ID: 1081912216

View in Genome Browser
Species Human (GRCh38)
Location 11:46707052-46707074
Sequence CAGCCCACAAAACCTCGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081912211_1081912216 11 Left 1081912211 11:46707018-46707040 CCAAGTTCACAGTGCTACAAGTG No data
Right 1081912216 11:46707052-46707074 CAGCCCACAAAACCTCGCGCTGG No data
1081912209_1081912216 16 Left 1081912209 11:46707013-46707035 CCTGCCCAAGTTCACAGTGCTAC No data
Right 1081912216 11:46707052-46707074 CAGCCCACAAAACCTCGCGCTGG No data
1081912210_1081912216 12 Left 1081912210 11:46707017-46707039 CCCAAGTTCACAGTGCTACAAGT No data
Right 1081912216 11:46707052-46707074 CAGCCCACAAAACCTCGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081912216 Original CRISPR CAGCCCACAAAACCTCGCGC TGG Intergenic
No off target data available for this crispr