ID: 1081912211

View in Genome Browser
Species Human (GRCh38)
Location 11:46707018-46707040
Sequence CACTTGTAGCACTGTGAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081912211_1081912219 18 Left 1081912211 11:46707018-46707040 CCAAGTTCACAGTGCTACAAGTG No data
Right 1081912219 11:46707059-46707081 CAAAACCTCGCGCTGGAGTCAGG No data
1081912211_1081912216 11 Left 1081912211 11:46707018-46707040 CCAAGTTCACAGTGCTACAAGTG No data
Right 1081912216 11:46707052-46707074 CAGCCCACAAAACCTCGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081912211 Original CRISPR CACTTGTAGCACTGTGAACT TGG (reversed) Intergenic
No off target data available for this crispr