ID: 1081914876

View in Genome Browser
Species Human (GRCh38)
Location 11:46724274-46724296
Sequence GCCACACCTGCCAACCCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 179}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081914876_1081914878 2 Left 1081914876 11:46724274-46724296 CCATGAGGGTTGGCAGGTGTGGC 0: 1
1: 1
2: 1
3: 26
4: 179
Right 1081914878 11:46724299-46724321 CACTCGCTAATGCGTCTGTAGGG 0: 1
1: 0
2: 0
3: 1
4: 17
1081914876_1081914881 20 Left 1081914876 11:46724274-46724296 CCATGAGGGTTGGCAGGTGTGGC 0: 1
1: 1
2: 1
3: 26
4: 179
Right 1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 56
1081914876_1081914877 1 Left 1081914876 11:46724274-46724296 CCATGAGGGTTGGCAGGTGTGGC 0: 1
1: 1
2: 1
3: 26
4: 179
Right 1081914877 11:46724298-46724320 GCACTCGCTAATGCGTCTGTAGG 0: 1
1: 0
2: 0
3: 3
4: 41
1081914876_1081914882 26 Left 1081914876 11:46724274-46724296 CCATGAGGGTTGGCAGGTGTGGC 0: 1
1: 1
2: 1
3: 26
4: 179
Right 1081914882 11:46724323-46724345 CAACTGACGGAGGTTGGCCCTGG 0: 1
1: 0
2: 0
3: 4
4: 78
1081914876_1081914880 16 Left 1081914876 11:46724274-46724296 CCATGAGGGTTGGCAGGTGTGGC 0: 1
1: 1
2: 1
3: 26
4: 179
Right 1081914880 11:46724313-46724335 TCTGTAGGGTCAACTGACGGAGG 0: 1
1: 0
2: 0
3: 4
4: 48
1081914876_1081914879 13 Left 1081914876 11:46724274-46724296 CCATGAGGGTTGGCAGGTGTGGC 0: 1
1: 1
2: 1
3: 26
4: 179
Right 1081914879 11:46724310-46724332 GCGTCTGTAGGGTCAACTGACGG 0: 1
1: 0
2: 1
3: 3
4: 57
1081914876_1081914883 30 Left 1081914876 11:46724274-46724296 CCATGAGGGTTGGCAGGTGTGGC 0: 1
1: 1
2: 1
3: 26
4: 179
Right 1081914883 11:46724327-46724349 TGACGGAGGTTGGCCCTGGCTGG 0: 1
1: 0
2: 0
3: 17
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081914876 Original CRISPR GCCACACCTGCCAACCCTCA TGG (reversed) Intronic
900234791 1:1583113-1583135 GGCTCACCTGCGGACCCTCATGG - Intergenic
900635705 1:3664061-3664083 ACCACACCTGAGAACCCCCAAGG + Intronic
900715239 1:4139893-4139915 GCCTCACCTGCCCACCCGCAGGG - Intergenic
900743463 1:4344370-4344392 GCCACCCCTGCCAGCCTGCAGGG - Intergenic
900920126 1:5664723-5664745 ACAACACCTTCCACCCCTCAGGG + Intergenic
902353991 1:15882785-15882807 CCAACACCTGCCAGCCCTCTAGG - Intronic
902751135 1:18511900-18511922 TCCTCACTTGCCAAACCTCAAGG - Intergenic
903173985 1:21569900-21569922 CCCACACCTGTCAGCACTCAAGG + Intronic
905253075 1:36662164-36662186 AACACACCAGCCAACCCCCAAGG - Intergenic
905278395 1:36833720-36833742 GTCACACCTGCCAACCCACCTGG + Intronic
906726647 1:48049107-48049129 GCCCCATCTGCTAACACTCAGGG - Intergenic
907036234 1:51218820-51218842 GCCACTCCTGCCAAGGCTTAAGG - Intergenic
907518349 1:55007402-55007424 GCCACATCTGCCACATCTCAGGG - Intronic
910073437 1:83247039-83247061 CCCACACCTGTCAACCATCAAGG - Intergenic
