ID: 1081926671

View in Genome Browser
Species Human (GRCh38)
Location 11:46835313-46835335
Sequence TGCCGTCTGCTCCTTGCTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081926671_1081926674 16 Left 1081926671 11:46835313-46835335 CCACTAGCAAGGAGCAGACGGCA 0: 1
1: 0
2: 2
3: 5
4: 113
Right 1081926674 11:46835352-46835374 GTTTCTAAATACCAAGCAAAAGG 0: 1
1: 0
2: 0
3: 22
4: 237
1081926671_1081926672 -6 Left 1081926671 11:46835313-46835335 CCACTAGCAAGGAGCAGACGGCA 0: 1
1: 0
2: 2
3: 5
4: 113
Right 1081926672 11:46835330-46835352 ACGGCAGAGTATCCAGATCTCGG 0: 1
1: 0
2: 0
3: 6
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081926671 Original CRISPR TGCCGTCTGCTCCTTGCTAG TGG (reversed) Intronic
901123144 1:6911171-6911193 TGCCCTCTGCTCCTTGAACGTGG + Intronic
904883433 1:33717695-33717717 AGCCCTCTTCTCCTTGCTTGTGG - Intronic
916812254 1:168315770-168315792 TTCTGTCTGCTCCAGGCTAGGGG - Intergenic
918245643 1:182657030-182657052 TGCCATCTGCTCCAGGCAAGAGG - Intronic
922346481 1:224700744-224700766 TGCACTCTGCTCCCTGCAAGAGG - Intronic
923460008 1:234201082-234201104 TGTTCTCTGCTGCTTGCTAGTGG - Intronic
1064718548 10:18203733-18203755 TTCCCTCTGCTTTTTGCTAGTGG + Intronic
1065103939 10:22360736-22360758 TGTCGTTTGCTCCTTACTAGAGG + Intronic
1074252234 10:111762648-111762670 TGCCATTTGGTCCTTGCTATGGG + Intergenic
1075520813 10:123142637-123142659 TGCCGGCTGCTTCCTGCAAGCGG + Intergenic
1075731683 10:124640180-124640202 TGACGGCTGCACCTTGCTACAGG + Intronic
1076335853 10:129706058-129706080 TGCCTTCTGCCTCTTGCCAGGGG + Intronic
1078068622 11:8094157-8094179 TCCCTTCTTCTCCTTCCTAGCGG - Exonic
1081916297 11:46732948-46732970 TGGCGTGTGCACATTGCTAGTGG + Intronic
1081926671 11:46835313-46835335 TGCCGTCTGCTCCTTGCTAGTGG - Intronic
1084399819 11:68937023-68937045 GGCCTGCTGCTCCTTGCTGGCGG - Exonic
1084729613 11:71064864-71064886 TGATGTCTGCTCCTTGCCAATGG - Intronic
1086055509 11:82641822-82641844 TCCCCTCTGCTGATTGCTAGTGG - Intergenic
1090905463 11:131070740-131070762 TGCCGTCTTTTCCTTCCTAAGGG + Intergenic
1091784206 12:3232481-3232503 TGCCTTCTGCTCCCTGCAATTGG + Intronic
1095088798 12:38085707-38085729 TGCCAGCTGGTCCTTGCCAGAGG + Intergenic
1095899274 12:47311184-47311206 TGCCCTCTGCTCCTTGCCATGGG + Intergenic
1100016145 12:90013195-90013217 TGCCCTCCTCTGCTTGCTAGTGG + Intergenic
1102119620 12:110429928-110429950 TGCCGCCTGCTCCTCACTGGAGG - Intergenic
1102793846 12:115671706-115671728 TACCATCTCCTCCTTGCTTGAGG - Intergenic
1102804044 12:115763521-115763543 GGCCGCCTTCTCCTTGCTACTGG - Intergenic
1105069497 12:133226154-133226176 TGACGTGGGCTCCTTGCTGGTGG + Intronic
1109892122 13:68629602-68629624 TGGCATCTTCACCTTGCTAGAGG - Intergenic
1113065511 13:106370305-106370327 TGCCGTCTGCACCTTGACACTGG - Intergenic
1113789605 13:113021389-113021411 TGCCTTCTGCCCCTAGCGAGTGG + Intronic
1116260005 14:42613046-42613068 TCCCTTCAGCACCTTGCTAGTGG - Intergenic
1116372139 14:44149816-44149838 TGCTCTCTGCTCCTTCCCAGTGG + Intergenic
1121823988 14:96995477-96995499 TTCCGACTGCTCCTGGCCAGTGG + Intergenic
