ID: 1081925050

View in Genome Browser
Species Human (GRCh38)
Location 11:46819387-46819409
Sequence CAGATCATGCAGGACTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 1, 2: 3, 3: 25, 4: 231}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081925050 Original CRISPR CAGATCATGCAGGACTATGA AGG Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905826322 1:41028359-41028381 CAGACCAACCAGGACTCTGATGG - Intronic
905843310 1:41204438-41204460 CAGATCATGCAGGACTATGTGGG - Intronic
906100292 1:43255975-43255997 CAGATTGTGCAGGACCGTGAAGG + Intronic
906166062 1:43687244-43687266 CAGATTAAACATGACTATGAGGG + Intronic
907638346 1:56159100-56159122 CAGATCATGCAGGGATCTGTAGG + Intergenic
907931502 1:59005327-59005349 CAGATCATGCAGGGCTGTACAGG + Intergenic
909305869 1:74075731-74075753 CAGTTCATCCAGGACTGTTACGG + Intronic
910282679 1:85518663-85518685 GAGATCATGCTGGACTATCTAGG - Intronic
912702713 1:111890057-111890079 CAGAACATGGAAGACTCTGAAGG + Intronic
917216959 1:172689022-172689044 CAATCCAGGCAGGACTATGAAGG - Intergenic
917924497 1:179777984-179778006 CAGATGCTCCTGGACTATGATGG + Intronic
917982889 1:180283315-180283337 CTGAACATGTGGGACTATGAGGG - Intronic
919436665 1:197571310-197571332 CAGATCATACAAGGCTTTGAAGG - Intronic
922224082 1:223630198-223630220 CAGATCATGAATGACTTTGTTGG - Intronic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
1063744524 10:8864971-8864993 CATCTTATGCTGGACTATGAAGG + Intergenic
1064349657 10:14565577-14565599 CAAAGCATGCAAGACTATAAAGG + Intronic
1064978873 10:21146505-21146527 CTGATAATGCAGGAGTAGGATGG - Exonic
1066759021 10:38737301-38737323 CAGAACAGGCAGGCCTATGGTGG - Intergenic
1069573152 10:69506708-69506730 CAGGTCACACAGGACCATGAGGG + Intronic
1069869650 10:71525518-71525540 CAGAGCATCCAGGACTAGGGAGG + Intronic
1070924636 10:80211032-80211054 CAGACCATGTGGGACCATGATGG - Intergenic
1073118635 10:101107968-101107990 CTGGTCATGCAGGACTTTGCTGG - Intronic
1074595687 10:114864659-114864681 CAATGCATGCAGGACTAAGAGGG + Exonic
1074872239 10:117586515-117586537 CAGATCTTCCAGGACTATTGGGG - Intergenic
1074918554 10:117983181-117983203 CAGATCATGCAGGGCTCTCTAGG - Intergenic
1075747740 10:124739665-124739687 CAGACCACGCTGGACTATCATGG - Intronic
1076266489 10:129113164-129113186 CAGCTCTTGCAGGAGCATGAAGG - Intergenic
1076297459 10:129397664-129397686 CGGATCCTGCAGGACTTTGTGGG - Intergenic
1076317903 10:129555860-129555882 AAGAACATTCAGGACTCTGACGG - Intronic
1078334005 11:10450166-10450188 GAGGTCATTCAGGACTTTGAGGG + Intronic
1078525466 11:12097562-12097584 CAGATCCTGCAGGGAGATGAGGG + Intronic
1080139880 11:28904028-28904050 GAGATCATGCTGGATTATGGTGG - Intergenic
1080504654 11:32900590-32900612 TAGATCATGCAGGGCTTTGTAGG - Intronic
1080559329 11:33448124-33448146 CAGAACATGCAGGTTTATGTGGG + Intergenic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1082773124 11:57224242-57224264 CAGGTCATGTAGGACCTTGAAGG - Intergenic
1084533078 11:69740789-69740811 GAGATCATCCTGGACTAGGATGG - Intergenic
1084977538 11:72810860-72810882 CAGATCAAGCAGGGCCTTGAAGG + Intergenic