910478808 1:87636369-87636391 GCCTCAGCTGCCACCCCACAGGG - Intergenic
912208343 1:107532726-107532748 AGCACACCTGCCCACTCTCAGGG + Intergenic
912449143 1:109758824-109758846 GCCTCATCTGCCTACCCTCTGGG + Intronic
913158554 1:116124194-116124216 GCCACTGCTGCAGACCCTCAGGG - Exonic
915538220 1:156550489-156550511 GCCACACATGCCCACACACAGGG - Intronic
917437234 1:175033785-175033807 GCCCAACCTGGCAAACCTCATGG - Intergenic
920069292 1:203290738-203290760 GCAACAGCTGCCAGCCATCAAGG + Intergenic
920832588 1:209478964-209478986 GCCACTCCTGCAAACCCCTAGGG - Intergenic
920880885 1:209879510-209879532 ACCACACCTGCCATCACTCAGGG - Intergenic
921595056 1:217045640-217045662 GCCACACGTGCTATCCCACATGG - Intronic
924458773 1:244239744-244239766 GACACACCTGCCCAGCCTGAGGG - Intergenic
1064017159 10:11781523-11781545 GCCTCCGCTGCCACCCCTCAGGG - Intergenic
1064119283 10:12605240-12605262 GCCAGACCTTCCTAGCCTCATGG - Intronic
1067414997 10:46096076-46096098 GCCACACCTGCCCTGCCTCTTGG - Intergenic
1067435044 10:46270656-46270678 GCCACACCTGCCCTGCCTCTTGG - Intergenic
1067438711 10:46296341-46296363 GCCACACCTGCCCTGCCTCTTGG + Intronic
1067695944 10:48535813-48535835 GCCAATGCTGACAACCCTCAGGG - Intronic
1069777680 10:70936362-70936384 GCCACAGCAGCTAACCCTAATGG + Intergenic
1069958942 10:72068389-72068411 GCCACATCTGCCTCCCCCCATGG + Intronic
1070932949 10:80273672-80273694 TCCCCACCCACCAACCCTCAGGG - Exonic
1073488790 10:103838957-103838979 GCCCCAGCTGCCAGCCCACAGGG + Intronic
1074198235 10:111207983-111208005 GCCACAGCTGTGCACCCTCAAGG - Intergenic
1075960607 10:126564419-126564441 GCCAAGCCTGCAAACCTTCAAGG + Intronic
1076112746 10:127873366-127873388 GCCACAGGTGCCAGGCCTCAGGG - Intergenic
1076850710 10:133091268-133091290 GCCACACCATCCAACCCTGCAGG - Intronic
1080584075 11:33665952-33665974 TCCAGACCTGCCAACTCTGAAGG + Intronic
1081914876 11:46724274-46724296 GCCACACCTGCCAACCCTCATGG - Intronic
1083707170 11:64524664-64524686 GCCCCACCTCCCAACCTCCAGGG + Intergenic
1085243216 11:75075476-75075498 GCCACACTTACCAACCCTCAGGG + Intergenic
1085620018 11:78030868-78030890 GAGACCCCTGCCAACCCACAAGG + Intronic
1088363270 11:109013182-109013204 GCCAGCCCTGCCAGCCCTCTTGG - Intergenic
1089300830 11:117497731-117497753 GCCTCACCTGCCCAGCCTCCAGG - Intronic
1089752284 11:120660389-120660411 GCCACACTTACCGATCCTCAAGG - Exonic
1089777126 11:120845938-120845960 GCCAGACCTGCCACCTCTCAGGG - Intronic
1090954811 11:131504429-131504451 GCCATTCCTGCCAAGCCCCAAGG - Intronic
1091279602 11:134374462-134374484 ATCCCACCTGCCCACCCTCATGG + Intronic
1091813991 12:3422236-3422258 GCTCCACCTGCCAACCTTCGTGG + Intronic
1091950868 12:4591880-4591902 GCTTCACCTGGCAAGCCTCACGG - Intronic