1122112958 14:99514592-99514614 TGCCCGCTGCTCCTTGCTTTTGG - Exonic
1126739632 15:51764611-51764633 TTCCTTCTGCGCCTTGCTAAGGG - Intronic
1129503950 15:76065452-76065474 TGTCGGCAGCTCCTTCCTAGCGG + Intronic
1129838876 15:78731219-78731241 TGCTGTGTGCTCCTTGCTCTGGG - Intergenic
1130933400 15:88448965-88448987 TGCCGTCTGCTCCCGGATACTGG + Intergenic
1131225892 15:90624190-90624212 TTCCCTCTGCTCCTGGCTGGTGG + Intronic
1131685540 15:94763677-94763699 TGCCCTCTGCCCCTTTTTAGGGG - Intergenic
1134031239 16:10994162-10994184 TGCCGTGTTCTCCTTGTTAATGG + Intronic
1141873333 16:86804666-86804688 TGCTGTCTGCTTGTTGCTTGTGG + Intergenic
1142358298 16:89614262-89614284 TGCCGGCTGTTCCTTCCTTGTGG + Intronic
1142972997 17:3625481-3625503 TGCCGGCTGCTCTTTGCCCGTGG - Intronic
1143010690 17:3864805-3864827 TGACATCTGCTCCCTGCTGGAGG - Intronic
1147666426 17:42151566-42151588 TGCTGCCTGCTGCTTGCAAGTGG - Intronic
1149032648 17:52101492-52101514 AGCTGTATGCTCCTTTCTAGTGG - Intronic
1149993349 17:61394830-61394852 TGGCCTCTGCTCCTTGACAGAGG - Intergenic
1150250480 17:63701655-63701677 TGCCTTCTGCACCTTGCTGTTGG - Intergenic
1151721369 17:75858198-75858220 TGCTGCCTGCTCTTTGCTGGGGG - Intergenic
1203170994 17_GL000205v2_random:147811-147833 TGCCAGCTGGTCCTTGCCAGGGG - Intergenic
1154172089 18:12059725-12059747 TGCCCTCTGCTGCATGCTGGAGG - Intergenic
1157795898 18:50574981-50575003 TGGCCTCTGCTCCTTGCTGAAGG - Intronic
1166843160 19:45711352-45711374 TGCCGTCTGCTCCCTGCTGGTGG + Exonic
932708852 2:74047575-74047597 AGCCTTCTGCTCCTGGCTGGTGG + Exonic
935881583 2:107571006-107571028 AGCCTTCTGCTCCTTCCTGGAGG + Intergenic
936958121 2:118043840-118043862 TGTCTTCTGCTCCTACCTAGTGG + Intergenic
937600773 2:123729102-123729124 TGCCTTCAGATCCTTGCCAGTGG - Intergenic
941158219 2:162004037-162004059 TGCCCTCTGCTCCTTCCACGTGG - Intronic
946716640 2:222560072-222560094 TGCCCTCTCCTGCTTCCTAGTGG + Exonic
947874501 2:233459394-233459416 TGCCATCTGCTCTTTTCTAGGGG + Intronic
948001728 2:234573419-234573441 TGCCTTCTGCTGCTAGCCAGGGG - Intergenic
1170629989 20:18057669-18057691 TCCCGGCTGCTCCCCGCTAGGGG + Exonic
1173173824 20:40748842-40748864 TCCCCTCTGCTCCTTTCTGGTGG - Intergenic
1174835086 20:53849543-53849565 TTCCGTCTGCCCCGTTCTAGTGG - Intergenic
1175012513 20:55754152-55754174 TGGCGTCTGCTGCTTGATGGTGG - Intergenic
1176326978 21:5509642-5509664 TGCCAGCTGGTCCTTGCCAGGGG - Intergenic
1176330730 21:5546569-5546591 TGCCAGCTGGTCCTTGCCAGGGG + Intergenic
1176397027 21:6274382-6274404 TGCCAGCTGGTCCTTGCCAGGGG - Intergenic
1176400779 21:6311309-6311331 TGCCAGCTGGTCCTTGCCAGGGG + Intergenic
1176436378 21:6677795-6677817 TGCCAGCTGGTCCTTGCCAGGGG - Intergenic
1176440130 21:6714722-6714744 TGCCAGCTGGTCCTTGCCAGGGG + Intergenic
1176460640 21:7004865-7004887 TGCCAGCTGGTCCTTGCCAGGGG - Intergenic
1176464392 21:7041791-7041813 TGCCAGCTGGTCCTTGCCAGGGG + Intergenic
1176484201 21:7386643-7386665 TGCCAGCTGGTCCTTGCCAGGGG - Intergenic
1176487953 21:7423570-7423592 TGCCAGCTGGTCCTTGCCAGGGG + Intergenic
1183040312 22:35172919-35172941 CGCTGTCTGCTCCTGGCTGGGGG + Intergenic