1086860751 11:91922243-91922265 CAGGGCATGCAGGCCTATAAAGG + Intergenic
1086885481 11:92200629-92200651 CAGATCATGCAGGACTGTTTGGG + Intergenic
1086950043 11:92882601-92882623 CAGATGAAGCAGGACAAAGATGG - Intronic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1087342173 11:96920633-96920655 GAGATCATACAGGATTAGGATGG + Intergenic
1088532876 11:110829637-110829659 CAGATCAAGCAGGAAAAAGAAGG + Intergenic
1088673685 11:112168971-112168993 CAGATAATACAGGACCTTGAAGG + Intronic
1088861521 11:113804732-113804754 CAGATCAATCAGCATTATGAAGG - Exonic
1091427790 12:406502-406524 CAGATCATACAGGACCTTGTCGG + Intronic
1091461808 12:648731-648753 CAGATCATGATGGACCCTGAAGG - Intronic
1092737353 12:11595093-11595115 CCGATCATGCAGGACATTGTAGG - Intergenic
1094677210 12:32632566-32632588 CAAATTATGCAGGACTTTGGAGG + Intronic
1100698539 12:97121356-97121378 CAAACCATGCAAGACTAGGAAGG - Intergenic
1102596584 12:113997385-113997407 CAGATCATGCAGGGACATGCAGG + Intergenic
1103085020 12:118056165-118056187 CAGATTATGCTGGATTTTGAGGG - Intronic
1103172597 12:118834282-118834304 CAGATCATGCAGGGACATGTTGG + Intergenic
1103215873 12:119201066-119201088 CAGATCATGTGGGACTTTGAAGG - Intronic
1103387847 12:120547753-120547775 CAGATCATGTGGGGCTTTGAAGG + Intronic
1104112683 12:125718425-125718447 CAGATCCTGCAGGACAGTGCAGG - Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1106358805 13:29010869-29010891 CAGATGGTGGAGGACTATGTGGG + Intronic
1106446374 13:29835923-29835945 TAGATCATGCAGGACCCTGAAGG + Intronic
1106677271 13:31974142-31974164 AAGATCTTGGAGGTCTATGAGGG - Intergenic
1107175219 13:37391953-37391975 CAGATCATGTAGGGCTTTGCAGG + Intergenic
1108161549 13:47645463-47645485 CAGATCATGCAGGGCCCTGTAGG - Intergenic
1108845932 13:54678526-54678548 CAGATCATACAGGAGGGTGAGGG - Intergenic
1109339931 13:61043120-61043142 GAGATCATTCAGGACATTGAAGG + Intergenic
1110027354 13:70557665-70557687 GAGATGATGAAGGACAATGAAGG - Intergenic
1110169709 13:72485954-72485976 CAGATCATGGAGCTCTGTGAGGG - Intergenic
1110480945 13:75975426-75975448 CAGGTCATGAAGGACTGTGTAGG + Intergenic
1114064022 14:19044763-19044785 CAGGGCATGCAGAACTATGGTGG + Intergenic
1114098237 14:19355233-19355255 CAGGGCATGCAGAACTATGGTGG - Intergenic
1115036900 14:28868888-28868910 CAGATCTTGTATGACTATGTAGG + Intergenic
1115657358 14:35456226-35456248 AGGATCATGAAGGACTATTATGG - Intergenic
1120316620 14:82902496-82902518 CAGATCATGCAGTACACTGTAGG - Intergenic
1121691931 14:95884255-95884277 CAGATCGTGCAGGGCCCTGAGGG - Intergenic
1124417930 15:29489697-29489719 CAGAGCCTGCAGCTCTATGAAGG + Intronic
1125379214 15:39069584-39069606 AAGATCTTACAGGTCTATGAAGG + Intergenic
1125896733 15:43308781-43308803 CAGATCATGCAGAGCTTTGGGGG - Intergenic
1130538726 15:84805298-84805320 CAGAAGATGCTGGACTCTGAGGG - Exonic
1130665596 15:85866771-85866793 CAGACCATGCAGGGCTGTGAAGG - Intergenic
1131585593 15:93689604-93689626 CAGTTTATGCAGGGCTTTGAAGG + Intergenic
1131770845 15:95735852-95735874 CAGAACTTGCAGGACAGTGATGG + Intergenic
1136629466 16:31481082-31481104 CACATCATGAAGGCCTTTGACGG + Intergenic
