ID: 1081914881

View in Genome Browser
Species Human (GRCh38)
Location 11:46724317-46724339
Sequence TAGGGTCAACTGACGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081914874_1081914881 21 Left 1081914874 11:46724273-46724295 CCCATGAGGGTTGGCAGGTGTGG 0: 1
1: 0
2: 0
3: 12
4: 168
Right 1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 56
1081914876_1081914881 20 Left 1081914876 11:46724274-46724296 CCATGAGGGTTGGCAGGTGTGGC 0: 1
1: 1
2: 1
3: 26
4: 179
Right 1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG 0: 1
1: 0
2: 0
3: 3
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081914881 Original CRISPR TAGGGTCAACTGACGGAGGT TGG Intronic
900434093 1:2619220-2619242 TGGGGTCATCTGACCTAGGTTGG - Intronic
901226763 1:7617658-7617680 TAGGGTCACCTGAAGGACTTTGG + Intronic
902359383 1:15933953-15933975 TAGAGTCAACTGGCGGGGGCGGG - Exonic
909382775 1:75018880-75018902 TAGGGACAAGTGACAGAGGAAGG - Intergenic
915579011 1:156802227-156802249 TTGAGTGAACTGAAGGAGGTGGG - Intergenic
917339877 1:173965046-173965068 TTGGGTCAACTTAATGAGGTGGG - Exonic
917700706 1:177577926-177577948 TGGGATCAACTGACCTAGGTAGG + Intergenic
1079724827 11:23867780-23867802 TAGGGCCAGCAGACTGAGGTGGG - Intergenic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1089385859 11:118067416-118067438 TAGGGTGAACTGGCCCAGGTGGG + Intergenic
1094788745 12:33883710-33883732 TAGGGTCTATTGATGGAGGGAGG + Intergenic
1103409845 12:120703141-120703163 AAGGGATAACTGAGGGAGGTAGG - Intergenic
1104691262 12:130828094-130828116 TAGGGTCTTCTGATGGAGATGGG - Intronic
1107408425 13:40137008-40137030 TAGGGTGAGCTGACGTAAGTTGG + Intergenic
1107838582 13:44433104-44433126 TAGGATCAAAAGACGGAAGTTGG - Intronic
1108500805 13:51068157-51068179 TAGGGGCAGCTGAGGGTGGTAGG - Intergenic
1111433772 13:88179835-88179857 TAGGGTTAGCAGACTGAGGTGGG + Intergenic
1114654259 14:24306587-24306609 TAGAGCCAACTGATGGATGTTGG - Exonic
1115648031 14:35383886-35383908 AAGGGTAAACTGAGGGAGGGAGG + Intergenic
1117478828 14:56122668-56122690 TAGGGTCCACAGATGGAGTTCGG + Intronic
1118329657 14:64805489-64805511 TAGTGTTAAGTGAAGGAGGTGGG - Intronic
1119517353 14:75258766-75258788 TATGGCCAACTGACGGTGGAGGG + Intronic
1121027240 14:90625578-90625600 TAGGCTCACCTGGCGGAGGTCGG - Intronic
1127100025 15:55554522-55554544 TTGGCTGAACTGACAGAGGTAGG + Intronic
1131947887 15:97647961-97647983 TAGGGGAAACTGAGGGAGGGGGG + Intergenic
1138420025 16:56892939-56892961 TGGGGTCCACTGCAGGAGGTGGG - Exonic
1152125045 17:78441483-78441505 CAGGGTCAACTGCGGGGGGTGGG + Intronic
1159020010 18:63135685-63135707 CAGGGACAATTGACGGAGGAAGG - Intronic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
929030878 2:37649011-37649033 TGGGGTCAGCTGATGGAGGCAGG + Intronic
929724735 2:44413281-44413303 TAGGGTCAAATGAAAGAGGCAGG + Intronic
932008265 2:67949382-67949404 CAGGTTTAACTGACAGAGGTTGG - Intergenic
934856813 2:97734876-97734898 TCGGGACACCTGACGGGGGTGGG + Intronic
942613048 2:177761998-177762020 TAGGGTCAACAGCAGGAGGCGGG + Intronic
947203368 2:227637097-227637119 TGGGATCACCTGACGGGGGTGGG + Intergenic
948557098 2:238820574-238820596 TAGGGGCTACTGGCGGAGGGAGG + Intergenic
1176983385 21:15408511-15408533 TAGGGTCAACATAAGGTGGTTGG + Intergenic
1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG + Intergenic
954190661 3:48958041-48958063 AGGGGTAAACTGACGTAGGTTGG + Intronic
960616279 3:119598949-119598971 TAGGGACAACTAATTGAGGTAGG - Intronic
966747863 3:183295578-183295600 GGGGGTCACCTGAGGGAGGTAGG - Intronic
969495830 4:7525693-7525715 AAGGGACAAGTGACTGAGGTGGG - Intronic
970647732 4:18142058-18142080 TAGGGAGCACTGAAGGAGGTTGG + Intergenic
976993172 4:91395531-91395553 TGGTGTCAACTGAAGGATGTGGG + Intronic
990283950 5:54280949-54280971 TTGGGTCAACTGACACAGGCTGG + Intronic
1000477315 5:161727270-161727292 AAAGTTCAACTGAGGGAGGTGGG + Intergenic
1000946163 5:167425952-167425974 TAGGGTCAATTGAAGGAACTGGG + Intronic
1005701242 6:28402478-28402500 TAGTGTCAAAAGACGGAGATTGG - Intergenic
1014942056 6:127453217-127453239 CAGGGTCAACGGACTGAGGGAGG + Intronic
1019268807 7:134416-134438 TGGGGTCAGCTGACGGAGACTGG - Intergenic
1021119099 7:16777795-16777817 TAGGGTCAGCTTCTGGAGGTTGG + Exonic
1022130192 7:27397757-27397779 TTGGTTCAGCAGACGGAGGTGGG - Intergenic
1036694963 8:10968232-10968254 TGGGGGCAGCTGACGGAGGACGG - Intronic
1051665170 9:19462145-19462167 TATAGACAACTGAGGGAGGTGGG - Intergenic
1060870421 9:127035364-127035386 TTGGATCAACTGAGGGAGGTAGG + Intronic
1061481765 9:130900911-130900933 TAGGGGCACCAGAAGGAGGTAGG + Intergenic
1061687811 9:132296882-132296904 TATCGTCTACTGACAGAGGTAGG - Exonic
1062258662 9:135645355-135645377 TAGTGTCAAGTGCTGGAGGTAGG - Intergenic
1193377008 X:80773349-80773371 TAGGTTGAAATGACAGAGGTGGG - Intronic
1200667756 Y:6048490-6048512 TAGGGTCAACTGTTGGTGGTGGG - Intergenic