ID: 1081925690

View in Genome Browser
Species Human (GRCh38)
Location 11:46826515-46826537
Sequence GACCTGGCTTTGCCCCCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081925690_1081925696 22 Left 1081925690 11:46826515-46826537 CCAGGTGGGGGCAAAGCCAGGTC 0: 1
1: 0
2: 1
3: 24
4: 192
Right 1081925696 11:46826560-46826582 ATGCCCAAACAAGCACCCTACGG 0: 1
1: 0
2: 1
3: 9
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081925690 Original CRISPR GACCTGGCTTTGCCCCCACC TGG (reversed) Intronic
900252495 1:1678407-1678429 GCCCTGGCATTGCCGCCACTGGG - Intronic
900530989 1:3153115-3153137 GAACAGGGGTTGCCCCCACCTGG + Intronic
900907017 1:5566351-5566373 ATCCTGGCTCTGCCCCCTCCCGG - Intergenic
901027665 1:6287257-6287279 GACCTGGCCTAAACCCCACCTGG - Intronic
903008850 1:20316399-20316421 GACTTGGGTTTGCAGCCACCTGG + Intronic
903357812 1:22758834-22758856 GACCTGGCTGGGCCCCCAATAGG - Intronic
903372380 1:22844930-22844952 ACCCTGGCTCTGCCCACACCCGG + Intronic
904066397 1:27755205-27755227 GACCTGGCTCTGGACTCACCAGG + Exonic
904263658 1:29305457-29305479 GACCTGGCCCTGCCCGCTCCAGG + Intronic
905172106 1:36115412-36115434 GGCCTGGCTGTGCTCCCGCCAGG - Intronic
905244822 1:36605471-36605493 GGCCTGGCTTTGCCCTGCCCCGG + Intergenic
908457264 1:64315881-64315903 GTCCTGGCTTTGCACTTACCAGG - Intergenic
913498355 1:119448572-119448594 GTCCTGGCTGTGCCCCCTCCTGG - Intergenic
915309584 1:155000606-155000628 GCCCTGGCTCTGCCCTCCCCGGG + Intergenic
916868618 1:168887840-168887862 TACCTGACTCAGCCCCCACCTGG + Intergenic
917913635 1:179678017-179678039 CACCTGTCCCTGCCCCCACCTGG - Intronic
918465031 1:184812380-184812402 GACGTGGCTTGGCCCCCAGCAGG + Intronic
919777241 1:201202208-201202230 CACCTGCCTCTGCCCCCATCTGG - Intronic
919816683 1:201445302-201445324 GACCTGGCTTTTACCTCCCCTGG + Intergenic
923133478 1:231097402-231097424 GTCCTGTCTTTGCCTGCACCTGG + Intergenic
1063138620 10:3237882-3237904 GATCTGGTTCTGCCCCCACCTGG - Intergenic
1066471435 10:35701784-35701806 TACCTGACTGTGGCCCCACCAGG + Intergenic
1066571995 10:36783773-36783795 GTCCGAGCTTTGCTCCCACCAGG + Intergenic
1067029500 10:42870910-42870932 GCCCTGGCTCTGCCACCTCCTGG - Intergenic
1067546483 10:47195916-47195938 GGCCTGGCTTTGTCCCCAAGGGG + Intergenic
1068737385 10:60429647-60429669 GCCCTGGCTTGGCTCCCAACTGG + Intronic
1069830875 10:71281783-71281805 CACCTGGCTCTACCCTCACCAGG - Intronic
1070148663 10:73792277-73792299 GCCTTGGCTTTGCCCCCACCTGG - Exonic
1070399043 10:76036649-76036671 GGCCTGGCTATGCCCTCACTGGG + Intronic
1070561046 10:77566735-77566757 CACCTGGGCTTGCCTCCACCCGG - Intronic