1183455114 22:37918417-37918439 TCCCATCTGCTCTTTGCTGGAGG + Intronic
949304982 3:2629536-2629558 TGACTTCTGGTCCTTGCTGGGGG + Intronic
951301231 3:20999570-20999592 TGCATTCTGCTCCTTGCTTTTGG - Intergenic
952924743 3:38312828-38312850 TGCCCTCTGCTCCTCCCTGGTGG - Intronic
954986506 3:54798749-54798771 TGCAGGCTGCTGCTCGCTAGTGG - Intronic
962932562 3:140051532-140051554 TGCCGTCTGCTGGCTGCAAGGGG + Intronic
967930035 3:194684492-194684514 TCCCGTCTGCTCCTAGCTCAGGG + Intergenic
976837882 4:89396466-89396488 TCCCTTCTGCTCCTTTCTTGTGG + Intergenic
981288260 4:143045183-143045205 TGGCGCCTGCTCCTGGCTGGTGG - Intergenic
988071445 5:26293818-26293840 TGGCTTCTGCAGCTTGCTAGAGG + Intergenic
990261307 5:54025951-54025973 AGCCCTCTGCTTCTTGGTAGAGG - Intronic
1006474292 6:34244893-34244915 TGCCGCCTGCTCCTCACTGGAGG + Exonic
1011753801 6:90478963-90478985 TGCAGGGTGCTCCTTTCTAGAGG + Intergenic
1013314426 6:108927431-108927453 TGCAGTGTGCTCCTTCCTTGTGG - Intronic
1013405342 6:109838242-109838264 TGACGGCTGCTCATTGCTATGGG - Intergenic
1013692327 6:112660470-112660492 TGCCTGCTGCCTCTTGCTAGGGG + Intergenic
1013842374 6:114412889-114412911 TGCAGTGTGCTCATTGCTAGTGG - Intergenic
1013965272 6:115948192-115948214 TGCCCTTTGCTCCTTGCTAGAGG - Intronic
1019971847 7:4547843-4547865 TGCCGTGTGTTCACTGCTAGGGG - Intergenic
1024472007 7:49774695-49774717 TGCCCTCGGCCCCTTGCCAGAGG - Intronic
1026227275 7:68453310-68453332 TGCCTGCTGCTCATTGCTTGGGG + Intergenic
1028494055 7:91444573-91444595 TGCAGTCTACTCCCTGCTACTGG - Intergenic
1033120472 7:138663383-138663405 TGCCGCCCGCTTGTTGCTAGAGG + Intronic
1035293963 7:157857379-157857401 TGCCATCTCCTCCTCCCTAGGGG - Intronic
1036085043 8:5604353-5604375 TGACGTGTGCTCCTTCCTGGAGG - Intergenic
1039329947 8:36525960-36525982 TGCTGTCTGCGCCTTGATATTGG + Intergenic
1041228972 8:55730232-55730254 TGCCTTATGCTCTTTGCTAGTGG - Intronic
1041932527 8:63302680-63302702 TGCCCTCTGGTCCTTGCAGGTGG - Intergenic
1045105386 8:98887758-98887780 TGCTGACTGCTCCTTGCTCTGGG - Intronic
1047723963 8:127668732-127668754 TCCCGCCTTCTCCTTGCCAGGGG + Intergenic
1050377289 9:4985703-4985725 TCCCGCCTGCCCCCTGCTAGTGG + Intronic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1053122650 9:35558262-35558284 TGCCGTCCGCGCCGTGCTGGAGG + Exonic
1056243203 9:84669538-84669560 TGCTGTCTGCTTCTGGCCAGTGG + Intronic
1058828098 9:108793016-108793038 TGGGCTCTGCTCCTTGCCAGAGG - Intergenic
1059552623 9:115244697-115244719 TGCCATTTACTCCTAGCTAGAGG + Intronic
1060553884 9:124498644-124498666 TGCCTTCTGCTCATGGCTGGAGG - Intronic
1062236203 9:135509053-135509075 AGCCTTCTGCTTCTTGCCAGTGG - Intergenic
1203431365 Un_GL000195v1:93757-93779 TGCCAGCTGGTCCTTGCCAGGGG - Intergenic
1192808940 X:74532940-74532962 TGCCCTCTGCCCCTAGCCAGGGG - Exonic
1199783628 X:151084557-151084579 TGCCGTCTGCTTCAAGCTGGGGG + Intergenic
1200138099 X:153884762-153884784 TCCCGTCAGCTCCTTGCTGCAGG - Intronic
1202328379 Y:23718156-23718178 TGCCCTCTGCTCCTTATTCGGGG - Intergenic
1202542392 Y:25951897-25951919 TGCCCTCTGCTCCTTATTCGGGG + Intergenic