1137913517 16:52403566-52403588 CAGATCATTCAGGCTGATGAGGG - Intergenic
1138044357 16:53705312-53705334 CAGATCATGCAGGATCTTGTAGG - Intronic
1140101226 16:71919190-71919212 CAGACAATGCAGGACCATGTAGG - Intronic
1141067971 16:80929185-80929207 CAAATCCTGCCGCACTATGAGGG + Intergenic
1141183951 16:81773903-81773925 CCCATCATGCAGGACTTTGATGG + Intronic
1144444606 17:15315301-15315323 CAGATCATGCAGGGCCCTAATGG + Intronic
1148724519 17:49779176-49779198 CAGACCAGGCAGGACACTGAAGG + Intronic
1152588777 17:81200864-81200886 CGGAACAGGCAGGGCTATGAGGG + Intronic
1153165857 18:2261588-2261610 CAGACCATACAGGACTTTGTGGG - Intergenic
1153464539 18:5374625-5374647 CAGATGATGCAGAGCTTTGAAGG - Intergenic
1155675879 18:28428009-28428031 AAGATCAAGAAGGACAATGAAGG - Intergenic
1157010317 18:43640589-43640611 CATATAAAGCAGCACTATGATGG + Intergenic
1157104824 18:44764149-44764171 CAGGTCATGCAGGACTCCGCAGG - Intronic
1157732866 18:50019877-50019899 CAGATCATGCAAGAGAAAGAGGG - Intronic
1158191266 18:54831397-54831419 CAGGTCTTGGAGGACTTTGAAGG + Intronic
1159750144 18:72290654-72290676 CAGACAATTCAGGACTAGGATGG + Intergenic
1160269497 18:77371753-77371775 CTGAAGATGCAGGACTATGGTGG - Intergenic
1161451769 19:4350299-4350321 CAGGTCATGCAGGGCTCTGTAGG + Intronic
1161597392 19:5157594-5157616 GAGATCATCCTGGACTATGTGGG - Intergenic
1161657167 19:5523396-5523418 CAAATCATGCAGGCCTTTGTGGG - Intergenic
1167297230 19:48658469-48658491 TAGATCATGCAGGGCTTTGTGGG + Intergenic
1167325087 19:48819479-48819501 CAGATCAGGCAGGGCCTTGAAGG - Intronic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
930277971 2:49335852-49335874 CAGATCATGCATGGCCATGCAGG + Intergenic
931065191 2:58578264-58578286 CAGATCATGCTGGACCTTGTGGG + Intergenic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
933453351 2:82487867-82487889 GAGATCATGAAGGACAGTGAGGG + Intergenic
933583810 2:84158470-84158492 CAGATCATGTAGGTCACTGAAGG + Intergenic
935641860 2:105298510-105298532 CATATCCTACAGGACTTTGAAGG - Exonic
935832851 2:107018656-107018678 CAGGTCATACAGGACTATGTAGG + Intergenic
938481283 2:131663747-131663769 CAGGGCATGCAGAACTATGGTGG + Intergenic
940431975 2:153602747-153602769 CAGATCATTCACTCCTATGATGG - Intergenic
940736042 2:157453633-157453655 TAGAACATGCAGGACCTTGAAGG - Intronic
941721972 2:168821869-168821891 CAGATCATGCAGAGCTTTGCAGG + Intronic
942428134 2:175880757-175880779 TAGATCATGCAGGACCTTCACGG + Intergenic
944219362 2:197286960-197286982 CAGAGCATGCAGGATTTTCAGGG + Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944378048 2:199071706-199071728 CAGATAATCAAGGACTATAAAGG + Intergenic
946133414 2:217625338-217625360 CAGATGAGGCAAGACTATGCAGG - Intronic
946460688 2:219865894-219865916 TAGATCTTGCAGGACCTTGAAGG - Intergenic
947671648 2:231940761-231940783 CGGGTCATGCAGGACCAGGATGG - Intergenic
948086216 2:235250967-235250989 CAGAGCATGCAGGATTTTTAAGG + Intergenic
1169075478 20:2757403-2757425 CAGTTCAGGCAGGCCTGTGATGG + Intronic
1169849964 20:10037389-10037411 CCCATCATCCAGAACTATGAGGG - Intronic
1172601707 20:36188335-36188357 CTTCTCATGCAGGACTCTGAGGG + Exonic