1071023133 10:81082532-81082554 TACCTGCCTTTGCTGCCACCAGG - Intergenic
1071144951 10:82557876-82557898 GAGCTGGCTTTGCACCCAGAAGG + Intronic
1073106710 10:101036464-101036486 GACCTGGCTTTTCCACCCACAGG + Exonic
1074559099 10:114519368-114519390 GACCTGGCCTTGCACCAACCAGG - Intronic
1075730116 10:124631011-124631033 TACCTGGCTCTGGCACCACCTGG - Intronic
1076115238 10:127891078-127891100 TGCCTGGCTGTGCTCCCACCTGG + Intronic
1076421091 10:130332029-130332051 GCCCTGGCTTTGCCTCCAGCTGG + Intergenic
1076452695 10:130567659-130567681 CACCTGCCTTTGCCCACGCCGGG + Intergenic
1076855427 10:133113532-133113554 GGCCTGGCTTGGACCCCACTGGG + Intronic
1077050895 11:566315-566337 CACCTGGCATTGCCCCCTGCTGG - Intergenic
1077152293 11:1077746-1077768 GACCTGGCCCTGACCCCCCCAGG + Intergenic
1081771732 11:45654395-45654417 TCCCTGGCTTTGCCCTCCCCGGG - Intronic
1081925690 11:46826515-46826537 GACCTGGCTTTGCCCCCACCTGG - Intronic
1083864075 11:65444229-65444251 GACCTGGCTCGGAGCCCACCTGG + Intergenic
1084485005 11:69443119-69443141 GCCCTGTCTTTGTCCCCAGCAGG + Intergenic
1084694524 11:70745676-70745698 GAGCTGGCCTGGCCCCCACCTGG + Intronic
1085317266 11:75553229-75553251 GAGCTGGCTCTGCCACCACTGGG - Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1089456904 11:118631138-118631160 AACCTGGCTCTATCCCCACCAGG + Intronic
1089700281 11:120240315-120240337 GCGCTGGCTTTGGCCCCGCCTGG + Intronic
1090429726 11:126635653-126635675 GATGTGGCTTTGACCCCAGCTGG + Intronic
1091590487 12:1839856-1839878 GACCTGTCTTTTCCCCCAAAAGG - Intronic
1093099500 12:15010759-15010781 GGCCTAGCTTTGCCCTCACATGG + Intergenic
1095921955 12:47540642-47540664 AGCCTGGCCTTGCCCCGACCTGG + Intergenic
1102253179 12:111401326-111401348 GGCCTGGCCTGGCCCCCAGCTGG - Intergenic
1103403262 12:120657736-120657758 CACCTGGCTTTGCTGCCCCCGGG + Intronic
1106509826 13:30403199-30403221 GACTTGCCTTTGACCCCATCTGG + Intergenic
1112840699 13:103573682-103573704 CAGCTGGCAATGCCCCCACCCGG - Intergenic
1113644241 13:111981154-111981176 GAGCTGGCTCTGCCCACACCTGG - Intergenic
1113708595 13:112449617-112449639 AACCCGCCTTTGCCACCACCAGG + Intergenic
1117054645 14:51899248-51899270 TGACTGGCTTTGCCTCCACCAGG + Intronic
1119701129 14:76755578-76755600 GTCGTGGCTTTGCTCCCACATGG + Intergenic
1120381690 14:83788908-83788930 TAGCTGGCTTTGCCCCTCCCAGG - Intergenic
1121825355 14:97006003-97006025 GGCCTGTCTTTGCTCCCACGTGG + Intergenic
1122804667 14:104250380-104250402 GAAATGGCAGTGCCCCCACCTGG + Intergenic
1122906921 14:104805851-104805873 GTCCTGGATTTGCCACCAACTGG - Intergenic
1123122621 14:105925011-105925033 AACCTGGCTCTGCCACCAGCAGG - Intronic
1127620373 15:60727915-60727937 GACCTGGCTTCACCTCCTCCTGG + Intronic