1092077592 12:5686232-5686254 GCCAAACCTGTCAACCCTGCAGG + Intronic
1094056226 12:26272301-26272323 ACCACACCTGGCAGCCCTGAGGG + Intronic
1094395229 12:29998428-29998450 GCCCCTCCTGCCATCTCTCATGG + Intergenic
1094500352 12:31015825-31015847 TCCGCAGCTGCCAACCCTCCCGG - Intergenic
1096236333 12:49929745-49929767 GCCGCACCTGCCAAGCCACAGGG + Intergenic
1096839583 12:54371954-54371976 GCCTCACCAGCCTACCTTCAGGG + Intronic
1101839705 12:108319235-108319257 ACCATCCCTGTCAACCCTCAGGG + Intronic
1102821606 12:115913705-115913727 ACCACACCTGGCCACCCTCTAGG - Intergenic
1103136660 12:118513484-118513506 GCCCCACTTGCCAAGTCTCAGGG - Intergenic
1103482531 12:121260258-121260280 ACCACACCTGCCAATGCCCAGGG - Intronic
1103738975 12:123078609-123078631 GTCACATCTTCCCACCCTCAGGG + Intronic
1104603873 12:130173105-130173127 ACCCAACCTGCCAACTCTCAGGG + Intergenic
1104879928 12:132063778-132063800 GTCACACCAGCCATCCCTCGAGG + Intronic
1109424418 13:62152210-62152232 CTCAGACCAGCCAACCCTCAGGG + Intergenic
1112421949 13:99260317-99260339 GCAACACATGCCAACTCTCAAGG - Intronic
1113908827 13:113832262-113832284 GCCACCCCTTCCAGGCCTCACGG - Intronic
1117190778 14:53289093-53289115 GCCTCATCTCCCAACCCTCAGGG + Intergenic
1119899083 14:78244609-78244631 ACCCCACCTCCCAACCCTCTGGG + Intronic
1122146378 14:99691295-99691317 GCCTCACCTGCCTCCACTCAGGG - Intronic
1122274531 14:100584948-100584970 GCCACACCTCCCCACCGCCATGG + Intronic
1122460201 14:101888341-101888363 GTCACAGCTTCCAAGCCTCAGGG + Intronic
1125310917 15:38377173-38377195 GCCACACCCAGCTACCCTCAGGG + Intergenic
1128212708 15:65913647-65913669 GCCACAGCAGCCAACCCTACAGG + Intronic
1130692465 15:86095321-86095343 GCCTCACCTCCCAACCTCCAGGG - Intergenic
1132163961 15:99566424-99566446 GCCCCACCGGCCCGCCCTCAGGG - Intronic
1133222127 16:4323303-4323325 CCCACACCTGCCCACCCACCCGG - Intronic
1135755342 16:25092631-25092653 CCCACACCTTCCCACCCTCAGGG - Intergenic
1136234390 16:28905098-28905120 ACCCCACCTGCCAGCCCCCAAGG + Intronic
1138333681 16:56235095-56235117 GCCACAACTCACAACTCTCAGGG + Intronic
1140524239 16:75609069-75609091 CCCACACCTGCTAAGGCTCAGGG - Intronic
1142748804 17:1975040-1975062 GCCGCAGGTGCCAACACTCAGGG - Intronic
1142957517 17:3531729-3531751 GCAGCTCCTGCCTACCCTCAGGG - Intronic
1143211981 17:5195141-5195163 GCCAAACCTGCCACCACTCCTGG + Intergenic
1143963895 17:10742312-10742334 GCGACTCCTGTCCACCCTCATGG + Intergenic
1144505722 17:15828944-15828966 GCCACACCAGGCAGCCCTCTTGG + Intergenic
1145169897 17:20646876-20646898 GCCACACCAGGCAGCCCTCTTGG + Intergenic
1147375071 17:40018396-40018418 GCCACAGCTCCCCACCCTCCTGG - Intergenic
1148191112 17:45679203-45679225 GCCAGACACGCCAACACTCAGGG + Intergenic
1149558229 17:57589493-57589515 GCCAAACCTGCCATAGCTCATGG + Intronic