1173107593 20:40152338-40152360 CAGATGAAGCAGAAATATGAGGG + Intergenic
1173338655 20:42134847-42134869 CAGATCATGCAAGACATTGCAGG - Intronic
1173559552 20:43993150-43993172 CGGATCATGCAGGACTTTGCAGG + Intronic
1173749401 20:45465037-45465059 AAGATCATGAAGGACCCTGAAGG - Intergenic
1175899242 20:62353542-62353564 CAGAGCTTGCAGGACCATGGGGG - Intronic
1176958184 21:15129999-15130021 TAGATCATGCAGGATCTTGAAGG + Intergenic
1177469940 21:21547957-21547979 GAGATTATGCTGGACTATCAAGG - Intergenic
1178884456 21:36474501-36474523 CATAACATGCAGGATTATAAAGG - Intronic
1179320776 21:40289228-40289250 AAGAGCATGCAGGAAGATGAGGG + Intronic
1180482514 22:15767397-15767419 CAGGGCATGCAGAACTATGGTGG + Intergenic
1182271259 22:29155175-29155197 CAGAACTTGCAGGACTTTGCTGG - Intronic
949605815 3:5652331-5652353 CAGCTCATTCAGAACCATGAAGG - Intergenic
953394112 3:42553406-42553428 CAGTCCAGCCAGGACTATGAAGG - Exonic
954917716 3:54163137-54163159 CAGATGATGTAGGGCTATGCAGG + Intronic
957105930 3:75887289-75887311 CACATCATTCATTACTATGAGGG + Intergenic
957163558 3:76641490-76641512 TAGATCATGAAGGACAAGGAAGG + Intronic
957849449 3:85787799-85787821 CAGATCATGCAGGACTTGTTAGG - Intronic
958765098 3:98358412-98358434 CAGATCATGCTAGAGTATAAAGG - Intergenic
959399637 3:105883914-105883936 CAGACCATGCAGGGCTTTGTAGG - Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
960034428 3:113088227-113088249 CAGATCATTCAAGCCTAGGAAGG - Intergenic
963182633 3:142375087-142375109 GAGATATTGCAGGACAATGATGG - Intronic
963761377 3:149289684-149289706 CAAATTATGAAGGACTATGATGG + Intergenic
964373950 3:156031269-156031291 CAGATCATGCAGGGCCCTGTTGG + Intergenic
964603979 3:158539061-158539083 CAGATCATGGAAGGATATGATGG + Intronic
965420323 3:168449890-168449912 TGGATCATGCAGGATTATAAAGG - Intergenic
965503084 3:169479486-169479508 CAGACCATGCAAGGCTTTGAAGG + Intronic
965676768 3:171205786-171205808 CAGATCATTCAGGGCTTTGCAGG - Intronic
965824264 3:172714707-172714729 CAGATCATTTAGGACCATGTAGG + Intergenic
965846485 3:172968247-172968269 CAGATCATACAAGAATTTGAGGG - Intronic
966160495 3:176962491-176962513 CAGGTCATGCAGGACCTTGCAGG + Intergenic
969058344 4:4415747-4415769 CAGGTCTTGCAGGACTCTGCTGG + Intronic
971459562 4:26880101-26880123 CAGATCATGCAGCAATTTGCAGG - Intronic
972028448 4:34418574-34418596 CAGATCATGTAGGGCTGTGTAGG - Intergenic
972642609 4:40939290-40939312 CATATCAAACAGGACTAAGAAGG + Intronic
975854451 4:78608409-78608431 CAGATCATGCAGGACCTTTTTGG + Intronic
976001701 4:80381808-80381830 CAGATCATAATGAACTATGAAGG - Intronic
977532277 4:98214435-98214457 CAGATCATACTGGATTAGGATGG - Intergenic
981702296 4:147619934-147619956 CAGATCATGTTGGACCTTGATGG - Intronic
982763871 4:159321147-159321169 AAGATCATGCTGGACTTTAAAGG - Intronic
984191699 4:176613524-176613546 GAGATCATGCTGGAGTAGGATGG + Intergenic
985116876 4:186600275-186600297 CAGAGCATTCAGGTCAATGATGG - Exonic
985606779 5:862154-862176 CTGATCCTGCAGGACTTAGAGGG - Intronic
986754320 5:10821111-10821133 CAGCTAAGGCAGGATTATGAAGG - Intergenic