1127900389 15:63336757-63336779 GGCCTGGCTTTGCTTCCTCCTGG - Intronic
1129169363 15:73798357-73798379 GACGCGGCTTTGCCCACACTGGG - Intergenic
1131173967 15:90198647-90198669 GACCTGGCTGCTCCCTCACCTGG - Intronic
1132502526 16:290862-290884 GACCTGCCTGCGCCTCCACCCGG - Intronic
1132556525 16:575135-575157 GCCCTGCCTGTGCCCCCAGCAGG + Intronic
1132627510 16:898531-898553 CCCTTGGCTCTGCCCCCACCTGG - Intronic
1133200948 16:4204245-4204267 GCACTGGCTTCGCCCACACCAGG + Intronic
1134038429 16:11049751-11049773 GGCCTAGCTCTGCCCCCAGCAGG + Intronic
1142137039 16:88456204-88456226 AAACTGGCTTTGCCCCGGCCAGG + Intronic
1142224516 16:88871109-88871131 CACATGGCTGTGCCCCCGCCTGG + Intergenic
1142232008 16:88904445-88904467 GACCTGGTGTTGCCCCCACAGGG + Intronic
1142250532 16:88989812-88989834 CACCTGGCTCTTCCCCAACCAGG - Intergenic
1142438381 16:90077504-90077526 GGCCTGGCTTTTCCCGCCCCTGG + Intronic
1143866631 17:9928454-9928476 CACCTGGCTTTGACCACAGCAGG - Intronic
1146063590 17:29619353-29619375 GAGCTGGCAGTGCCCCCTCCTGG - Intronic
1146490403 17:33277353-33277375 GACCTGGCTTTGGTACCAGCTGG + Intronic
1146789350 17:35742737-35742759 GACCTTGCTGTCCCCCCACCAGG - Exonic
1147884664 17:43676558-43676580 TGCCTGGCTTTGCCCCTCCCTGG + Intergenic
1149790361 17:59471398-59471420 GACCTGGTTCTGTCCCCACTGGG - Intergenic
1151362213 17:73595731-73595753 GAACTGACACTGCCCCCACCAGG - Intronic
1151944382 17:77311493-77311515 GCCCAGGCCTTGCCCCCACAGGG - Intronic
1152069402 17:78127549-78127571 GTCCTGGCTCTGCCGTCACCCGG + Intronic
1152199370 17:78936098-78936120 GCCCAGGCTCTGCCCCCACCCGG - Intergenic
1153868182 18:9292472-9292494 GAGCTGCCTTAGCCCCAACCAGG + Intergenic
1161119719 19:2518615-2518637 GCCCTTGCTTTGCTCCCAGCGGG - Intronic
1162054288 19:8053384-8053406 TAACTGGCTTTGCCCACAGCTGG - Intronic
1163584756 19:18157539-18157561 CACCTGGCTGTGCACCCACGGGG + Intronic
1163607588 19:18283543-18283565 CACCTGGCTCTGCCCCCAACTGG + Intergenic
1164743375 19:30593604-30593626 GCCTTGGCTCTGACCCCACCTGG + Intronic
1167383614 19:49151921-49151943 GGCCAGGCTCCGCCCCCACCAGG + Intronic
1167504776 19:49865451-49865473 GGACTGGCTCCGCCCCCACCGGG + Intronic
1167591275 19:50405834-50405856 CTCCTGCCTCTGCCCCCACCTGG + Intronic
1168328371 19:55550283-55550305 TTCCTGGCTTTGTCCCCTCCTGG + Intergenic
1168343219 19:55637709-55637731 CACCTGCCTCTGCCCACACCAGG - Intronic
1168494339 19:56837554-56837576 GGCCTGGCTTTGGCGCCCCCTGG + Intronic
925890551 2:8430809-8430831 GACCTGGGTTTGCCTCCAGGGGG + Intergenic
927484030 2:23476873-23476895 GATCTGCTTTAGCCCCCACCAGG + Intronic