1151418731 17:73983817-73983839 CCCACAGCTGCCAGCCCTGAGGG - Intergenic
1152640119 17:81445782-81445804 GCCACACCTGCCCAGACCCAGGG + Intronic
1154027694 18:10723968-10723990 GCCACCCCTGCCCACCCACCTGG - Intronic
1156458446 18:37307745-37307767 GCCAGACCTGGCTGCCCTCAAGG + Intronic
1157481127 18:48054405-48054427 CCCACAGCTGCCACCCCCCACGG - Intronic
1158448012 18:57537820-57537842 GCCACACCTGGCTACACTCCAGG + Intergenic
1158448120 18:57538807-57538829 GCCACACCTGGCTACACTCCAGG + Intergenic
1160888963 19:1366891-1366913 TCCACACCTCCCACCCCTCGGGG - Intronic
1161347920 19:3777347-3777369 GCCACACATGCAGACCCTCCTGG + Intergenic
1161626545 19:5330332-5330354 GGGACACCTGCCACCTCTCAGGG + Intronic
1162161843 19:8723870-8723892 GCCACACTTGCCAACCCTCAGGG - Intergenic
1163779398 19:19238440-19238462 GCCACCCCTGCCCACCCTCCAGG - Intronic
1164591009 19:29506859-29506881 GCCTCACCTACCAACCCTATTGG - Intergenic
1164607790 19:29612526-29612548 GCTACACCTGACAGCCCCCAAGG + Intronic
1165759680 19:38313664-38313686 CCCACTCCTGCCAACCACCATGG + Intronic
1168271837 19:55254415-55254437 TCAACACCAGCCACCCCTCAAGG + Intronic
927955012 2:27201879-27201901 GCCAGTCCTGCCAGCCCTCACGG + Intronic
931747354 2:65301730-65301752 GGCACACCTGACACCCCTCGCGG + Intergenic
935407037 2:102719902-102719924 GTCACACCTGCAAAACCTCAGGG + Intronic
935856860 2:107283859-107283881 GCCACACTTGCTACACCTCAAGG - Intergenic
936076318 2:109403950-109403972 GCCACCACAGCCAACACTCAAGG - Intronic
937328160 2:121004631-121004653 GCCACTGTTGCCAACCCTCCTGG - Intergenic
937885858 2:126899651-126899673 TCCACACCTGCCAAGACCCAAGG + Intronic
937987970 2:127647106-127647128 GCCACCCCTGCCGTCACTCAGGG + Intronic
942229204 2:173844006-173844028 GCCACAAGTGCCAACCCAAACGG - Intergenic
942243749 2:173988407-173988429 TCCACATCTGCCAACCTTTAAGG + Intergenic
944669041 2:201980073-201980095 ACCACACCTGGCCAGCCTCAGGG + Intergenic
944999189 2:205330421-205330443 GCAACAACAGCCAGCCCTCAGGG + Intronic
945055108 2:205861502-205861524 CCCACACCAGACAACCCTCCAGG + Intergenic
947537374 2:230948789-230948811 GCCACCTCGCCCAACCCTCAGGG - Intronic
947702337 2:232244842-232244864 GAAAGGCCTGCCAACCCTCATGG + Intronic
948479535 2:238240904-238240926 GCCGCAGCTGCCAACTGTCACGG - Intergenic
1170316250 20:15044105-15044127 GCCCCACCTTCCAACCTCCATGG - Intronic
1171037709 20:21729234-21729256 GCCACAGCAGCCAACCCTGAGGG - Intergenic
1172449636 20:35012862-35012884 GTCACACCTGCTAACACTGAGGG + Intronic
1173235627 20:41243071-41243093 GGCAGACCTCCCAACCTTCAGGG + Intronic
1174487733 20:50871726-50871748 GCCACTCCTGCCACCCCACCAGG - Intronic
1175987482 20:62771185-62771207 GTCACACCTGCCACCTCCCAGGG + Intergenic
1176038271 20:63050693-63050715 GCCACACCCGCCACCCCTGTGGG - Intergenic
