833-125040855 TCATTGGCTCTCTGGACAAGAGG - Intergenic
939060793 2:137419455-137419477 GAAATAGCTCTCTGCAGAGATGG + Intronic
941027171 2:160469579-160469601 GAAAAGGGTCTGTGGAGAGGTGG - Intronic
942143637 2:173003225-173003247 AAAATAGCGCTCTGGAGAGAAGG + Intronic
942484381 2:176423878-176423900 TAGCTGGGTCTCTGGAGAAGGGG + Intergenic
942486991 2:176450530-176450552 TAATTGGCACTCTGGAGGGAAGG + Intergenic
944406272 2:199387297-199387319 CAAATGGGCCCCTGGAGAGGAGG + Intronic
944488715 2:200234848-200234870 TAAATTTCTATCTGGAGAGAGGG + Intergenic
944680041 2:202069051-202069073 TGAATGCCACTCTGGAGAGGCGG - Intergenic
944680200 2:202070330-202070352 TGAATGCCACTCTGGAGAAGTGG - Intergenic
946910390 2:224454932-224454954 TTAAAGGCTCTGTGGAGAGCTGG + Intergenic
947903797 2:233744604-233744626 TACTTGGCTCTATAGAGAGGTGG + Intronic
947905190 2:233755954-233755976 TACTTGGCTCTATAGAGAGGTGG + Intronic
948094455 2:235322273-235322295 TAGATAACTCTCTGGAGAAGGGG - Intergenic
1168865919 20:1086527-1086549 AAAATGGCACCCTTGAGAGGAGG + Intergenic
1169048886 20:2559671-2559693 TAAAAGCCTCTCTGTAAAGGTGG - Intronic
1170597437 20:17816654-17816676 CAAATGGCTCGCTGGAAAGCCGG + Intergenic
1171026929 20:21639323-21639345 TAAAAGCCTATGTGGAGAGGAGG - Intergenic
1172315427 20:33950376-33950398 TGAATGTCTATCTTGAGAGGTGG + Intergenic
1173181821 20:40811994-40812016 AAGATGGCTCTCTGGAGGAGAGG + Intergenic
1177801586 21:25833710-25833732 AAAATGGCTCTCAGGGGAAGGGG - Intergenic
1178274246 21:31221976-31221998 TTAATAGCTGTATGGAGAGGTGG + Intronic
1181648858 22:24247939-24247961 TAAATGAGGCACTGGAGAGGCGG - Intergenic
1182371127 22:29811770-29811792 TGAAAGGCTCTTTGGAGATGGGG - Intronic
1184592794 22:45496360-45496382 GGAAAGGCTCTCTGCAGAGGTGG + Intergenic
1184606647 22:45578276-45578298 TAAATGGCTCTTTGGCAAGACGG - Intronic
950935330 3:16833844-16833866 TGAATTGCTCTGTGCAGAGGAGG - Intronic
951692460 3:25410861-25410883 CAAGTGGCTCTCTGCAGAGCAGG - Intronic
952927310 3:38329451-38329473 TCCCTGGCTCTGTGGAGAGGGGG + Intergenic
953217785 3:40937393-40937415 TACATTGCTCTCTGGAGAACAGG - Intergenic
953472591 3:43179743-43179765 CAGATGGCTCTGTGGAGAGATGG + Intergenic
954300976 3:49700622-49700644 GTAATGGATCTGTGGAGAGGGGG - Exonic
955109661 3:55935786-55935808 GGAATGGCTGTCTGGAGAGCAGG - Intronic
955266137 3:57447032-57447054 TAGATGGCTCACTGCAAAGGGGG + Intronic
955536156 3:59925696-59925718 TAAATAGCTCACTGTACAGGTGG + Intronic
958044242 3:88264864-88264886 AAAATGGTTCTCAGGAGACGAGG - Intergenic
959900446 3:111654935-111654957 TACATGGCTCTCAGGATATGAGG - Intronic
962119616 3:132548091-132548113 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
962474361 3:135742380-135742402 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
963378826 3:144503827-144503849 CAAATGGCTCTCAGCAGAGAGGG + Intergenic
963633275 3:147760741-147760763 TTAATGGCACTCTGGAGAATGGG - Intergenic
965039700 3:163490567-163490589 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