928234418 2:29527476-29527498 GTCCTGGCTTTGCCACGAGCAGG + Intronic
928435991 2:31254772-31254794 GGCCTGAGTTTGCCACCACCTGG + Intronic
929047034 2:37800138-37800160 GAGACAGCTTTGCCCCCACCTGG + Intergenic
929788456 2:45008050-45008072 GGCCTGGCTTTTCCCCATCCAGG + Intronic
930095309 2:47562023-47562045 GACCTGGCTCTGCCACTAACTGG - Intronic
931017648 2:58003381-58003403 CACCTGGCTTTAGCACCACCGGG + Intronic
931792085 2:65672620-65672642 GAACAGGCTTAACCCCCACCTGG - Intergenic
932268743 2:70390506-70390528 GACCTGGCTTACCCCACCCCAGG + Intergenic
932429630 2:71666354-71666376 AACCTGGCTCTGCCCCTAGCTGG - Intronic
935702030 2:105821235-105821257 TAGCTGACTTTGCCCCCAACAGG + Intronic
937319261 2:120951288-120951310 GATCCGGCTTTCCCCGCACCCGG + Exonic
937913251 2:127086472-127086494 GGCCTGGCCTCGCCCCCACATGG + Intronic
938119740 2:128625136-128625158 GACCTGGCTTTGCCCATTCTGGG - Intergenic
940165328 2:150764483-150764505 GACCTGGCCTTGCTCCCTCCTGG + Intergenic
941013949 2:160333416-160333438 TACCTGGGTCAGCCCCCACCAGG + Intronic
946159238 2:217826039-217826061 CACCTGGCCCTGCCCTCACCGGG + Intronic
947622073 2:231597281-231597303 GGCCTGGCCTGGCCCACACCCGG - Intergenic
947864080 2:233384155-233384177 GATCTGGCTTCGACCCCATCAGG + Intronic
1168771139 20:417710-417732 TCCCTCTCTTTGCCCCCACCAGG + Exonic
1169032253 20:2418534-2418556 ACCCTGGCTTTGCCCCTTCCTGG - Intronic
1170156561 20:13274459-13274481 AACCTGCCTTTGCCCCCATCTGG + Intronic
1172009555 20:31838454-31838476 GACATGGCTCAGCCTCCACCGGG - Intergenic
1173148496 20:40545768-40545790 GCCCTGGCTTTGTCCTCACCTGG - Intergenic
1173644156 20:44623078-44623100 GACCTGGCTCTCCCCCTTCCAGG - Exonic
1174570061 20:51495020-51495042 GTTCTTACTTTGCCCCCACCTGG - Intronic
1175534238 20:59696669-59696691 GCCCTGGCTCTGTCCACACCAGG + Intronic
1175584280 20:60125678-60125700 CACCTAGCATTGCCCCCATCTGG + Intergenic
1175732288 20:61362178-61362200 GCACTTGCTGTGCCCCCACCTGG - Intronic
1176002652 20:62839918-62839940 GACCTAGCTCTGCCTCTACCTGG + Intronic
1176097295 20:63350017-63350039 GACCTGGCTTTGGCCAGCCCTGG + Exonic
1178432119 21:32526004-32526026 GAGCTGGGCTTGCCTCCACCTGG + Intergenic
1179101749 21:38360520-38360542 CACCTGCCTATGCCACCACCAGG - Intergenic
1179376304 21:40852755-40852777 GACCAAGCTCTGCCCCCAACTGG - Intergenic
1180072056 21:45441508-45441530 GGCCTGGAGGTGCCCCCACCGGG + Intronic
1182094345 22:27615925-27615947 AACCTGGCTTTGCCACCTCCCGG + Intergenic
1183383347 22:37501472-37501494 GTCCAGGCCCTGCCCCCACCTGG - Intronic
1183746964 22:39697675-39697697 AATCTGGCTTTGTCCCCGCCTGG - Intergenic
1184654214 22:45933050-45933072 CACCTGGCTGAGCCCCCAGCAGG - Intronic