1176144632 20:63560094-63560116 GCCTCACCTCCCATCCCGCAGGG - Exonic
1178594039 21:33936713-33936735 GCCACATCTAACAACCTTCAAGG - Intergenic
1179994199 21:44966546-44966568 GCCCTACCTGCCACCCCCCATGG + Intronic
1182874993 22:33684019-33684041 TCCACACCTTCCTACCCTCCTGG - Intronic
1182978586 22:34646752-34646774 GCCATGCCAGTCAACCCTCAGGG + Intergenic
1184867407 22:47209376-47209398 GCCACACCTGCCAGCCCGAGTGG + Intergenic
1185161981 22:49235596-49235618 GCCACACCTGCCTTCCTTCAAGG - Intergenic
1185262985 22:49880482-49880504 GCCCCACCTGCCCTCGCTCACGG - Intronic
950428092 3:12935407-12935429 GCCACAGCTGCCCACCCTGAGGG + Intronic
950677672 3:14564432-14564454 CCCACACCTGCCATGTCTCAGGG + Intergenic
951237789 3:20254947-20254969 GCCTCACCTGGGAAGCCTCACGG - Intergenic
952842921 3:37663475-37663497 GCCCCACCACCCAACCCCCATGG - Intronic
952880889 3:37985724-37985746 GCCACTCCTTCCCACCCTCCTGG - Intergenic
953039558 3:39243359-39243381 GTCAAACCTGCCAAACTTCATGG + Intergenic
958724220 3:97884159-97884181 GCTATACCTGTCAATCCTCAAGG - Intronic
959440039 3:106362823-106362845 GCCACAGATGCCCACCCCCAAGG - Intergenic
959672322 3:108993060-108993082 GACACAACTGACAAACCTCATGG + Intronic
962209092 3:133461509-133461531 GCCCCACCTTCCTATCCTCAGGG + Intronic
964654609 3:159052404-159052426 GCCATACCTGCAAAGCCACAAGG + Intronic
968047277 3:195631394-195631416 CTCACTCCTGCCAACCCTCAGGG + Intergenic
968118512 3:196108182-196108204 CCAACACCTGCCAGCCCTCTAGG - Intergenic
968307336 3:197658530-197658552 CTCACTCCTGCCAACCCTCAGGG - Intergenic
969139871 4:5059276-5059298 CCCAAACCAGCCCACCCTCAAGG + Intronic
970260011 4:14214689-14214711 GACACACCTGCAGACCTTCATGG + Intergenic
970404394 4:15748424-15748446 GCGACTCCTGCCAACTCTCTGGG + Intergenic
970447437 4:16135999-16136021 GACACAGCTGACAACCCACATGG + Intergenic
974131383 4:57760642-57760664 GCCCCACCTGCAAAGCCTTATGG - Intergenic
979851663 4:125578930-125578952 GCTCCACCTGGTAACCCTCAGGG - Intergenic
983626890 4:169811050-169811072 GCTACCCTTGCCAACCCTCCTGG + Intergenic
986601203 5:9474810-9474832 CTTACACCAGCCAACCCTCAAGG + Intronic
992253819 5:74901743-74901765 ACCAGTCCTGCCAACACTCAAGG + Intergenic
995700377 5:114929054-114929076 GCCTCAGCTGCCTCCCCTCAGGG + Intergenic
1000990388 5:167906073-167906095 CTCACACCTGCCAACCCTGCAGG + Intronic
1002966462 6:1970973-1970995 CCCACCCCTGCCCACCCCCATGG - Intronic
1003015399 6:2463443-2463465 GCCTCACATGCTGACCCTCAGGG + Intergenic
1003118676 6:3301636-3301658 GCCCCACCTTCCAACCCCTAGGG + Intronic
1003124550 6:3345942-3345964 GCCACAGCAGCCAACACTCTCGG - Intronic
1004364313 6:14999084-14999106 GCCATTCCTGCCAACCCTCGAGG - Intergenic
1010194312 6:73224413-73224435 GTCACACATCCCTACCCTCAAGG - Intronic
