ID: 1081911912

View in Genome Browser
Species Human (GRCh38)
Location 11:46705203-46705225
Sequence TGGCCGGGCGTTTCGTCAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 17}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081911903_1081911912 13 Left 1081911903 11:46705167-46705189 CCATACAGGAGAAAAGCCTTTCC 0: 1
1: 0
2: 1
3: 27
4: 251
Right 1081911912 11:46705203-46705225 TGGCCGGGCGTTTCGTCAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 17
1081911902_1081911912 25 Left 1081911902 11:46705155-46705177 CCATATGAGGCTCCATACAGGAG 0: 1
1: 0
2: 0
3: 1
4: 74
Right 1081911912 11:46705203-46705225 TGGCCGGGCGTTTCGTCAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 17
1081911904_1081911912 -3 Left 1081911904 11:46705183-46705205 CCTTTCCTGTGCCCGCACTGTGG 0: 1
1: 1
2: 2
3: 28
4: 221
Right 1081911912 11:46705203-46705225 TGGCCGGGCGTTTCGTCAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 17
1081911907_1081911912 -8 Left 1081911907 11:46705188-46705210 CCTGTGCCCGCACTGTGGCCGGG 0: 1
1: 0
2: 1
3: 15
4: 166
Right 1081911912 11:46705203-46705225 TGGCCGGGCGTTTCGTCAGCGGG 0: 1
1: 0
2: 0
3: 3
4: 17

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081911912 Original CRISPR TGGCCGGGCGTTTCGTCAGC GGG Exonic
906514611 1:46431624-46431646 TGGCCGCGCCCTTGGTCAGCTGG - Intergenic
1081911912 11:46705203-46705225 TGGCCGGGCGTTTCGTCAGCGGG + Exonic
1083551691 11:63594752-63594774 AGGCCGGGCGTTTGATCAACGGG + Intronic
1089352345 11:117828729-117828751 TGGCCTGCCCTTTCCTCAGCTGG + Intronic
1102533869 12:113566793-113566815 TGGCTGTGAGTTTCGTGAGCTGG - Intergenic
1106618727 13:31354016-31354038 TGGCAGGGACTTTCGTCAGCAGG - Intergenic
1126403222 15:48295750-48295772 TGGCCTCCTGTTTCGTCAGCAGG - Intronic
1144356924 17:14455141-14455163 TGGCTGGGGGTTTAGTCAGCAGG + Intergenic
1152438967 17:80293676-80293698 TGGCCGGGCGTCTTGGCAGCGGG + Intronic
1161053697 19:2179271-2179293 TGGCCTTGTGTTTCGTCAGGTGG + Intronic
932073503 2:68643577-68643599 TGGCGAGGCGTGTCGCCAGCTGG - Exonic
940962173 2:159798015-159798037 CGGCCGGGTGTTGCGTCTGCGGG + Intronic
1169869734 20:10237868-10237890 TGGCTGGGCCTTTTCTCAGCAGG - Intronic
1175517099 20:59576854-59576876 TGGACGGGCGTTTTGTGAGAGGG + Intergenic
1179951689 21:44712028-44712050 TGGCTGGGGGTTTGGGCAGCAGG + Intergenic
963395123 3:144722439-144722461 TGGATGGGCCTTTCTTCAGCAGG + Intergenic
1001643452 5:173261961-173261983 TGGCTGGGTGGTTCCTCAGCTGG - Intergenic
1026032604 7:66807297-66807319 TGCCCGTGGGGTTCGTCAGCTGG - Intronic
1027230074 7:76267489-76267511 TGGTCGGGCGGGTCGCCAGCGGG + Intronic
1049746259 8:144264556-144264578 CGGCCGGGCGGTTGGTCACCGGG + Exonic
1050997858 9:12242451-12242473 TGGCAGGGCATATCATCAGCAGG + Intergenic