965123641 3:164595664-164595686 AAAATGGCTCTCAGCAGAGAGGG + Intergenic
966958428 3:184908769-184908791 GAAATGGCTTTCTGCAGAGAGGG + Intronic
967175042 3:186855190-186855212 TCAATGGCTCTCAGGTGAGGTGG - Exonic
967984897 3:195087262-195087284 AAAATGTCTCCCTGGAGAGTGGG - Intronic
969278890 4:6155857-6155879 TGAATGGCACTCTCTAGAGGTGG + Intronic
970084698 4:12333804-12333826 TAAATTTTTCTCTGGAGAGGTGG - Intergenic
971246870 4:24937216-24937238 TAAATGGAACTCAGGAGGGGTGG + Intronic
971959822 4:33471341-33471363 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
974003565 4:56534167-56534189 TAAGTGGTTCTCTAGAGAAGGGG - Intronic
974136035 4:57819731-57819753 TTAATGGTTCTCCGGAGAAGTGG + Intergenic
974388897 4:61239012-61239034 CAAATGTCTTTCTGGAGAGTAGG - Intronic
977220477 4:94332217-94332239 GAAATGGCTCTCAGCAGAGAGGG - Intronic
977354612 4:95929701-95929723 TAATTGTCTCTCTGGAGATTTGG + Intergenic
977570546 4:98624914-98624936 TTAATGCCTCTCTGTATAGGAGG - Intronic
982112129 4:152066385-152066407 TAAATGTTTGTCTGGTGAGGTGG - Intergenic
983192235 4:164766884-164766906 GAAATGCCTCTGTGGGGAGGTGG + Intergenic
983485251 4:168324796-168324818 CAAATGAATCTCTGCAGAGGAGG + Intergenic
984194795 4:176646146-176646168 CCAATGGCTCTCTGGAGATGGGG - Intergenic
985803025 5:2018355-2018377 TAAATGCCGCTCTGGACGGGTGG + Intergenic
987683636 5:21168278-21168300 TAAATGGCTCTCTGTAAACCTGG - Intergenic
988989546 5:36656345-36656367 TACATGGCTCTAGAGAGAGGGGG - Intronic
991527725 5:67580513-67580535 AAAATGGCTCTCTTGAGCTGAGG - Intergenic
991634210 5:68687107-68687129 TAAATCGGTCTCTGGAAAAGAGG - Intergenic
992522589 5:77570815-77570837 TAATTTGCTCTCTGAAGAGATGG - Intronic
998199959 5:140111867-140111889 GAAATGGCTCTCTGAAGGGAAGG - Intronic
999329360 5:150662193-150662215 TAACTTGCCCTCTGGAGAAGAGG - Intronic
999627308 5:153534327-153534349 TAAATGCCCCTCTGGGGAGAAGG + Intronic
1000308489 5:160018374-160018396 GGAAAGCCTCTCTGGAGAGGTGG + Intronic
1000501290 5:162054200-162054222 TAAATTTTTTTCTGGAGAGGAGG - Intergenic
1001052780 5:168426264-168426286 AAAATTGTTCCCTGGAGAGGAGG + Intronic
1002959521 6:1901103-1901125 TAAAAGGCTCACTGGAAAGCAGG - Intronic
1002961835 6:1922803-1922825 GAAATGGCTCTCAGCAGAGACGG - Intronic
1002971525 6:2027103-2027125 TAAATGGCTCCATGAAGAAGAGG + Intronic
1004542161 6:16561386-16561408 AAAATGTATCTGTGGAGAGGTGG - Intronic
1005033271 6:21531330-21531352 AAATTGGCTCTCTGGGGTGGGGG + Intergenic
1005522752 6:26614495-26614517 GAACTGCCTCTCGGGAGAGGAGG + Intergenic
1006884749 6:37371834-37371856 TAAGAGGCTCTCTGGGGAAGTGG + Intronic
1009036708 6:58125541-58125563 TATACAGCACTCTGGAGAGGTGG + Intergenic
1009212510 6:60879149-60879171 TATACAGCACTCTGGAGAGGTGG + Intergenic
1012665563 6:101964324-101964346 TGAATGTTTCACTGGAGAGGAGG + Intronic
1013231562 6:108165694-108165716 TATCTGGCACTCTGGAGAGAGGG + Intronic
1016126755 6:140413026-140413048 TACATGGCTTTCTGGGGAGTAGG + Intergenic
1016630649 6:146226208-146226230 TGAATTGCTCTCTGGAAAGAAGG - Intronic