1011497230 6:87948982-87949004 TCCACACCTCCCTGCCCTCATGG + Intergenic
1012549267 6:100452914-100452936 GCCACTCATGCCAGCCCACAGGG + Intronic
1013316872 6:108951691-108951713 GCCACACCCGACGCCCCTCACGG + Intronic
1018212835 6:161498646-161498668 GCTCCACCTGCCGACCCTGATGG + Intronic
1019463853 7:1175652-1175674 CTCACACCTGCTGACCCTCATGG - Intergenic
1019528876 7:1493948-1493970 CCCACACCTGCCAGACCTGAGGG + Intronic
1022837376 7:34131045-34131067 GCCTCACATTCCAACTCTCAGGG + Intronic
1023094165 7:36643386-36643408 GCCACACTTGCCATTCCCCAAGG - Intronic
1024562878 7:50659506-50659528 CCCGAACCTGCCAACGCTCAAGG + Intronic
1026680768 7:72464919-72464941 GCCACCTATGTCAACCCTCATGG + Intergenic
1027155254 7:75762855-75762877 GCCACACCACCCAGGCCTCAGGG - Intergenic
1027291119 7:76711913-76711935 CCCACACCTGTCAACCATCAAGG - Intergenic
1031303055 7:120088170-120088192 ACCACAACTGCTAACCCTCTGGG - Intergenic
1033147523 7:138884023-138884045 GCCCCACCCCCCAACCTTCAGGG + Intronic
1034644877 7:152636627-152636649 GCCACATCAGCAAGCCCTCAAGG + Intergenic
1035556114 8:568636-568658 CCCAAATCAGCCAACCCTCAAGG - Intergenic
1037186318 8:16067726-16067748 GCCACACTTTCCAACCTTCAGGG - Intergenic
1037881652 8:22576388-22576410 GCCACCACTGCCACCCCACAGGG - Intergenic
1039844146 8:41313737-41313759 GTCACACCTGCCCACTCTCCAGG + Intergenic
1041704639 8:60832862-60832884 GCCACATCTGCCAAGCCTTAGGG - Intronic
1047605341 8:126468691-126468713 GCCCCACCCACCAACCTTCAGGG - Intergenic
1047957354 8:129985832-129985854 CCAACACCTGCTCACCCTCAGGG - Intronic
1049285837 8:141774767-141774789 GCCTCCCCTCCCAACACTCAAGG - Intergenic
1049367399 8:142247106-142247128 CCCACACCTGCCCAGGCTCAGGG - Intronic
1049605014 8:143525327-143525349 GCACCACCTGCCACCCCTCAGGG - Intronic
1049991818 9:998445-998467 GCCGCACCTCCCACCTCTCATGG - Intergenic
1052452177 9:28645278-28645300 CCCACAGCTGTCAACCTTCATGG + Intronic
1054773533 9:69105368-69105390 GCCACACCTGCCTGGCCTGAGGG - Intergenic
1057817228 9:98304541-98304563 TCCACACCTGCCCAGCCTAAAGG - Intronic
1059886195 9:118747261-118747283 GCCACAGCTCCCAGCCCTGAGGG + Intergenic
1061073450 9:128326324-128326346 GCCACACCTGCCATACCGTAGGG - Intronic
1061119623 9:128635027-128635049 GCCACACCTTCCCACCCCCAAGG + Intronic
1062597700 9:137306513-137306535 GCCACTGCTGCCCACCCTGAGGG - Intergenic
1062721347 9:138045886-138045908 CCCACACCTGCGAACCCCCAAGG - Intronic
1189707188 X:43770371-43770393 TCCACAGCTGCCAATCCTAAGGG + Intronic
1190050694 X:47146575-47146597 GCCACTTCATCCAACCCTCAGGG - Intronic
1198613385 X:138426400-138426422 GCCACACCTGCTTACTCTCAAGG + Intergenic
1199545014 X:148999182-148999204 GACACCCCTGACAACTCTCAGGG - Exonic
1199680099 X:150218175-150218197 GTCACACCTGCCAGCCCTCTGGG - Intergenic