ID: 1081914874

View in Genome Browser
Species Human (GRCh38)
Location 11:46724273-46724295
Sequence CCACACCTGCCAACCCTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 168}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081914874_1081914882 27 Left 1081914874 11:46724273-46724295 CCCATGAGGGTTGGCAGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1081914882 11:46724323-46724345 CAACTGACGGAGGTTGGCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 78
1081914874_1081914878 3 Left 1081914874 11:46724273-46724295 CCCATGAGGGTTGGCAGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1081914878 11:46724299-46724321 CACTCGCTAATGCGTCTGTAGGG 0: 1
1: 0
2: 0
3: 1
4: 17
1081914874_1081914879 14 Left 1081914874 11:46724273-46724295 CCCATGAGGGTTGGCAGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1081914879 11:46724310-46724332 GCGTCTGTAGGGTCAACTGACGG 0: 1
1: 0
2: 1
3: 3
4: 57
1081914874_1081914881 21 Left 1081914874 11:46724273-46724295 CCCATGAGGGTTGGCAGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 56
1081914874_1081914880 17 Left 1081914874 11:46724273-46724295 CCCATGAGGGTTGGCAGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1081914880 11:46724313-46724335 TCTGTAGGGTCAACTGACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
1081914874_1081914877 2 Left 1081914874 11:46724273-46724295 CCCATGAGGGTTGGCAGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1081914877 11:46724298-46724320 GCACTCGCTAATGCGTCTGTAGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081914874 Original CRISPR CCACACCTGCCAACCCTCAT GGG (reversed) Intronic
900587585 1:3440546-3440568 CCCCACCTGCCAGACCACATGGG + Intergenic
900635707 1:3664062-3664084 CCACACCTGAGAACCCCCAAGGG + Intronic
901148640 1:7085714-7085736 GCTCACCTGCCAGCCCCCATGGG + Intronic
901783595 1:11610279-11610301 CCACAGCTGTCAACCCTCTGTGG - Intergenic
902644847 1:17791018-17791040 CCCCTCCCCCCAACCCTCATAGG - Intronic
902743702 1:18458676-18458698 CAACACCTGCTCAGCCTCATGGG - Intergenic
904463096 1:30692191-30692213 CCCCACCTCCCAACCTTCAGAGG - Intergenic
905371518 1:37484961-37484983 CCACACCTCACAACTCTCCTAGG + Intergenic
906868662 1:49451611-49451633 CCCCACCTGCAAACCCTGGTAGG + Intronic
908495190 1:64687993-64688015 CCAGTCCTGCCAGCCCACATGGG - Intronic
913254756 1:116943555-116943577 CCACACATGGCAACCATCAGAGG - Intronic
917437232 1:175033784-175033806 CCCAACCTGGCAAACCTCATGGG - Intergenic
918126082 1:181585183-181585205 CCTCACCTCCCAGCCGTCATGGG - Intronic
919791399 1:201293054-201293076 CCAAACCTGCCTTCCCTCCTTGG - Intronic
919879098 1:201890410-201890432 TCTCACCTTCCAACACTCATAGG - Intronic
922644590 1:227273907-227273929 CCAAACCTGTCATCTCTCATTGG - Intronic
1063638999 10:7813074-7813096 CCCCAGCTGCCAACCCTCGTTGG + Intergenic
1065252887 10:23834838-23834860 CCCCACCTGCCACCCCTCCATGG - Intronic
