ID: 1081912219

View in Genome Browser
Species Human (GRCh38)
Location 11:46707059-46707081
Sequence CAAAACCTCGCGCTGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081912210_1081912219 19 Left 1081912210 11:46707017-46707039 CCCAAGTTCACAGTGCTACAAGT No data
Right 1081912219 11:46707059-46707081 CAAAACCTCGCGCTGGAGTCAGG No data
1081912209_1081912219 23 Left 1081912209 11:46707013-46707035 CCTGCCCAAGTTCACAGTGCTAC No data
Right 1081912219 11:46707059-46707081 CAAAACCTCGCGCTGGAGTCAGG No data
1081912211_1081912219 18 Left 1081912211 11:46707018-46707040 CCAAGTTCACAGTGCTACAAGTG No data
Right 1081912219 11:46707059-46707081 CAAAACCTCGCGCTGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081912219 Original CRISPR CAAAACCTCGCGCTGGAGTC AGG Intergenic
No off target data available for this crispr