1017053396 6:150415488-150415510 TAGATGCTTATCTGGAGAGGAGG + Intergenic
1018654770 6:166024750-166024772 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
1019369832 7:656026-656048 AAAATGACTTTCTGGGGAGGTGG - Intronic
1022066230 7:26860674-26860696 TAAATGGAACTTTGGAAAGGTGG + Intronic
1023745439 7:43318778-43318800 AAAAGGGCTCTCTGCAGAGCTGG + Intronic
1024579044 7:50787249-50787271 AAAATGGGGCTCTGGAGAGCAGG + Intronic
1026479488 7:70765584-70765606 TATATGGCTCTCTGTATTGGCGG - Intronic
1027452301 7:78346103-78346125 TGTATGGCTCTATGGAGAGCAGG + Intronic
1028432539 7:90763839-90763861 TAAATGGCTTTGTATAGAGGGGG + Intronic
1029947428 7:104547633-104547655 AACATGGCTCTCTGGACAGCTGG - Intronic
1030616629 7:111744188-111744210 CAAGTGGCTCTCTGCAGTGGAGG + Intronic
1041870671 8:62631201-62631223 ACAATGTCTCTCTGGAGATGTGG - Intronic
1045568320 8:103343733-103343755 CAAGGGGCACTCTGGAGAGGTGG - Intergenic
1046815946 8:118583729-118583751 TAAAAGGCTTTCTGAAGAAGAGG - Intronic
1047885799 8:129248963-129248985 TAAGTGACTCAGTGGAGAGGTGG - Intergenic
1047964380 8:130034910-130034932 TAAGTGGATCTCTGGATAAGCGG + Intergenic
1048235641 8:132687431-132687453 AAAAAGACTCTCTGGAGAGCAGG - Intronic
1048641690 8:136370227-136370249 GAAATGGCTCTCAGCAGAGAGGG + Intergenic
1048980636 8:139702029-139702051 TCAATTGCTCTCAGTAGAGGTGG - Intronic
1053274835 9:36775502-36775524 TAAATGGCTCTCTTGAAAATAGG + Intergenic
1053290186 9:36874550-36874572 TGCTTGGCTATCTGGAGAGGAGG - Intronic
1055074027 9:72195203-72195225 AAAATGGCTAATTGGAGAGGCGG - Intronic
1056429832 9:86516378-86516400 GAAATGGCTCTCAGCAGAGAGGG - Intergenic
1058106129 9:100973864-100973886 TAAATGTTTCTCTTCAGAGGTGG + Intergenic
1058283917 9:103152591-103152613 TGAAAGGCTCTCTGAAGAGCAGG - Intergenic
1059571896 9:115446576-115446598 TAAATGTTTCTCTGGTGAGTTGG + Intergenic
1060108563 9:120890505-120890527 TAATTAGCTCTCTGGGCAGGAGG + Intronic
1061619839 9:131804822-131804844 TAAATGGCACTCTAGAGTGGGGG - Intergenic
1062510403 9:136902263-136902285 GAGATGGCTCCCTGGGGAGGTGG + Intronic
1187726636 X:22209830-22209852 TAAATGTCTCTGTGGAGGTGGGG - Intronic
1188854277 X:35173200-35173222 TAAATGGCTAGCTGGATAGCTGG + Intergenic
1189583469 X:42432067-42432089 TAAAAGGCTCTTTGCAGAAGTGG - Intergenic
1189676727 X:43468186-43468208 AAAATGGCTCTCAGCAGAGAGGG + Intergenic
1190156181 X:47994609-47994631 TAAATCACCCTCTGGAGAGAAGG - Intronic
1191627428 X:63283868-63283890 TACACGGCTCTAAGGAGAGGAGG + Intergenic
1191893993 X:65973876-65973898 TACATGTCTCTCTGTTGAGGTGG - Intergenic
1194980124 X:100431984-100432006 TAAATCCCTCTCTGGAAAAGTGG + Intergenic
1195853221 X:109305491-109305513 GAAATGGCTCTCAGGGGAGAAGG + Intergenic
1196090848 X:111740545-111740567 TAAACGGCTCTGTGGAGAAATGG + Intronic
1198177228 X:134168545-134168567 TGAATGAATCTCTGGAGATGGGG + Intergenic
1202377963 Y:24255424-24255446 TAGAGGGCTCTCTGCAGCGGCGG + Intergenic
1202492819 Y:25414697-25414719 TAGAGGGCTCTCTGCAGCGGCGG - Intergenic