1065498027 10:26349990-26350012 ACCCACCTCTCAACCCTCATGGG + Intergenic
1068106140 10:52619416-52619438 CCACACCTGGAAAGCCACATTGG - Intergenic
1069777682 10:70936363-70936385 CCACAGCAGCTAACCCTAATGGG + Intergenic
1073285106 10:102382780-102382802 CCCCACCTGCCTACCCTCCATGG - Exonic
1074570275 10:114618020-114618042 CCACTCCTCCCAACCCCTATAGG + Intronic
1076662054 10:132062235-132062257 CGACACCTCCCAAGCCTGATGGG - Intergenic
1080395009 11:31882118-31882140 CCACACCTGACTTTCCTCATTGG + Intronic
1080584077 11:33665953-33665975 CCAGACCTGCCAACTCTGAAGGG + Intronic
1081914874 11:46724273-46724295 CCACACCTGCCAACCCTCATGGG - Intronic
1083289698 11:61682915-61682937 CCACACCTGTCTGCCCTCAGAGG - Intronic
1084576206 11:69989519-69989541 CCACACCTTCCATACCTCTTGGG - Intergenic
1084926174 11:72513577-72513599 GCAGACCTGCCAGTCCTCATGGG + Intergenic
1089256843 11:117198696-117198718 ACACCTCTGCCAACCCGCATGGG - Intergenic
1092355925 12:7795155-7795177 CCCCTCCTCCCATCCCTCATAGG + Exonic
1092368444 12:7896532-7896554 CCCCTCCTCCCATCCCTCATAGG - Intergenic
1092368758 12:7898963-7898985 CCCCTCCTCCCATCCCTCATAGG + Intergenic
1094056228 12:26272302-26272324 CCACACCTGGCAGCCCTGAGGGG + Intronic
1094466007 12:30754675-30754697 CCAGACCTGCCCACCCTCGCCGG + Intronic
1096181704 12:49554740-49554762 CCACCCCTGCCAGCTCTCCTTGG + Intronic
1097142217 12:56911552-56911574 CCACAACTGCCCACACTCAATGG - Intergenic
1097440003 12:59596846-59596868 CCACCCCTGCCATCCTTCCTGGG - Intronic
1099369436 12:81811856-81811878 CCACACCTGCCCACACCTATCGG + Intergenic
1101805498 12:108060133-108060155 CCACAAGTGGCAAACCTCATTGG - Intergenic
1103482529 12:121260257-121260279 CCACACCTGCCAATGCCCAGGGG - Intronic
1103716708 12:122949437-122949459 CCTCACCTGCTGACCCCCATGGG + Intronic
1104603875 12:130173106-130173128 CCCAACCTGCCAACTCTCAGGGG + Intergenic
1104939188 12:132386937-132386959 TCGCACCTCCCACCCCTCATGGG + Intergenic
1105805397 13:23949165-23949187 CCAAACCTGCCACCCCACCTGGG - Intergenic
1106561419 13:30849679-30849701 CTAAACCTGCCCACCTTCATTGG + Intergenic
1107682461 13:42865970-42865992 CCCCAGCTGTCAGCCCTCATCGG + Intergenic
1108187690 13:47904605-47904627 CCCCACCTCCCAACCCGAATAGG - Intergenic
1109071287 13:57772543-57772565 CCACACCTGGCCACCATTATTGG - Intergenic
1111399291 13:87711249-87711271 CCTCACCTACCAAGCCTCACAGG - Intergenic
1113113773 13:106852811-106852833 CCAAACCTCCCAACGCTCACAGG + Intergenic
1116826297 14:49676720-49676742 CCACACCTGTCAGGCCTCAAAGG - Intronic
1118278713 14:64409573-64409595 CCCCACCACCCAACCCTCACTGG - Intronic
1121148103 14:91604320-91604342 CCCCTCCTCCCATCCCTCATAGG - Intronic
1124605956 15:31170546-31170568 CCACTCTTGCCAAGCCTCAGTGG + Intergenic
1132372150 15:101306601-101306623 CGAGTCCTGCCAACCCTCCTTGG + Intronic
1132581290 16:685855-685877 CCACCCCAGCCTACCCTCATTGG + Exonic