987493582 5:18614281-18614303 CAGATCTTGCAGTACCATGTTGG + Intergenic
987765476 5:22223453-22223475 CAGATGATGCAAGCCTAGGAAGG + Intronic
988555553 5:32232900-32232922 CAGATCAGGCAGGATAAGGATGG + Intronic
989507315 5:42242426-42242448 CAGTTGATGCAGAACTATGAAGG - Intergenic
990288872 5:54328692-54328714 CAGATCCTTCAGGAATGTGAAGG - Intergenic
990887189 5:60607940-60607962 CAGATCATGCAGAACTTTGTAGG + Intronic
992551139 5:77861443-77861465 GAGATCAGACACGACTATGAAGG + Intronic
993714298 5:91259736-91259758 CAGCTCATGCAGGGCTTTGTAGG - Intergenic
993946214 5:94119901-94119923 CAGATCATGCAGGACTTTATAGG - Intergenic
994502704 5:100600473-100600495 CAGATTATGCAGGGTTATAAAGG + Intergenic
995624190 5:114058718-114058740 CAGATCCTGCAGGGCTTTGCAGG + Intergenic
996682259 5:126240198-126240220 GAGATCATGTTGGACTATTAGGG + Intergenic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
997745695 5:136298396-136298418 CAGGTCATGCAGCACTTTGTAGG + Intronic
999595455 5:153199017-153199039 CTGATCTTGCAAGACTGTGAGGG - Intergenic
1000541028 5:162540233-162540255 CAGATCATGAAGGACTTTATGGG + Intergenic
1001697096 5:173679017-173679039 CAGGTCATGCAGCACTCTGCAGG + Intergenic
1001996992 5:176170132-176170154 CAAATTATGCATGACTTTGAAGG - Intergenic
1002386512 5:178871175-178871197 CAGACCATGTAGGTCTCTGAAGG - Intronic
1003455600 6:6278791-6278813 CAGATCAAGCAGGGCTTTGTAGG + Intronic
1003497589 6:6677916-6677938 CAGACAATGAAGGACTCTGAGGG + Intergenic
1004007801 6:11652833-11652855 CACATCATGCAGGAGGAGGATGG + Intergenic
1004766588 6:18735188-18735210 CAGATCATGCAAGAATATCTGGG + Intergenic
1005073427 6:21883955-21883977 CACATCATCCTGGACTGTGAAGG + Intergenic
1005660200 6:27990511-27990533 CAAATCACACAGGACCATGAAGG + Intergenic
1007793694 6:44329892-44329914 TATATCATCCAGGATTATGAAGG + Intronic
1008662545 6:53682944-53682966 CAGAGCATGCAGGATTATCTAGG + Intergenic
1011772870 6:90694392-90694414 AAGATCATGCAGGACTCTGAAGG + Intergenic
1011801365 6:91019740-91019762 CAGGTCCTGCAGGACTTTGTGGG - Intergenic
1012188126 6:96247298-96247320 CAGATCATGTAGGACTTTGTAGG + Intergenic
1012262042 6:97099168-97099190 CATGTCATGCAGGTGTATGAGGG - Intronic
1015228636 6:130887519-130887541 CAGATCATGCAGGGCCTTGGAGG - Intronic
1016155291 6:140799012-140799034 CAGATAAAGCAGTACTAAGAGGG - Intergenic
1018287898 6:162260318-162260340 TAGATCATACAGTACTCTGAAGG + Intronic
1020576108 7:9930615-9930637 GAGATCATGCCGGAATAGGATGG - Intergenic
1022606271 7:31817440-31817462 CAGATCATGCAGGGCTTTGGAGG + Intronic
1023143833 7:37129517-37129539 CAGATAATGCAGGTCTGTGAAGG - Intronic
1023393398 7:39731568-39731590 CAGATCATGAAGGACTTGAATGG + Intergenic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1030934964 7:115574353-115574375 CAGATATTGCAGAACTATGAGGG - Intergenic
1031220749 7:118962188-118962210 CAGTGCAGGCAGGAGTATGAAGG + Intergenic
1031509095 7:122626141-122626163 CAGATCACACAGGACTTTGCAGG + Intronic
1032686089 7:134235208-134235230 AAGATCATGGAGGACTTTGCAGG - Intronic
1033133732 7:138767767-138767789 CAGATCATGGAGGACCCTGGGGG - Intronic