1184785626 22:46670346-46670368 GATCTGGCTCTGCCCACTCCTGG - Intronic
950170509 3:10835658-10835680 GACCAGGCTTTGCCACCTACCGG + Intronic
953571353 3:44074271-44074293 CACCTGGCTTTGTCACCTCCTGG + Intergenic
954986605 3:54799819-54799841 AACCTGGCTCTGCAGCCACCTGG - Intronic
960942730 3:122945240-122945262 GGCCTGCCTTTGCCCCCAGCAGG + Intronic
962381255 3:134899864-134899886 ACCCTTGCTGTGCCCCCACCTGG - Intronic
964170970 3:153768802-153768824 CACCTAGCTTTGCCCCCCTCCGG + Intergenic
965602616 3:170469945-170469967 GACCTGTCCCTGCCCCCACAAGG + Intronic
967876503 3:194271459-194271481 GCCCTGGCTCAGCCCCCTCCAGG + Intergenic
968695455 4:2023616-2023638 CACCTGGTTTTTACCCCACCTGG - Intronic
969176478 4:5402777-5402799 GTCCTGGCCTTGACCCCAACGGG - Intronic
975420432 4:74158051-74158073 GGCCTGGCTCCGCCCTCACCCGG - Intronic
975681799 4:76884898-76884920 GTCCTGGCTTTGGCCCCAATAGG + Intergenic
977777543 4:100938998-100939020 TGCCTGTCTTTGCCCCCACCTGG + Intergenic
980602330 4:135040909-135040931 GACCTGGCTTTGGCCACTGCTGG + Intergenic
982723095 4:158879519-158879541 GAGCTGGCTTTGCCACCAACAGG + Intronic
984695037 4:182770603-182770625 GACCTGGCCAGGTCCCCACCTGG + Intronic
985558347 5:569027-569049 GACCTGGCTCCAGCCCCACCTGG - Intergenic
986174151 5:5337547-5337569 GACCTGGCTGTGGCTCCCCCTGG - Intergenic
989618660 5:43363347-43363369 GACATGGCTCTGCCCTCACGGGG + Intergenic
992476704 5:77109646-77109668 TACCTGGCTTTGCCAGCAACAGG - Intergenic
994634298 5:102324926-102324948 CTCCTGGCTTTGCTCCCAGCTGG + Intergenic
998971304 5:147595418-147595440 GACACAGCTTTGCCCCCTCCAGG + Intronic
1002595308 5:180318209-180318231 GGCCAGGCTTTGGCCCCACTGGG + Intronic
1006177121 6:32129041-32129063 CTCCTGACTTTACCCCCACCTGG - Exonic
1006642328 6:35495868-35495890 GACCTGGTTCTGCCCCTACCTGG + Intronic
1011923947 6:92618237-92618259 GGCCTATCTGTGCCCCCACCTGG - Intergenic
1013494972 6:110689280-110689302 TACCTGACTGAGCCCCCACCTGG + Intronic
1017087051 6:150723240-150723262 GCCCTGGCTCTGCACCCCCCGGG - Intronic
1017767611 6:157619539-157619561 GCCCTGGCCTTGCCACCACCTGG - Intronic
1018114989 6:160574280-160574302 AGCCTGACTTTCCCCCCACCTGG - Intronic
1019510312 7:1414379-1414401 CACCTGGCTGTGCCCCCAGCTGG + Intergenic
1021015501 7:15526166-15526188 GCCCAGGCCTTGCTCCCACCCGG - Intronic
1022426694 7:30276145-30276167 GAACTGCTTTGGCCCCCACCAGG + Intergenic
1026051766 7:66952793-66952815 CTCCTGACTATGCCCCCACCAGG - Intronic
1026564792 7:71481049-71481071 TCCCTGGCTTTGCCCCAAACTGG + Intronic
1026736930 7:72954753-72954775 CACCCGGCTCTGCCCCCGCCCGG + Intergenic
1027106802 7:75410310-75410332 CACCCGGCTCTGCCCCCGCCCGG - Intronic