1133222125 16:4323302-4323324 CCACACCTGCCCACCCACCCGGG - Intronic
1136234392 16:28905099-28905121 CCCCACCTGCCAGCCCCCAAGGG + Intronic
1136477824 16:30524486-30524508 CCACACCTCCCACCCCTGCTGGG + Exonic
1139572754 16:67823570-67823592 CCACAGCTGCCAACCTTAGTGGG - Intronic
1140524237 16:75609068-75609090 CCACACCTGCTAAGGCTCAGGGG - Intronic
1141716350 16:85729269-85729291 CAGCACGTGCCAACCCTTATAGG + Intronic
1141944351 16:87299116-87299138 CCACACCTCCCACCCATCATCGG + Intronic
1144946680 17:18973007-18973029 CCACATCCGCCATGCCTCATGGG + Intronic
1147375069 17:40018395-40018417 CCACAGCTCCCCACCCTCCTGGG - Intergenic
1147669744 17:42170078-42170100 CCAGACCTGCCACGCCTCAGTGG - Intronic
1148142784 17:45340154-45340176 TCACACAAGACAACCCTCATGGG - Intergenic
1148989242 17:51651158-51651180 CCACTCCTGCCCACCCTGCTGGG + Intronic
1152798715 17:82321463-82321485 CCGCACCTGCCGAGCCTCTTTGG - Exonic
1155449464 18:25948560-25948582 CCTAACCTGCCAAACATCATAGG - Intergenic
1156493067 18:37507857-37507879 CCACATCTGCCCATCCTCCTGGG + Intronic
1156736810 18:40270189-40270211 CACAACCTCCCAACCCTCATTGG + Intergenic
1160888961 19:1366890-1366912 CCACACCTCCCACCCCTCGGGGG - Intronic
1161347922 19:3777348-3777370 CCACACATGCAGACCCTCCTGGG + Intergenic
1164909907 19:32000611-32000633 CCACATCTGCCACCCCTGAGAGG + Intergenic
1167214019 19:48152037-48152059 CCACCCCCGCCACCCCTCACTGG + Intronic
1168176996 19:54633474-54633496 CCAGGCCTGCCCACCCTCAGTGG + Intronic
1168271838 19:55254416-55254438 CAACACCAGCCACCCCTCAAGGG + Intronic
1168382932 19:55939461-55939483 CCCCACCCCCCAACCCTTATAGG - Intergenic
925294557 2:2768598-2768620 CCACACCTGGGAACCCTGCTTGG - Intergenic
926806663 2:16717445-16717467 CCACTCCTACCTACCCTCAAAGG - Intergenic
927671471 2:25072167-25072189 CCACAACTGCCAACACGCAGAGG - Intronic
927994375 2:27472886-27472908 CCATCCCAGCCAACCCTAATTGG - Intronic
928239010 2:29570388-29570410 GCACACCTGCCAAGCTTCCTTGG - Intronic
930629951 2:53742180-53742202 CCACAGCTGCCAACCCCCAATGG + Intronic
933944801 2:87276698-87276720 CCATCCCTGCCTACCCACATTGG + Intergenic
935407038 2:102719903-102719925 TCACACCTGCAAAACCTCAGGGG + Intronic
936335409 2:111584881-111584903 CCATCCCTGCCTACCCACATTGG - Intergenic
942204714 2:173608639-173608661 CCACTCATCCCAACCCTCAACGG - Intergenic
945055110 2:205861503-205861525 CCACACCAGACAACCCTCCAGGG + Intergenic
947333477 2:229055110-229055132 CAACACCTGCCATTCATCATTGG + Intronic
947404504 2:229760809-229760831 CCACTCCTGCCCACTCCCATGGG + Intergenic
948729648 2:239954806-239954828 CGTCACCTGCCAACCCACTTGGG - Intronic
1169443968 20:5656293-5656315 CTACACCTGCCCAGCCACATCGG - Intergenic
1171037707 20:21729233-21729255 CCACAGCAGCCAACCCTGAGGGG - Intergenic
1171303704 20:24086224-24086246 GCACACCTGCCTTCCCTCACTGG + Intergenic
1171445337 20:25198835-25198857 CCAAACCTGTCACCTCTCATAGG + Intronic