1033690514 7:143732048-143732070 CAAATCATGGAAGACTATGTTGG - Intergenic
1034550661 7:151818640-151818662 CAGATCTTGCAGGACAGTGAGGG - Intronic
1035479927 7:159173784-159173806 CAGCTCATGGATGACCATGAGGG - Intergenic
1036227659 8:6973418-6973440 CAGATCATGCCGGTTCATGAAGG - Intergenic
1036230113 8:6992577-6992599 CAGATCATGCTGGTTCATGAAGG - Intergenic
1036232565 8:7011680-7011702 CAGATCATGCTGGTTCATGAAGG - Intronic
1038821129 8:30952738-30952760 CAGAGCATGCAGGGCCATGAAGG + Intergenic
1039492208 8:37956305-37956327 GAGATCATGCTGGACTAGGATGG + Intergenic
1043271566 8:78340295-78340317 CAGATCATTTAGGGCTATGCAGG - Intergenic
1043551192 8:81374953-81374975 CAGATCCTGTAGGACTTTGTGGG + Intergenic
1043800896 8:84608330-84608352 CACCTCATGCAGGACTGGGATGG + Intronic
1045328312 8:101133787-101133809 CAGAACATGCAGGCCTCAGAGGG - Intergenic
1045598281 8:103682877-103682899 CAGATACTGCAGCACTATCAAGG - Intronic
1045977382 8:108145074-108145096 CAGATCATGCAGGACCCTCTTGG + Intergenic
1046078284 8:109338064-109338086 CAGATCATGAAGGATCATGTAGG + Intronic
1048087432 8:131198788-131198810 CAGGTTATGCAGCACTCTGAAGG + Intergenic
1050465373 9:5917487-5917509 CAGATCACACAGAGCTATGAAGG + Intronic
1055660122 9:78494872-78494894 CAGATCATGCAAGGCTTTGTGGG + Intergenic
1055697547 9:78903014-78903036 CAGATGATGGAGGGCTGTGAAGG + Intergenic
1056651125 9:88463989-88464011 CAGGTCATGCAGCAATATGCAGG - Intronic
1057208497 9:93186898-93186920 CAGAACCTACAGGACCATGAGGG - Intronic
1058387831 9:104459759-104459781 CAGATTATGGAAGGCTATGAAGG + Intergenic
1059348245 9:113646795-113646817 CAGATCACGCAGGGCCTTGAAGG - Intergenic
1059533253 9:115057533-115057555 CTGATAATTCAGGGCTATGATGG + Intronic
1059592187 9:115673675-115673697 CAGATCATGCATGGCTTTGTAGG - Intergenic
1059604029 9:115813461-115813483 CAGGTCATGAAGGACCATGTGGG - Intergenic
1060463655 9:123882931-123882953 CAGATCATGTAGGACTTTGTAGG - Intronic
1186610149 X:11130997-11131019 CAGCTCATGCATGCCTCTGATGG + Intergenic
1188232150 X:27677663-27677685 CAGGTCATGCAGGACCTTGCAGG + Intronic
1189876065 X:45437400-45437422 GAGATCATCCTGGACTATGGTGG + Intergenic
1189906015 X:45760413-45760435 CAGATCAGGTAGGACTCTGTTGG - Intergenic
1190489342 X:50965394-50965416 CAGATCATGTAGGATTTTGTAGG - Intergenic
1190853077 X:54265553-54265575 CAGATCCTGTAGGACTTTGCAGG + Intronic
1192280119 X:69676116-69676138 CAGATCATGTAGGGCTTTGTAGG + Intronic
1195476259 X:105289262-105289284 CAGATCATGTAGGGCTATGCAGG + Intronic
1195725717 X:107913912-107913934 AAAATCATGCAGGACTTTGTAGG - Intronic
1195994531 X:110718453-110718475 TAGACCATGCAGGATTCTGAAGG - Intronic
1196003794 X:110813914-110813936 CAGATCATGTAGGGCTTTGAAGG + Intergenic
1196963225 X:121026531-121026553 CAAATCATGGAGGACGCTGAAGG - Intergenic
1197865516 X:131012553-131012575 CAGATCATGTAGGGCTGTGGAGG + Intergenic
1197982650 X:132233872-132233894 CAGACCTTGCAGGAATAAGAAGG - Intergenic
1198428559 X:136543402-136543424 CAGATCATGCAGGCCAAGGTTGG + Intronic
1200983304 Y:9281716-9281738 CAGCCCATGCTGGACTATGCTGG - Intergenic
1202127077 Y:21577981-21578003 CAGCCCATGCTGGACTATGCTGG + Intergenic