1029919563 7:104248609-104248631 GGCCTGCCTTTGTCACCACCAGG + Intergenic
1031147631 7:118014562-118014584 CAACTGGCCTTGCCCTCACCTGG + Intergenic
1032085572 7:128881698-128881720 GACATGGCTCTGCATCCACCAGG - Exonic
1034163049 7:149006487-149006509 GACCTTGCTCTGCCCACCCCTGG - Intronic
1034282296 7:149862750-149862772 GTGCTGGCTCTGCCCCCAACTGG + Intronic
1034472589 7:151263436-151263458 GCCCTGTCTTTGCCCTCCCCAGG + Intronic
1034490094 7:151388570-151388592 CTCCTGGCTCTGTCCCCACCTGG + Intronic
1035483022 7:159202442-159202464 GTCCTGGCTTTGGTCCTACCTGG - Intergenic
1036285828 8:7443416-7443438 GACCTGGCTTTGCTCTCTGCTGG + Intronic
1036335645 8:7868113-7868135 GACCTGGCTTTGCTCTCTGCTGG - Intronic
1041401980 8:57455965-57455987 AACCTGGCTTTGCCTACTCCTGG + Intergenic
1041804471 8:61834931-61834953 GACCAGGCTTGGGACCCACCGGG + Intergenic
1042487224 8:69359987-69360009 CACATGACTTTGCCCACACCTGG - Intergenic
1042977082 8:74481283-74481305 GACCTGGCTTAGCCCTGCCCTGG - Intronic
1045502475 8:102754050-102754072 CACCTGACTTTGCTCCCTCCTGG - Intergenic
1047102194 8:121689063-121689085 CATCTGGCTTTGCTCCCACTAGG + Intergenic
1047202464 8:122779295-122779317 TACCTGGCTTCCCTCCCACCTGG + Intergenic
1047215485 8:122872783-122872805 GGCCTGGCTTTGCGCCCAGCTGG + Intronic
1049059296 8:140263724-140263746 GTCCTGGCTTTGCCACCTACTGG - Intronic
1049368497 8:142252344-142252366 GTCCTGGCTGTGCCCCCCACTGG + Intronic
1049445337 8:142627893-142627915 CACCTGGCCCAGCCCCCACCGGG + Intergenic
1052347960 9:27428917-27428939 AAGCTGGCTTTCCCACCACCTGG + Intronic
1053303661 9:36969213-36969235 GGCCTGGCTCTGTCCCCAGCAGG + Intronic
1053421670 9:37983740-37983762 CACATGGCTTTGCAGCCACCGGG + Intronic
1056683466 9:88740168-88740190 GTCCTGGATCTGCCCCCACCTGG - Intergenic
1057236624 9:93366393-93366415 TACCGGGCTCTGCCCCCTCCAGG - Intergenic
1057907439 9:98993645-98993667 GACCTGGCTCTGCCACCTCCAGG - Intronic
1059902159 9:118939989-118940011 GACCTGGCTCTGCCACTAACTGG + Intergenic
1060862733 9:126968408-126968430 GACCTGGCTCTGCCAATACCTGG - Intronic
1061283661 9:129610677-129610699 GGCCTGGCTTTGGCGCCGCCTGG - Intronic
1061765284 9:132877898-132877920 GTCCTGGCTGTGCCGCCAGCGGG - Intronic
1062467678 9:136688201-136688223 CACCTGGCCCGGCCCCCACCCGG + Intergenic
1186218875 X:7328270-7328292 TACCTTGCTTTTCCCCCACTGGG - Intronic
1186908954 X:14141000-14141022 GACCTGAAATTGCCCCCAGCAGG - Intergenic
1189083518 X:37997517-37997539 GACCTGGCTGTGACAGCACCTGG - Intronic
1190323040 X:49189434-49189456 TACCTGACCTTGCCCCCACTGGG + Intronic
1200068672 X:153517449-153517471 GGCCTGGCATTGCCCCCAAAGGG - Intergenic