1178988323 21:37328390-37328412 CCACACCTGACCATCCTGATGGG - Intergenic
1182019408 22:27068293-27068315 CACCTCCTGCCAACCCACATAGG + Intergenic
1185205468 22:49535674-49535696 CGGCACCTGCCTACCCTCCTGGG - Intronic
949443270 3:4106725-4106747 TCAAACCAGCAAACCCTCATTGG - Intronic
950345161 3:12287126-12287148 GCGCACCTGCCAACCCACTTTGG + Intergenic
950428094 3:12935408-12935430 CCACAGCTGCCCACCCTGAGGGG + Intronic
952412444 3:33061828-33061850 CCACATATGCAAACCATCATAGG + Intronic
952610847 3:35206795-35206817 CCAGACCTTCCAACCCTAATAGG + Intergenic
952880887 3:37985723-37985745 CCACTCCTTCCCACCCTCCTGGG - Intergenic
953158737 3:40398573-40398595 CCTGACCTGACATCCCTCATGGG - Intronic
953660972 3:44891284-44891306 CCACACCTGCCCTCTCTCCTGGG + Intronic
954151547 3:48660070-48660092 TCACAGATGCCAACACTCATCGG - Exonic
954426138 3:50444088-50444110 CCACCCCTCACAACCCTGATAGG + Intronic
954792658 3:53144625-53144647 CCAAACCTGCCAACCCTGTGAGG + Intergenic
959398435 3:105869336-105869358 GCCCACCTGCCACCCCTTATTGG - Intronic
962603406 3:137012102-137012124 CCCGACCTGCCAGCCCCCATTGG + Intergenic
966733928 3:183173689-183173711 CCAAACCTCACAAGCCTCATAGG - Intergenic
968047278 3:195631395-195631417 TCACTCCTGCCAACCCTCAGGGG + Intergenic
968307335 3:197658529-197658551 TCACTCCTGCCAACCCTCAGGGG - Intergenic
968669896 4:1843646-1843668 CCACCCCTCCCAGGCCTCATTGG - Intronic
968919737 4:3516288-3516310 TCGCGCCTGCAAACCCTCATAGG - Intronic
969291692 4:6244266-6244288 CCACACCTGACATCCCTTAGAGG + Intergenic
969377510 4:6772528-6772550 CCTGACCTGCAAACCCTCCTAGG + Intergenic
973261776 4:48172475-48172497 CCACCCCTGCCATCCAGCATGGG - Intronic
976718250 4:88146146-88146168 ACAAACCTGCCCACCCTCCTTGG + Intronic
977002337 4:91519385-91519407 GGACACCAGCCAACCCTCACTGG - Intronic
977964900 4:103134287-103134309 CCTCTCCTGCCAACGCTGATTGG + Intronic
983174495 4:164571974-164571996 TCACACCTGCCAACCTTGAGAGG - Intergenic
984782772 4:183540886-183540908 CTCCACTTGCCAACCCACATGGG + Intergenic
986488604 5:8266206-8266228 CCACAACTTCCAACCTTCACAGG + Intergenic
986601204 5:9474811-9474833 TTACACCAGCCAACCCTCAAGGG + Intronic
986746209 5:10747396-10747418 CCTCTGCTGCCAACCCTCCTGGG - Intronic
986771040 5:10973848-10973870 CCAAAACTGCCAACTGTCATTGG + Intronic
992253821 5:74901744-74901766 CCAGTCCTGCCAACACTCAAGGG + Intergenic
993130346 5:83889406-83889428 CATCACCTGACTACCCTCATAGG - Intergenic
994508802 5:100676994-100677016 CAACATCTTCCAACCCACATTGG - Intergenic
997997113 5:138595912-138595934 TCACCCCTGCAAAACCTCATGGG + Intergenic
998960509 5:147481516-147481538 CCACACCTCCCAAGTCTCACAGG + Intronic
1003642663 6:7888630-7888652 CCCCACCTCCCCACCCTCAGAGG - Intronic
1004364311 6:14999083-14999105 CCATTCCTGCCAACCCTCGAGGG - Intergenic
1006057481 6:31396164-31396186 CCCCACCAGCCACCCCTCCTGGG + Intergenic
