ID: 1081915644

View in Genome Browser
Species Human (GRCh38)
Location 11:46728547-46728569
Sequence TCCCCTCCCTGGTGGCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 376}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081915636_1081915644 10 Left 1081915636 11:46728514-46728536 CCCAGGGGGCTGCCATGGCAGGA 0: 1
1: 0
2: 3
3: 43
4: 325
Right 1081915644 11:46728547-46728569 TCCCCTCCCTGGTGGCCTGCAGG 0: 1
1: 0
2: 6
3: 45
4: 376
1081915631_1081915644 24 Left 1081915631 11:46728500-46728522 CCCAGGAAGAAACACCCAGGGGG 0: 1
1: 0
2: 0
3: 16
4: 220
Right 1081915644 11:46728547-46728569 TCCCCTCCCTGGTGGCCTGCAGG 0: 1
1: 0
2: 6
3: 45
4: 376
1081915638_1081915644 -2 Left 1081915638 11:46728526-46728548 CCATGGCAGGAACCAGCCCTATC 0: 1
1: 0
2: 1
3: 25
4: 251
Right 1081915644 11:46728547-46728569 TCCCCTCCCTGGTGGCCTGCAGG 0: 1
1: 0
2: 6
3: 45
4: 376
1081915637_1081915644 9 Left 1081915637 11:46728515-46728537 CCAGGGGGCTGCCATGGCAGGAA 0: 1
1: 1
2: 1
3: 30
4: 271
Right 1081915644 11:46728547-46728569 TCCCCTCCCTGGTGGCCTGCAGG 0: 1
1: 0
2: 6
3: 45
4: 376
1081915633_1081915644 23 Left 1081915633 11:46728501-46728523 CCAGGAAGAAACACCCAGGGGGC 0: 1
1: 0
2: 2
3: 14
4: 168
Right 1081915644 11:46728547-46728569 TCCCCTCCCTGGTGGCCTGCAGG 0: 1
1: 0
2: 6
3: 45
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081915644 Original CRISPR TCCCCTCCCTGGTGGCCTGC AGG Intronic