1006069908 6:31490821-31490843 CCCCACCAGCCATCCCTCCTGGG + Intergenic
1009057901 6:58360247-58360269 CCACAACTGCCAATCTTTATGGG + Intergenic
1010931131 6:81804701-81804723 CCACACCAGACAACACTCATTGG + Intergenic
1011497232 6:87948983-87949005 CCACACCTCCCTGCCCTCATGGG + Intergenic
1011719766 6:90143482-90143504 CCACACCTCCCCACCCTGGTAGG + Intronic
1017461356 6:154653985-154654007 CCTCACCTACCAACCCTCCGTGG - Intergenic
1019183119 6:170204833-170204855 CCAAAACTACCAACCATCATAGG - Intergenic
1019528878 7:1493949-1493971 CCACACCTGCCAGACCTGAGGGG + Intronic
1022299680 7:29091391-29091413 CCCCACCTCCCATCCCTCTTTGG - Intronic
1024554523 7:50592073-50592095 ACACACCTGGCACCCGTCATCGG - Exonic
1034672034 7:152866305-152866327 CCACACTTACCAACTCCCATTGG - Intergenic
1034882664 7:154774355-154774377 CCATCCCTGCCAAGCCTCCTGGG + Intronic
1038214743 8:25551176-25551198 CCACACCTGTCCAGCCTCACTGG + Intergenic
1042306818 8:67342277-67342299 CCTCATCTGCCTAACCTCATAGG + Intronic
1046531964 8:115457811-115457833 GCACACCTGCCCACCCACCTAGG - Intronic
1047231922 8:123004853-123004875 CCCCACCTGCCTATCCACATTGG + Intergenic
1047957353 8:129985831-129985853 CAACACCTGCTCACCCTCAGGGG - Intronic
1048900778 8:139035501-139035523 CCAAACCTGCCTACACTCAATGG - Intergenic
1054166137 9:61731325-61731347 CCCAACCTGCCAAACATCATCGG + Intergenic
1056501362 9:87212948-87212970 CCCCACCTCCCAAACCTCAGCGG + Intergenic
1056630514 9:88289385-88289407 CCCCCACTGCCAACCCCCATGGG - Intergenic
1057078490 9:92154206-92154228 CCACAGATGCCAGCCCTGATGGG - Intergenic
1057391139 9:94642363-94642385 CTAGTCCAGCCAACCCTCATTGG + Intergenic
1057817226 9:98304540-98304562 CCACACCTGCCCAGCCTAAAGGG - Intronic
1058686643 9:107487027-107487049 GCACACCTGCGAACCCACACAGG - Exonic
1060591371 9:124819126-124819148 CCACACCTCCCAACCAGCTTTGG + Intergenic
1061237054 9:129349359-129349381 TCACCCCTGCCACCCCTCACTGG - Intergenic
1062721345 9:138045885-138045907 CCACACCTGCGAACCCCCAAGGG - Intronic
1186398511 X:9234829-9234851 CCACAACTGCCAAACTTCATTGG - Intergenic
1186718205 X:12275705-12275727 CCTCACCTGCCAACTCTCCATGG - Intronic
1187294569 X:17986220-17986242 CCCCACCTGCCACCCCCCCTTGG - Intergenic
1187491985 X:19760813-19760835 CCCCACCTGCCAACAGACATGGG + Intronic
1187810361 X:23169624-23169646 CCACAGCTGGCATCCCTAATTGG - Intergenic
1188646333 X:32572210-32572232 CCATAAATGCTAACCCTCATTGG - Intronic
1189267803 X:39730130-39730152 CCACCCCAGCCAACCCTCAGAGG + Intergenic
1198863116 X:141091889-141091911 CCACCCCTCCCGGCCCTCATAGG - Intergenic
1198899574 X:141495498-141495520 CCACCCCTCCCGGCCCTCATAGG + Intergenic
1199680098 X:150218174-150218196 TCACACCTGCCAGCCCTCTGGGG - Intergenic
1202232206 Y:22669276-22669298 CTCCACCTACCAACCCTCTTGGG + Intergenic
1202310950 Y:23526882-23526904 CTCCACCTACCAACCCTCTTGGG - Intergenic
1202559852 Y:26143712-26143734 CTCCACCTACCAACCCTCTTGGG + Intergenic